ID: 946391543

View in Genome Browser
Species Human (GRCh38)
Location 2:219419408-219419430
Sequence CAGTGTAGCCAGAGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 357}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946391543 Original CRISPR CAGTGTAGCCAGAGGGAGAA GGG Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900599568 1:3497251-3497273 CAGTGAAGCCAGGGGGACAGCGG + Exonic
900809495 1:4790631-4790653 CTCTGAAGCCAGAGGGTGAAAGG + Exonic
900967863 1:5971840-5971862 CACTGGAGACAGAGGGAGACGGG + Intronic
901625617 1:10623189-10623211 GAGTGGAGACAGAGGGAGAGGGG - Intronic
902770069 1:18640789-18640811 CAGTGCGACCAGAGGGAGAGAGG + Intronic
903310884 1:22454540-22454562 CAGTCTAGCAAGAAGGGGAAAGG + Intronic
904318708 1:29682661-29682683 CAGTGGGGTCAGAGGGAGCAGGG - Intergenic
904606551 1:31701086-31701108 CAGTCTAGCCAGAGAGTGCAAGG - Intronic
906279729 1:44544889-44544911 CTCTGTACCCAGTGGGAGAATGG - Intronic
906808557 1:48803365-48803387 CACTGTAGGCAGAGGGAGATTGG - Intronic
908466386 1:64400159-64400181 AAGTGAAGCCAGAGTGCGAAGGG - Intergenic
908656609 1:66395056-66395078 CAGAGAACCCAGAGGGATAAGGG + Intergenic
909669115 1:78168441-78168463 CAGTGTAGCCATTGGAAGAGAGG + Intergenic
910562580 1:88607630-88607652 GAGTGTAGATATAGGGAGAAAGG + Intergenic
911171587 1:94776127-94776149 CAGGGAAGCGGGAGGGAGAAAGG - Intergenic
912248793 1:107989771-107989793 AAGGGTAGACAGTGGGAGAAGGG + Intergenic
912903248 1:113675420-113675442 CAGGGAAGCCAAGGGGAGAAAGG + Intronic
913229667 1:116731325-116731347 CTGTGAAGGCTGAGGGAGAAAGG - Intergenic
913255639 1:116950695-116950717 CAGTGGAGACAGAGGGGGCAGGG + Intronic
914421592 1:147533095-147533117 CAGTCTAGGGGGAGGGAGAAAGG + Intergenic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916348371 1:163820478-163820500 CAGATAAGCCAGAGGGAGGAAGG + Intergenic
916518595 1:165543541-165543563 CAGTGTTGCCAGAAGAAGATGGG - Intergenic
918109134 1:181440545-181440567 CAGGGTAGGCAGAGGCAGAAAGG + Intronic
918650024 1:186951149-186951171 GGGTGTAGCCAGTGGGATAAGGG - Intronic
919425186 1:197421235-197421257 CGGTGTAGCCAGATGGACATAGG - Exonic
919962945 1:202490639-202490661 CAGCGTTGCCAGAGGGAAATGGG - Intronic
921156807 1:212445462-212445484 GAGTGTAGAGAGAGGGATAATGG + Intronic
922167284 1:223126882-223126904 TAATGAGGCCAGAGGGAGAAGGG + Intronic
922550953 1:226493960-226493982 CAGTGTCTCCAGAGGGAGTCAGG - Intergenic
923144398 1:231187735-231187757 CTGGGTAGCCAGAGGGACAGCGG + Intronic
923341284 1:233009033-233009055 CAGTGTGGCCAGTAGGAGCAAGG + Intronic
924198554 1:241637043-241637065 CTGTGTGGCCAGAGGTAGAAAGG + Intronic
1065313351 10:24437541-24437563 CAGTGTAGACAGAGCCAAAAGGG + Intronic
1066592986 10:37016117-37016139 AAGTGAAGACAGAGAGAGAAAGG - Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1070055038 10:72926133-72926155 CAGCTTAACCAAAGGGAGAATGG + Intronic
1072231193 10:93415228-93415250 CAGTGAAGTGAGAGGGGGAAAGG - Intronic
1073611838 10:104951819-104951841 AAGATTAGCCAGATGGAGAATGG - Intronic
1074077659 10:110143340-110143362 CAGTGTGCCCAGGTGGAGAAGGG - Intergenic
1074822119 10:117187622-117187644 AAGTCTAGCCAGTGGGAAAAGGG - Intergenic
1075388984 10:122078571-122078593 CAGTGCCCCCAGAGGGTGAAAGG + Intronic
1075674098 10:124283820-124283842 GAGTGGAGCCCGAGGGAGATGGG - Intergenic
1076988510 11:256869-256891 CTGTGAGGCCAGAGGAAGAAGGG + Intergenic
1077378194 11:2215496-2215518 AGGAGTAGCCAGAGGGAGCACGG + Intergenic
