ID: 946394441

View in Genome Browser
Species Human (GRCh38)
Location 2:219436045-219436067
Sequence TGGTGCAAACAGGTGAGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946394433_946394441 16 Left 946394433 2:219436006-219436028 CCTGCATGGGTGCTGTGGAGGGC 0: 1
1: 0
2: 4
3: 16
4: 202
Right 946394441 2:219436045-219436067 TGGTGCAAACAGGTGAGGTATGG 0: 1
1: 0
2: 0
3: 15
4: 154
946394437_946394441 -6 Left 946394437 2:219436028-219436050 CCCTGGATTCTGTGTGGTGGTGC 0: 1
1: 0
2: 0
3: 21
4: 167
Right 946394441 2:219436045-219436067 TGGTGCAAACAGGTGAGGTATGG 0: 1
1: 0
2: 0
3: 15
4: 154
946394438_946394441 -7 Left 946394438 2:219436029-219436051 CCTGGATTCTGTGTGGTGGTGCA 0: 1
1: 0
2: 0
3: 35
4: 596
Right 946394441 2:219436045-219436067 TGGTGCAAACAGGTGAGGTATGG 0: 1
1: 0
2: 0
3: 15
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946394441 Original CRISPR TGGTGCAAACAGGTGAGGTA TGG Intronic
900992641 1:6104936-6104958 AGGTGCAGACAGGTCAGGTAGGG + Exonic
904119169 1:28184938-28184960 AGGTGCAAAAGGGTGAGGTGAGG - Intronic
904568487 1:31442937-31442959 GGGCTCAAAGAGGTGAGGTAAGG - Intergenic
907260465 1:53214449-53214471 TGGTGCATGAAGGTGAAGTAAGG - Exonic
907309086 1:53529191-53529213 TGGTGCAAACAAGGGAAGGAAGG + Intronic
910661787 1:89681358-89681380 TGATGCAAAAAGGTGAGTAAGGG - Intronic
911456245 1:98127838-98127860 AGGTGCAAACAGATGTGGTACGG + Intergenic
913973407 1:143434301-143434323 TGGTGCAACCAGGTGATCCAAGG - Intergenic
914067794 1:144259908-144259930 TGGTGCAACCAGGTGATCCAAGG - Intergenic
914111361 1:144706446-144706468 TGGTGCAACCAGGTGATCCAAGG + Intergenic
919167233 1:193910853-193910875 TGCTGCAGCAAGGTGAGGTATGG - Intergenic
923037124 1:230292120-230292142 TGCTCCAAGCAGGTGAGGAAAGG + Intergenic
1062970705 10:1646113-1646135 AGGTGCACACAGGTGAGTTAGGG + Intronic
1064450127 10:15434692-15434714 TGGTGCAAGAAAGTGAGGGAGGG - Intergenic
1065057778 10:21864258-21864280 TTTTGCAAATAGGTGAGGTAAGG - Intronic
1066194786 10:33088674-33088696 TGGTGTAGACAGGTGGGGTTGGG + Intergenic
1067118201 10:43451853-43451875 TGGTGCAAACTGGCCAGGTGCGG - Intronic
1068272744 10:54750416-54750438 TGGTGAATACAGGTAAGTTAGGG + Intronic
1076408650 10:130230687-130230709 TGGAGAACACAGGTGAGGCAGGG - Intergenic
1076703109 10:132284344-132284366 TGGGGGGAACAGGTGAGGTTGGG + Intronic
1076832804 10:133005207-133005229 TGGTGCATGCAGGTCAGGTGTGG + Intergenic
1087137103 11:94732078-94732100 TGGTGGGGAGAGGTGAGGTAGGG - Intronic
1087334340 11:96824480-96824502 TGGTGCAAACCGGTTAGCCAGGG - Intergenic
1088967931 11:114743442-114743464 TCAAGCAAACTGGTGAGGTAAGG + Intergenic
1090563037 11:127953877-127953899 TGCTGCAAACAGGTGTAGTCTGG + Intergenic
1090737333 11:129621511-129621533 GGGTGCCATCAGGGGAGGTACGG - Intergenic
1098437945 12:70488108-70488130 TGGTCTAAAAAGGCGAGGTATGG - Intergenic
1100217507 12:92467638-92467660 AGGTGCTCACAGGTGGGGTAAGG + Intergenic
1100797029 12:98193165-98193187 TGCTGAAAGCAGGTTAGGTAAGG + Intergenic
1101523592 12:105507232-105507254 GGGTGGAAATAGGTGAGATAAGG - Intergenic
1102747057 12:115258461-115258483 AGGTGGAAACAGAAGAGGTAGGG + Intergenic
1104068670 12:125326697-125326719 TGGTGCAACCAGGACAGGGATGG + Intronic
1104915568 12:132262682-132262704 AGGTGCAGACAGATGAGCTATGG - Intronic
