ID: 946392705

View in Genome Browser
Species Human (GRCh38)
Location 2:219426157-219426179
Sequence CCCATCCCTGCCTGGTCACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 319}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946392693_946392705 20 Left 946392693 2:219426114-219426136 CCTCCTCACTGGCCATCCCTCGT 0: 1
1: 1
2: 3
3: 23
4: 219
Right 946392705 2:219426157-219426179 CCCATCCCTGCCTGGTCACAGGG 0: 1
1: 0
2: 2
3: 28
4: 319
946392695_946392705 17 Left 946392695 2:219426117-219426139 CCTCACTGGCCATCCCTCGTGGT 0: 1
1: 0
2: 2
3: 10
4: 115
Right 946392705 2:219426157-219426179 CCCATCCCTGCCTGGTCACAGGG 0: 1
1: 0
2: 2
3: 28
4: 319
946392699_946392705 -6 Left 946392699 2:219426140-219426162 CCCCAACAGCGACATAGCCCATC 0: 1
1: 0
2: 0
3: 1
4: 57
Right 946392705 2:219426157-219426179 CCCATCCCTGCCTGGTCACAGGG 0: 1
1: 0
2: 2
3: 28
4: 319
946392697_946392705 4 Left 946392697 2:219426130-219426152 CCCTCGTGGTCCCCAACAGCGAC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 946392705 2:219426157-219426179 CCCATCCCTGCCTGGTCACAGGG 0: 1
1: 0
2: 2
3: 28
4: 319
946392696_946392705 8 Left 946392696 2:219426126-219426148 CCATCCCTCGTGGTCCCCAACAG 0: 1
1: 0
2: 2
3: 13
4: 147
Right 946392705 2:219426157-219426179 CCCATCCCTGCCTGGTCACAGGG 0: 1
1: 0
2: 2
3: 28
4: 319
946392701_946392705 -8 Left 946392701 2:219426142-219426164 CCAACAGCGACATAGCCCATCCC 0: 1
1: 0
2: 0
3: 9
4: 82
Right 946392705 2:219426157-219426179 CCCATCCCTGCCTGGTCACAGGG 0: 1
1: 0
2: 2
3: 28
4: 319
946392692_946392705 21 Left 946392692 2:219426113-219426135 CCCTCCTCACTGGCCATCCCTCG 0: 1
1: 0
2: 3
3: 28
4: 270
Right 946392705 2:219426157-219426179 CCCATCCCTGCCTGGTCACAGGG 0: 1
1: 0
2: 2
3: 28
4: 319
946392690_946392705 29 Left 946392690 2:219426105-219426127 CCTCTGACCCCTCCTCACTGGCC 0: 1
1: 1
2: 8
3: 70
4: 613
Right 946392705 2:219426157-219426179 CCCATCCCTGCCTGGTCACAGGG 0: 1
1: 0
2: 2
3: 28
4: 319
946392691_946392705 22 Left 946392691 2:219426112-219426134 CCCCTCCTCACTGGCCATCCCTC 0: 1
1: 0
2: 4
3: 45
4: 569
Right 946392705 2:219426157-219426179 CCCATCCCTGCCTGGTCACAGGG 0: 1
1: 0
2: 2
3: 28
4: 319
946392700_946392705 -7 Left 946392700 2:219426141-219426163 CCCAACAGCGACATAGCCCATCC 0: 1
1: 0
2: 0
3: 5
4: 38
Right 946392705 2:219426157-219426179 CCCATCCCTGCCTGGTCACAGGG 0: 1
1: 0
2: 2
3: 28
4: 319
946392698_946392705 3 Left 946392698 2:219426131-219426153 CCTCGTGGTCCCCAACAGCGACA 0: 1
1: 0
2: 1
3: 5
4: 48
Right 946392705 2:219426157-219426179 CCCATCCCTGCCTGGTCACAGGG 0: 1
1: 0
2: 2
3: 28
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946392705 Original CRISPR CCCATCCCTGCCTGGTCACA GGG Exonic