1077474851 11:2781515-2781537 CAGTGGGGCCAGAGGGGGAGTGG - Intronic
1077716046 11:4581649-4581671 TAGAGTATCCAGAGGGAAAAGGG + Intergenic
1078578143 11:12518340-12518362 CACTGTAGCCAGAGGGACAGAGG - Intronic
1079056434 11:17210141-17210163 AAGTGAAGCCAGTGGAAGAAAGG - Intronic
1079446503 11:20561575-20561597 CAGGGTTGCTAGAGGGAGACTGG + Intergenic
1079688999 11:23399383-23399405 CAGTGGTGGCAGAGTGAGAATGG + Intergenic
1081190153 11:40094207-40094229 CAGTGTAGCCAGTGGAAGGAAGG + Intergenic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1082655431 11:55850481-55850503 CAGTGAAGTCAGAAGGTGAACGG + Intergenic
1083299476 11:61732801-61732823 CAGCCTGGCCAGAGGGAGAAGGG + Intronic
1083619233 11:64040774-64040796 GGGTGCAGGCAGAGGGAGAAGGG + Intronic
1083672642 11:64307536-64307558 CAGTGTACCCAGAGGGTGCAGGG - Intronic
1087319850 11:96644547-96644569 CTGTTTAGCCAGAGAAAGAAAGG - Intergenic
1088738370 11:112746984-112747006 CAGTGTAGCCTGGGAGGGAAAGG - Intergenic
1088970459 11:114770320-114770342 CAGTGCAGCAAGAGGTAGATGGG - Intergenic
1089606542 11:119644730-119644752 CATTGTAGGCAGAGTGAGGAGGG + Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090744345 11:129694503-129694525 AACTGTAGTCAGAGGGAGAGAGG + Intergenic
1093176208 12:15916135-15916157 CAATTTATCCTGAGGGAGAATGG + Intronic
1093224015 12:16459444-16459466 CAGGCTAACCAAAGGGAGAAAGG - Intronic
1095752321 12:45727284-45727306 AATTGTAACTAGAGGGAGAACGG - Intergenic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1096073520 12:48788754-48788776 CAGTGTTGCCCGAGGGAGTTGGG - Intronic
1096758068 12:53816719-53816741 GAGTTTAGCCAGAGGGGGAGAGG - Intergenic
1097055664 12:56247757-56247779 CAGTGTGGCCAGAGGCAGCTAGG + Exonic
1097250485 12:57629984-57630006 CAGCAGGGCCAGAGGGAGAAAGG - Intronic
1098429567 12:70405005-70405027 AAGAGTGGCCAGAGGGTGAAAGG + Intronic
1098630182 12:72713396-72713418 AAGTGTAGAGACAGGGAGAAGGG + Intergenic
1099553502 12:84078364-84078386 CAATATAGCAAGATGGAGAAGGG + Intergenic
1099639017 12:85260606-85260628 CGGTGGAGGTAGAGGGAGAAGGG - Intronic
1099915700 12:88890301-88890323 TAGTGTAGTCAGAATGAGAAAGG - Intergenic
1100438264 12:94591800-94591822 CAGGATAGCAAGAGGGAGATGGG - Intronic
1100607829 12:96166198-96166220 CTATGTAACCAGAGGCAGAAAGG - Intergenic
1102425585 12:112841762-112841784 TAGTGTATCCAGATTGAGAAAGG + Intronic
1103081402 12:118026866-118026888 CTGTGTAGACAGAGGGGGAAAGG - Intronic
1103921512 12:124401862-124401884 GAGTGCAGCCAGCTGGAGAAAGG - Intronic
1104035239 12:125093004-125093026 TGGTGTCCCCAGAGGGAGAATGG + Intronic
1104058528 12:125248801-125248823 CACAGTGGGCAGAGGGAGAAGGG - Intronic
1104757661 12:131279154-131279176 CAGTGTGGGGAGAGGGAGAGGGG + Intergenic
1104984177 12:132587341-132587363 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984188 12:132587387-132587409 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1105480313 13:20769389-20769411 CACTTTAGCCAGAGGGAGAGGGG - Intronic
1106115771 13:26816316-26816338 CAGAGTAGCCAGAGGCAGAAGGG + Intergenic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1107776678 13:43851512-43851534 CAGTGTAGTTAGGGGGAGACAGG - Intronic
1109200057 13:59420379-59420401 CAGAGTTGACAGAGGTAGAAGGG + Intergenic
1111549220 13:89784719-89784741 CCGTGAAGCCAGAGGGAGCCAGG - Intergenic
1112381306 13:98893174-98893196 CAGTGTAACCAGAGCGAAATCGG + Intronic
1113680202 13:112238605-112238627 CAGTGCAGCCACAGGCTGAAGGG - Intergenic