1104915584 12:132262759-132262781 AGGTGCAGACAGATGAGCTATGG - Intronic
1109174250 13:59135792-59135814 TGGTGTCAACAGGTGAGGTGGGG - Intergenic
1114566143 14:23634355-23634377 AGGTGCAAACAGGCTAGGCACGG - Intronic
1115601503 14:34960051-34960073 TGGTGGTACCAGGTGAAGTAGGG + Intergenic
1120523636 14:85552725-85552747 TGGTGCAGACAGGTAAGACACGG + Intronic
1127905690 15:63374160-63374182 TGGGTCAAACAGGGGAGGTGTGG - Intronic
1128614286 15:69097213-69097235 TGGTGCAGTCAGGTGAGCTTGGG - Intergenic
1129198837 15:73986660-73986682 TGCTGCCACCAGGTGATGTAAGG + Intronic
1129653857 15:77510030-77510052 TGATGGAAACAGGAAAGGTAAGG - Intergenic
1131682019 15:94733567-94733589 CTGGGCAAAGAGGTGAGGTAGGG - Intergenic
1131945953 15:97621466-97621488 TTGTGAAAACAGGTGTGGTCAGG + Intergenic
1134508233 16:14824863-14824885 AGGTGAAAACAGGCGAGGTGGGG + Intronic
1134695932 16:16223628-16223650 AGGTGAAAACAGGCGAGGTGGGG + Intergenic
1134975895 16:18571060-18571082 AGGTGAAAACAGGCGAGGTGGGG - Intergenic
1138028652 16:53541923-53541945 TGGTGGAAACAGGCAAGGTCAGG - Intergenic
1138485724 16:57341919-57341941 CCTTGCAAACAGGTGAGGTCAGG + Intergenic
1140348574 16:74239314-74239336 TGATGCCAACAGGTGAGGGCAGG - Intergenic
1147163132 17:38579171-38579193 TGGTGCCAGCAGGTGAGGGAAGG + Intronic
1150678068 17:67261932-67261954 TGGGGCAAAGAGATGAGTTAGGG - Intergenic
1152343312 17:79737249-79737271 TGCTGCACACAGGTGAGGGCAGG + Exonic
1153258208 18:3194510-3194532 TGGTGCACACGGGTGCGATAAGG + Intronic
1156979546 18:43268442-43268464 TGGTGGTAGCAGCTGAGGTATGG - Exonic
1158079625 18:53574466-53574488 TGGGGAAAACTGGGGAGGTAAGG + Intergenic
1162342311 19:10098851-10098873 GGGTGCAAGGAGGTGAGGTGGGG + Intronic
1162350755 19:10147762-10147784 TAGTTGAAACAAGTGAGGTACGG + Intronic
1163704481 19:18804309-18804331 TTGTGCAAACAGGTGGGGTGGGG + Intergenic
1164470216 19:28523630-28523652 CTGTGCAAACAGTTGATGTATGG + Intergenic
1166303541 19:41925230-41925252 TGGGATAAACAGGTGAGGAATGG + Intronic
1167784332 19:51625164-51625186 TGGTGGAAACAGGGAAGGAAAGG + Intronic
925662778 2:6220557-6220579 TGGAGCAAGCAGGGCAGGTATGG + Intergenic
932180131 2:69639554-69639576 TGATGCTACCAGGGGAGGTATGG + Intronic
932492605 2:72131661-72131683 TTGTCCAAACTGGTGAGGGAGGG + Exonic
933627163 2:84614053-84614075 TGGGGGAAACAGGTGGTGTATGG + Intronic
934178100 2:89595268-89595290 TGGTGCAACCAGGTGATCCAAGG - Intergenic
934288400 2:91669559-91669581 TGGTGCAACCAGGTGATCCAAGG - Intergenic
934876879 2:97930015-97930037 TGGGGGGAACAGGTGAGGAATGG - Intronic
934920087 2:98336026-98336048 TGGTGCCTACAGGTGAAGAAGGG - Intronic
935821029 2:106892886-106892908 TGGTGGAAAGAGGGGAGGGAAGG - Intergenic
937984122 2:127630954-127630976 GGGTGCAATGAGGTGAGGTGGGG - Intronic
942428447 2:175883943-175883965 TGGGGCAAGCAGGTGAGGGGAGG + Intergenic
946394441 2:219436045-219436067 TGGTGCAAACAGGTGAGGTATGG + Intronic
947011987 2:225576228-225576250 TGGTGGAACCAGATGAAGTAAGG - Intronic
947156485 2:227166924-227166946 TGGGGCCAGCAGGTGAAGTAAGG + Intronic
1168836750 20:882591-882613 GGGTGCCAACAGGTGGGGCAGGG - Intronic
1168911777 20:1453993-1454015 TGGTGAGAACAGGTGGGGAAAGG - Intronic
1170147707 20:13195301-13195323 TGGTGCAAACAGGAATGGGAAGG - Intergenic