1115516701 14:34192431-34192453 CAGGGTACCTAGAGGGTGAAGGG + Intronic
1118355249 14:65008402-65008424 CAGGGAAGCCAGAGTGAGCAAGG + Intronic
1118690376 14:68333089-68333111 CAGTATATGCAGAGGCAGAAAGG - Intronic
1119946911 14:78704665-78704687 CAGTGCAGTCAGAGAGATAAGGG + Intronic
1120488700 14:85148852-85148874 CAGTTAAGCAAGAGGAAGAAAGG - Intergenic
1121242527 14:92440735-92440757 CAGGGGAGCCAAAGGGAGAGGGG + Intronic
1121495409 14:94388632-94388654 CAGTGGATCCAGAGGGGCAACGG + Exonic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122201138 14:100123493-100123515 CAGTGTGGTTAGAGGAAGAAAGG - Intronic
1123030965 14:105450856-105450878 CAGTGTCGCCTGACGGAGAGCGG + Intronic
1123458557 15:20447081-20447103 CAGTTTAGCAAGTGGGAAAAGGG - Intergenic
1123659506 15:22553328-22553350 CAGTTTAGCAAGTGGGAAAAGGG + Intergenic
1124264847 15:28223251-28223273 CAGTTTAGCAAGTGGGAAAAGGG - Intronic
1124313367 15:28647823-28647845 CAGTTTAGCAAGTGGGAAAAGGG + Intergenic
1124572684 15:30880229-30880251 AAGTGTAGTGAGAGGGTGAAGGG - Intergenic
1124851654 15:33345379-33345401 CACTCTAGCCAGAGTGACAAAGG - Intronic
1125518862 15:40337447-40337469 CTGTGTAGACAGAGGGAGTCAGG + Intronic
1125832609 15:42727587-42727609 CAGGGAAGCCAAAGGGAGTAGGG + Intronic
1126047206 15:44653242-44653264 CAGAGTAGCTAGGGGAAGAAGGG + Intronic
1128300639 15:66564511-66564533 CAGTGCAGCCAGAGGGGGCAGGG - Intronic
1128349543 15:66879891-66879913 CTGGGGAGCCAGAGGGAGATGGG - Intergenic
1129265956 15:74393180-74393202 CAGTGCAGCCAGAGAGAGGAGGG - Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130520309 15:84656840-84656862 CTGTGTAGACTGGGGGAGAAAGG + Intronic
1130988489 15:88860399-88860421 CAGTGTAGCCAGGGGGGCACAGG - Exonic
1132253614 15:100354207-100354229 CAGTGAATCCAGAGAGAGATGGG - Intergenic
1132336964 15:101053875-101053897 CAGAGTGGCCAGAGGGTGAAAGG + Intronic
1132946825 16:2536401-2536423 CTGTGTCGCCAGAGGGCGAGGGG + Intergenic
1133841769 16:9416548-9416570 CATTGCAGAGAGAGGGAGAATGG + Intergenic
1135399952 16:22159843-22159865 CAGTGTCTTCAGAGGGAGCATGG - Intergenic
1135990827 16:27217788-27217810 CAGGGTTGCCAGAGGGACACAGG - Intronic
1136349870 16:29699773-29699795 AAGTGTAGCCAGATGGACAAGGG - Intergenic
1137500939 16:49011187-49011209 CTGTGTGGCCACAGGGAGAAAGG + Intergenic
1139409822 16:66750743-66750765 GAGTGAGGCCAGAGGGAGTAAGG + Intronic
1139852547 16:69959809-69959831 CCGTGTAGCCAGGGGGACAGTGG - Exonic
1139881518 16:70182717-70182739 CCGTGTAGCCAGGGGGACAGTGG - Exonic
1140370991 16:74412788-74412810 CCGTGTAGCCAGGGGGACAGTGG + Exonic
1140880136 16:79190506-79190528 CAGTGGAGCCAGAGGGTGTGAGG - Intronic
1141324855 16:83046925-83046947 CAGTGTAGCCATCGGGGAAAGGG - Intronic
1141687805 16:85580290-85580312 GCGTGTAGGGAGAGGGAGAAGGG + Intergenic
1141799726 16:86298573-86298595 CATTGCAGAAAGAGGGAGAAAGG + Intergenic
1141992506 16:87618574-87618596 CAGTGTGGCCAGGTGGAAAAAGG - Intronic
1142150411 16:88510159-88510181 CAGTTTACCCATATGGAGAAGGG - Intronic
1142869317 17:2809921-2809943 CAGAGGAGCCAGCGGGAGGAAGG - Intronic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143684161 17:8500534-8500556 GAGTGAAGCCACTGGGAGAAGGG + Intronic
1143898624 17:10156603-10156625 CACTGTAGCCAGAGGGTGCGAGG - Intronic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1145404199 17:22571229-22571251 GAGGGTAGCAAGAGGGAGCAGGG + Intergenic
1146483798 17:33227294-33227316 CAGGGTGGCCACATGGAGAAGGG - Intronic
1146608028 17:34278771-34278793 AAGGGCAGCCAGAGAGAGAAAGG + Intergenic
1146828736 17:36047837-36047859 CAGTGTAGGAAGAGGGAGATGGG - Intergenic
1146953699 17:36923566-36923588 CAGTGTAGCTAAAGGGAGAGAGG + Intergenic
1147129105 17:38395616-38395638 TATTGCAGCCAGAGGGAGGAAGG + Intronic
1148245037 17:46024910-46024932 CAGGGCAGCCTGTGGGAGAAGGG + Exonic
1148249580 17:46064502-46064524 CAGTTTTGGTAGAGGGAGAAAGG - Intronic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1148798584 17:50209576-50209598 CCATGTGGCCAGAGGGGGAAGGG + Intergenic
1152136176 17:78505063-78505085 CAGTGTATCCTTAGGGAGAAAGG - Intronic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1153888907 18:9494322-9494344 TAGTGTAGCCAGAGAGGGCACGG + Intronic
1154484787 18:14865063-14865085 AAGTGTGGCCAGAGGGAGTGGGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156004467 18:32423105-32423127 CAGTGAAGCAACAGAGAGAAGGG + Intronic
1156236964 18:35215156-35215178 CACTTCAGCCAGAAGGAGAAAGG + Intergenic
1157574792 18:48736383-48736405 CAGTGCAGCTGGAGGAAGAAGGG - Intronic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1157840216 18:50950517-50950539 CACTGCAGCCTGAGTGAGAAAGG - Exonic
1157914989 18:51655706-51655728 CCATTTAGCCAGAGAGAGAAAGG - Intergenic
1158933612 18:62344871-62344893 CCGTGCAGGCAGAGGGAGACTGG + Intronic
1160301457 18:77684544-77684566 CAGACTAGACAGAGGGAGCAAGG + Intergenic
1160517442 18:79486465-79486487 TGGTGTAGGCAGCGGGAGAAAGG - Exonic
1161228474 19:3159825-3159847 CAGTCCATCCAGAGGGTGAAAGG + Intronic
1161652968 19:5496551-5496573 CAGTGTAGTCAGGTGGAGCATGG - Intergenic
1161722965 19:5913927-5913949 CTGTGAAGCCAGAGAGGGAAAGG + Intronic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1164472801 19:28550205-28550227 CAGTCTAACCTGAGGGGGAAAGG + Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1166397049 19:42449076-42449098 CTGTGTAGGCACAGGAAGAAAGG + Intergenic
1166934143 19:46320956-46320978 GAGTGAAGGAAGAGGGAGAAAGG - Intronic
1168527878 19:57103327-57103349 CAGTGTAACCAGGTGGATAATGG - Intergenic
924981402 2:225332-225354 TAGTGTAGAAAGAGGCAGAACGG + Intronic
925079932 2:1056040-1056062 CAGAGTGGACACAGGGAGAAGGG + Intronic
925507356 2:4583369-4583391 GAGTGTGGTCAGAGAGAGAAAGG + Intergenic
925574063 2:5341845-5341867 CAATGCAGCCAGAGGAAGGAGGG - Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927600539 2:24436569-24436591 GAGTGGAGCCAGGGGAAGAAGGG - Intergenic
928395937 2:30943373-30943395 CAGTGGATCCAGAGGGTGAAGGG + Intronic
928438004 2:31268419-31268441 CAATGGAGGCTGAGGGAGAAGGG + Exonic
929087711 2:38184605-38184627 CAGTGTGCCCAGAGAGAGAGTGG + Intergenic
929609277 2:43257917-43257939 CAGAGAAGCCAGTGGGAGGAAGG + Intronic
931249143 2:60514990-60515012 CTGTCTCACCAGAGGGAGAACGG - Intronic
931867986 2:66432514-66432536 AAGTGTAGGCAGAGGCATAAAGG + Intergenic
932734567 2:74245672-74245694 CAGTGCAGTCACAGAGAGAAGGG + Intronic
933004085 2:76967864-76967886 CCCATTAGCCAGAGGGAGAATGG - Intronic
933478754 2:82826238-82826260 GGGTGTATTCAGAGGGAGAAGGG + Intergenic
935410803 2:102759886-102759908 CGGAGTGGCCAGAGAGAGAAAGG - Intronic
935956366 2:108380695-108380717 CACTGTGGCCATAGGTAGAATGG - Intronic
936488323 2:112946579-112946601 CAGTGTAGCAAGAGGGAGGGAGG - Intergenic
937098005 2:119248222-119248244 CTGAGTTGCCAGAGGGAGGAAGG - Intronic
938732695 2:134158685-134158707 CAGGGCAGCCAGCGGGAGACGGG - Intronic
938969814 2:136421793-136421815 CAGGGAAGTCAGAGGGAAAAAGG - Intergenic
940497826 2:154456220-154456242 CAGTGTAGCCACAGCTAGAAAGG + Intergenic
940839041 2:158558391-158558413 CAGTATAGCCAGAGGAGGCAGGG + Intronic
941060545 2:160842401-160842423 AAGTGTAGGCAGATGGAGAGGGG + Intergenic
941794221 2:169582553-169582575 GAGTGTAGACAGTGGGAGGAGGG - Intergenic
943484784 2:188465539-188465561 CAGTGTGGGCTGAGGGAGAGAGG - Intronic
943516917 2:188899999-188900021 AAGAGGAGCCAGAGGGAGATCGG - Intergenic
944398635 2:199299549-199299571 CAAGGTAGCCAGAGGGAAAATGG + Intronic
946161607 2:217839191-217839213 CCGTGTGGCCAGAGGAAGAAAGG + Intronic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
947288881 2:228549481-228549503 CAGTATACCCAGAGAGAGAGAGG + Intergenic
1170330347 20:15202811-15202833 CAGTGTAGACAGAAAGAAAAAGG + Intronic
1170341135 20:15328280-15328302 CACTGTGGCCAGAGGGAGAGAGG + Intronic
1170494461 20:16911838-16911860 AAGGGTAGCCAGAGAGAAAAAGG - Intergenic
1170654695 20:18275704-18275726 CAGTTCAGCCAGAGGGTGAGTGG + Intergenic
1170991885 20:21309867-21309889 CAGTGTAGCCAGACTGATAATGG - Intronic
1171562309 20:26136571-26136593 GAGGGTAGCAAGTGGGAGAAGGG + Intergenic
1173001995 20:39111497-39111519 CAGTGGAGCAGGAGGAAGAAGGG + Intergenic
1173347545 20:42214784-42214806 CCATGTACCCAGAGGGAGGAGGG - Intronic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1175171378 20:57083884-57083906 CAGAGCAGCCAGAGTGAGGATGG - Intergenic
1175221108 20:57416944-57416966 TGGTGTGGCCACAGGGAGAAAGG + Intergenic
1176723564 21:10412585-10412607 GAGGGTGGCCAGTGGGAGAAGGG - Intergenic
1176796538 21:13374412-13374434 AAGTGTGGCCAGAGGGAGTGGGG + Intergenic
1177960467 21:27660377-27660399 CAGTATGGCCACATGGAGAATGG + Intergenic
1178793473 21:35721993-35722015 CAGTGTAGCCACAAGGAGAGAGG - Intronic
1179894465 21:44353628-44353650 CAGTGTAGCGAGCTGGAGAGAGG + Exonic
1180304723 22:11065357-11065379 GAGGGTGGCCAGTGGGAGAAGGG - Intergenic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1181159020 22:20945700-20945722 CAGAGTAGCCAGAGAGATAGAGG - Intronic
1181498922 22:23304735-23304757 TAGTGTATCCTAAGGGAGAAGGG + Intronic
1182331752 22:29555887-29555909 CGGGGTTGCCTGAGGGAGAAGGG + Exonic
1182358940 22:29735384-29735406 CTGGGTGGCCAGAGGGACAATGG + Intronic
1182881184 22:33734853-33734875 CATGGTAGCCAGAGGTAGCATGG - Intronic
949525574 3:4900172-4900194 GAGTGTATACAGAGGGAGAGAGG - Intergenic
949712434 3:6887114-6887136 CAGTTTAAACAGTGGGAGAAAGG - Intronic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950149795 3:10678078-10678100 CAGTGTAGCAACTGGGAGCATGG - Intronic
950276118 3:11662563-11662585 TAGTGGAGGCAGTGGGAGAAGGG - Intronic
950659673 3:14459419-14459441 CAGGGTTGCAAGAGGTAGAATGG + Intronic
951204987 3:19916568-19916590 CAATGTAGCCAGAGGTACCAGGG + Intronic
952014466 3:28940521-28940543 CAGTGTTTACAGAGGAAGAAGGG - Intergenic
952460653 3:33522140-33522162 CACTTTAGCTAGAGGGGGAAGGG - Intronic
954853249 3:53620899-53620921 CACTGAGGCCAGAGGAAGAAGGG + Intronic
955031937 3:55230538-55230560 CAGTCTAGGAAGTGGGAGAAGGG - Intergenic
955112339 3:55961197-55961219 CAGTGTAGCTTGGGGGAGTAGGG - Intronic
955210533 3:56936277-56936299 AAGTGAAGGCAGAGAGAGAAGGG + Intronic
956020272 3:64926456-64926478 TATTGTAGCCTGAGGGACAAGGG - Intergenic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
958532398 3:95350187-95350209 CAGTTGAGCAAGAGGCAGAACGG + Intergenic
958564315 3:95788437-95788459 GAATGAAGCCAGAGAGAGAAAGG - Intergenic
960557661 3:119046729-119046751 AAGGGCAGCCAGAGAGAGAAAGG + Intronic
962644262 3:137420386-137420408 CAGTGTGTCCAGGAGGAGAAGGG - Intergenic
962679025 3:137779929-137779951 AACTGTAGCCACAGGGAGAGGGG - Intergenic
963634426 3:147776609-147776631 CAGAGTAGAAATAGGGAGAATGG - Intergenic
963818260 3:149857983-149858005 CCATCTAGCCAGAGAGAGAATGG - Intronic
964514736 3:157495528-157495550 CAATGTAGCCACTGGCAGAATGG + Intronic
964744583 3:160000513-160000535 CAGTTTAGCAAGAGAGAGAAGGG - Intergenic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
967742778 3:193021514-193021536 CAGTGTATCTAGTGGAAGAAAGG + Intergenic
967763308 3:193250094-193250116 CAGTCTAGCAAGACTGAGAAAGG - Intronic
968958980 4:3733309-3733331 CAGTGGAGCTTGAGGGAGCAGGG + Intergenic
969350948 4:6597529-6597551 CAGTTTAGCAAAAGGGATAAAGG + Intronic
969476312 4:7424403-7424425 CAGTGATGCCAGAGGGACAACGG - Intronic
969484844 4:7466555-7466577 CACTGCAGCCAGAGGGAGAATGG - Intronic
972710747 4:41592074-41592096 CAGTGCTATCAGAGGGAGAAGGG - Intronic
973050081 4:45585564-45585586 CCCTGTAGCCAGAGGGTGATTGG + Intergenic
973163317 4:47046101-47046123 CAGAGTGGCCGGAGAGAGAAGGG - Intronic
973336245 4:48959389-48959411 GAGGAGAGCCAGAGGGAGAAGGG + Intergenic
974316138 4:60282924-60282946 CAGTATGGCCACATGGAGAATGG - Intergenic
974557886 4:63475440-63475462 CAGTGATGCAGGAGGGAGAAAGG - Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
980738106 4:136917427-136917449 CTGTGGAGCCAGAGGGAGCCAGG + Intergenic
981107966 4:140902968-140902990 CAGTGGTGCTAGAAGGAGAAAGG + Intronic
982149367 4:152435493-152435515 CAGTGTAGAAAGATTGAGAAAGG - Intronic
983534864 4:168846675-168846697 CAGTCTACCCAGAGGAAGATAGG + Intronic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
984855004 4:184187449-184187471 CAGTGTAGCAAGAGCAAAAAAGG - Intronic
985795462 5:1958649-1958671 CAGTGCAGCCGGAGGGGGATGGG - Intergenic
985819430 5:2149605-2149627 AACTGTAGCCAGCGGGAGACAGG + Intergenic
987322486 5:16783636-16783658 CAATGTGGCCAGCAGGAGAAAGG - Intronic
987739474 5:21887524-21887546 CAGTGTCTCCAGAGGAAGAATGG - Intronic
989973701 5:50555819-50555841 CAATGAAGCCAGGGGAAGAAAGG - Intergenic
990488260 5:56279942-56279964 GAGTGAAGGTAGAGGGAGAAAGG - Intergenic
991414559 5:66379141-66379163 CATTGTAGGCAGAAGGAGAGGGG + Intergenic
991507674 5:67342433-67342455 CAGGGTAGCCACATAGAGAAGGG + Intergenic
991950889 5:71945946-71945968 CAGTGTGGCCACAAGGAGAGGGG + Intergenic
993338285 5:86689331-86689353 CAGTGTAGCCAAAGTGTTAAGGG - Intergenic
995749563 5:115440063-115440085 TAGTAGAGTCAGAGGGAGAAGGG - Intergenic
995815120 5:116158508-116158530 CACTTCAGCCTGAGGGAGAAAGG - Intronic
996646713 5:125826395-125826417 AAGTGGATCCAGAAGGAGAATGG - Intergenic
996700495 5:126445882-126445904 CAGTATAGCCAGAGCAGGAAGGG + Intronic
996813861 5:127551856-127551878 CAGTGCAGCCAGAGCGATAGCGG + Exonic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
999099043 5:149007031-149007053 CACTGTAGCCAGGCGGTGAAAGG + Exonic
999148550 5:149411896-149411918 CTGTGTGCCCAGAGGGATAATGG - Intergenic
999658386 5:153832996-153833018 TAGTGGAGCCAGATGGTGAAAGG + Intergenic
1001492206 5:172163885-172163907 CACTGTGGCCAGAGGGAGCGCGG - Intronic
1001942642 5:175751450-175751472 GAATGTAACCAGAGGGAGAGTGG + Intergenic
1002279769 5:178123476-178123498 CAGGGTAGCCAAAGGGAGTGAGG - Exonic
1002494455 5:179602311-179602333 CAGTCAGGCCAGAGGGAGCAGGG + Intronic
1003015993 6:2468031-2468053 GAGGGTAGACAGAGAGAGAAAGG + Intergenic
1007731713 6:43951491-43951513 CAGTGCAGCCAGAGACAGGAGGG + Intergenic
1007867518 6:44989188-44989210 CAGTGTAACCAAAGGGTGATGGG - Intronic
1008304599 6:49886180-49886202 CAGGGTAGCCAAGGGAAGAAAGG - Intergenic
1008627843 6:53335332-53335354 CAGGGAAGCCAGAGGGAGACAGG - Intronic
1009343797 6:62589620-62589642 CTGTGTAGGCACAGGAAGAAAGG - Intergenic
1009943268 6:70314502-70314524 AAGTGGAGCCAAAGGGAGACAGG + Intergenic
1011344365 6:86352801-86352823 CAGTGGGGCCAAATGGAGAATGG - Intergenic
1012239176 6:96852629-96852651 CAGTATTGCCAGAGAGAGAATGG - Intergenic
1014273727 6:119363621-119363643 CAATGAAACTAGAGGGAGAAAGG + Intergenic
1015195266 6:130518615-130518637 CAGTGTAGCCAGGAGCAGAAAGG - Intergenic
1015464821 6:133537081-133537103 CACTGTAGCAAGATGGGGAATGG + Intergenic
1016458013 6:144251295-144251317 CAGTGTCCTCAGAGGGAGCATGG - Intergenic
1016786434 6:148015674-148015696 GAGTGTACCCAAAGGGAGAGAGG - Intergenic
1017122690 6:151039232-151039254 CAGTGTTGGCACAGGGAGAAGGG + Intronic
1017834491 6:158164915-158164937 CATTCTAGCAAGAGGGAGGAGGG - Intronic
1020077320 7:5266867-5266889 CATTGAAACCAAAGGGAGAAGGG + Intergenic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1021228778 7:18060305-18060327 CTCTGTAGGCAGTGGGAGAATGG - Intergenic
1021423307 7:20470022-20470044 CAGTGTAGCCAGAGGAGGCTGGG - Intergenic
1022495320 7:30849621-30849643 CAGCGGAGGCAGAGGAAGAAGGG - Intronic
1023585887 7:41729322-41729344 CAGTGAAGCCAGAGGTGAAAGGG + Intergenic
1023594142 7:41811036-41811058 CAGTGTAGCCATATAAAGAACGG + Intergenic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024382115 7:48708828-48708850 GAGTTGAGCCAGAGGGATAAAGG - Intergenic
1024903887 7:54353975-54353997 CCCTGAATCCAGAGGGAGAAAGG + Intergenic
1026070291 7:67112796-67112818 CAGGGGAGCCAGATGCAGAACGG + Intronic
1026706619 7:72699473-72699495 CAGGGGAGCCAGATGCAGAACGG - Intronic
1027444304 7:78255104-78255126 CAGTGAACCTAGAGAGAGAAGGG - Intronic
1027504286 7:78996119-78996141 TATTGTTCCCAGAGGGAGAATGG - Intronic
1027827238 7:83131482-83131504 CAGAATAGCCAAAGGGAGAGGGG + Intronic
1028474600 7:91239493-91239515 CAGTGAAGCCAGAGAGGGAAGGG - Intergenic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1030441843 7:109596550-109596572 CAGAGTAGAGACAGGGAGAAGGG + Intergenic
1030860653 7:114621772-114621794 CAGTGTACCCAGCGGCAGGAGGG + Intronic
1032544760 7:132732412-132732434 CAAAGCAGCCAGAGGGAGAACGG + Intergenic
1032750340 7:134833547-134833569 CAGTGTAGCCCTGGGAAGAAGGG + Intronic
1033590621 7:142805336-142805358 CAGTGTTACCTGAGGAAGAATGG - Intergenic
1035136491 7:156708738-156708760 CAGTGTGGGCAGATGGGGAAGGG + Intronic
1035659364 8:1335192-1335214 CGGTGTAGACTGAGAGAGAAAGG - Intergenic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1037709324 8:21342985-21343007 CAGTGTGGCCACAGGAGGAAAGG - Intergenic
1037974289 8:23199165-23199187 AAGTGGAGCCTGAGGGAGATGGG - Intronic
1038154520 8:24976044-24976066 CAGGGTAGCAGGAGAGAGAATGG - Intergenic
1039390844 8:37179823-37179845 AAGAGAAGCCAGAGGGGGAAAGG - Intergenic
1040557826 8:48496656-48496678 AGGTGTAGCCAGATGGAGAGAGG + Intergenic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1042572849 8:70185461-70185483 CAATGAAGGCACAGGGAGAATGG + Intronic
1044893925 8:96867873-96867895 CAGTGAAGACAAAGGGTGAAAGG - Intronic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1046195603 8:110859991-110860013 CAGTGGAGCCAGGGGGAGCCAGG + Intergenic
1047115138 8:121833514-121833536 CAGTGAAGCAAAAGGGATAAGGG + Intergenic
1047858826 8:128941979-128942001 GAGTGGAGCAAGAGAGAGAAGGG - Intergenic
1048373349 8:133799863-133799885 CAGTGTATCATAAGGGAGAAAGG + Intergenic
1048837747 8:138537424-138537446 CAGATCAGCCTGAGGGAGAATGG - Intergenic
1049129820 8:140828361-140828383 GAGTGTAGCCAGAGTGAGACAGG - Intronic
1049446547 8:142634089-142634111 GCGAGGAGCCAGAGGGAGAAGGG + Intergenic
1049879760 8:145053558-145053580 CAGGGAAGCCTGAGGGAGCAGGG + Intronic
1052652512 9:31321930-31321952 CAGTGGAGCCAGTGGGAGCCGGG - Intergenic
1053143761 9:35698281-35698303 CAGTATAGCCCAAGGGACAATGG + Intronic
1054814662 9:69463700-69463722 CAATGTAGGCAGAGGAAGAGAGG + Intronic
1056321091 9:85435143-85435165 AAGGGAAGCCAGAGAGAGAAAGG + Intergenic
1057353911 9:94320316-94320338 CAGGGGAGCCTGAGGGACAACGG - Exonic
1057439187 9:95070177-95070199 CAGAGTAGCCACAGGGCAAACGG - Intronic
1057653839 9:96937274-96937296 CAGGGGAGCCTGAGGGACAACGG + Exonic
1057925350 9:99142088-99142110 CAGTGTGGCCACAGTGGGAATGG - Intronic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1058480231 9:105385553-105385575 CAGTGAAGACAGAGAGAGAGAGG - Intronic
1059467368 9:114477557-114477579 GACTGTAGCCAGTGGGAGAGGGG - Intronic
1059812733 9:117874033-117874055 CAGCGTAGGCAGGGGGAGCAGGG + Intergenic
1061084032 9:128389048-128389070 CTTTGTAGCCAGATGGAAAATGG - Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061514252 9:131079367-131079389 CAGGGTTGCAGGAGGGAGAAGGG + Intronic
1061620215 9:131807120-131807142 CAGAGTAGCCTGAGGGGGAGAGG + Intergenic
1062201595 9:135305816-135305838 GAGAGTAGCGAGAGGGAGAAGGG + Intergenic
1062596628 9:137302576-137302598 CCGGGTGGCCGGAGGGAGAAGGG - Intergenic
1186031930 X:5377639-5377661 GAGTGGAGGGAGAGGGAGAAAGG + Intergenic
1187549753 X:20290377-20290399 CAGTGTGGCCAGTGGGATAGTGG + Intergenic
1187948271 X:24447536-24447558 AAGTGAAGCCACAGGGATAATGG + Intergenic
1188304472 X:28545662-28545684 CATTTTAGCCAGAGAAAGAAAGG - Intergenic
1188312858 X:28639169-28639191 CATTGCTCCCAGAGGGAGAATGG - Intronic
1189368125 X:40405626-40405648 CAGTGAATCCAGAAGGAAAAAGG - Intergenic
1189748382 X:44193704-44193726 GTGTGTAGACAGAGGGAGAGTGG + Intronic
1190472924 X:50800721-50800743 GACTGGAGCCAGATGGAGAATGG + Intronic
1190497513 X:51040803-51040825 GATTGAACCCAGAGGGAGAAAGG + Intergenic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1191715580 X:64191607-64191629 CAATGGAGACAGAGGAAGAACGG - Exonic
1192120244 X:68448499-68448521 CAGTGAACCCAGAGGTAGAGAGG + Intergenic
1192607134 X:72529968-72529990 CAGTCTTGGCAGAGGGACAAAGG - Intronic
1194429056 X:93777981-93778003 CATTCTAGCCAGAAGGACAAAGG + Intergenic
1194503938 X:94709554-94709576 CAATGAAGGCAGAGGGTGAAAGG + Intergenic
1196092592 X:111761902-111761924 AGGTGTAGCCACAGGGGGAAAGG - Intergenic
1196388133 X:115181179-115181201 CAGTGTAACTAGAGGGAAATGGG + Intronic
1196441508 X:115723427-115723449 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1196445039 X:115841416-115841438 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1197665285 X:129216635-129216657 CAGGGTAGCAGGAAGGAGAAGGG + Intergenic
1198842766 X:140876628-140876650 TGGTGTACCCAGAGGGAGCACGG + Intergenic
1199411756 X:147532220-147532242 CAGTGTAGAGGAAGGGAGAATGG - Intergenic
1200115488 X:153768072-153768094 CATAGCATCCAGAGGGAGAAAGG - Intronic
1200770848 Y:7124035-7124057 AGGAGTGGCCAGAGGGAGAATGG + Intergenic
1201298708 Y:12487793-12487815 CAGAGAAGCCAGTGGGAAAATGG + Intergenic