1171034989 20:21707056-21707078 TGGAGCAAACAGGTCAGTTGTGG + Exonic
1171287251 20:23951428-23951450 TGGTGCAAACAAGTCAGGCCTGG - Intergenic
1173151271 20:40568291-40568313 TGCTGCAGACAGGTGAAGTCAGG - Intergenic
1173217508 20:41099543-41099565 TGCTCCAAAAAGGTGAGGGATGG - Intronic
1176512458 21:7759065-7759087 AGGAGCAAACAGGTGAGGAGAGG - Intronic
1176982813 21:15402802-15402824 TGGTTCAAACAAGTTAGGAAAGG - Intergenic
1178646570 21:34389589-34389611 AGGAGCAAACAGGTGAGGAGAGG - Intronic
1179086566 21:38223430-38223452 TGGTGATAACAGCTGAGGGAAGG + Intronic
1179163985 21:38920823-38920845 GGCTGCAAACAGATGAGCTAGGG + Intergenic
1181167794 22:20992714-20992736 TGGTGCAGCCAGGTAAGGCAAGG - Intronic
1182648436 22:31829586-31829608 TGGTGCAAAGAGGTGAAGGTAGG - Intronic
1183134630 22:35874845-35874867 GGGTGCAAAGAGGTGAGTTAGGG - Intronic
1183246887 22:36700904-36700926 TGGTGCAAACGGTTGAGTGATGG - Intronic
951980492 3:28561022-28561044 TGGTAAAAACAGGTCAGGTTTGG + Intergenic
953698623 3:45179285-45179307 TGGAGAAAGCAAGTGAGGTAAGG + Intergenic
953718420 3:45335235-45335257 GGATGCTAACAGGTGAGGGAAGG + Intergenic
954205385 3:49055248-49055270 TGGTACAAACAAGTTAGATAAGG - Intronic
955514341 3:59711805-59711827 TGGTGCAAAGGGGTGGGGAATGG + Intergenic
956282952 3:67577992-67578014 TGGTGAGAGCAGGTGAAGTAAGG + Intronic
956292264 3:67673236-67673258 CAGTGCTAACAGGTGAGGTTGGG - Intergenic
959260093 3:104067427-104067449 TGCTCCAAAGAGGTGAGGGATGG + Intergenic
959823594 3:110766964-110766986 TGGTGACAAAATGTGAGGTATGG + Intergenic
959940833 3:112079246-112079268 TGGTGGAAAGAGGAGAGGAATGG + Intronic
960701469 3:120443260-120443282 TAGTGCCAAGAGGTGAGGAAGGG + Intronic
961009282 3:123425115-123425137 TGGTGCACACAGGTTATGGATGG + Intronic
961651364 3:128418194-128418216 GGGTGCAGACAGGTGAGGAGGGG - Intergenic
963295076 3:143537382-143537404 TGGTGCAGGCAGCTGAGGGATGG - Intronic
967904535 3:194489011-194489033 TGGTGCCAACAGCTGAGGGAGGG - Intronic
968661471 4:1800492-1800514 TGGGGTAAGCAGGTGAGGAAGGG + Intronic
969831151 4:9798125-9798147 TGGTGCAACCAGGTGATCCAAGG + Intronic
969904028 4:10376470-10376492 TGTTGCAGACAGGTGCGGGATGG + Intergenic
970330884 4:14982853-14982875 TGGAGCAAAGGGGTGAGGTGAGG - Intergenic
970586039 4:17515276-17515298 TGGTTCAAAAAGGCGTGGTATGG + Exonic
971230653 4:24798446-24798468 TGGTGCACACAGAGGAGGCATGG - Intronic
972347881 4:38208843-38208865 TGATGCACACATGTGAGGAAAGG - Intergenic
977247187 4:94646610-94646632 CAGTGCAAAAAGGAGAGGTAAGG + Intronic
979741615 4:124158267-124158289 TGGTGAAAAGGGGTGAGTTAAGG + Intergenic
979748352 4:124244778-124244800 TGGTGGAAACAAGAGAGGAACGG - Intergenic
980647868 4:135667073-135667095 TGGTTCTAACAAGTGAAGTAAGG + Intergenic
982745483 4:159101895-159101917 TAGTGCACACAGGTGACTTAAGG + Intergenic
983070054 4:163257170-163257192 TTGTGCAAACAAGTGAGGTCAGG + Intergenic
983670906 4:170236888-170236910 TGGTACATACAGATCAGGTAAGG + Intergenic
984347440 4:178547513-178547535 TAGTGCAAACTGCTGAGGTTTGG + Intergenic
985132793 4:186756242-186756264 TGGTGGAAGCATGTGAGGTTTGG - Intergenic
985900041 5:2780964-2780986 TGGAGCAGAAAGGTGAGGCAGGG - Intergenic
989577468 5:43001462-43001484 TGGTGCAATAAGGTGAGAAAAGG - Intergenic
993434244 5:87872024-87872046 GGGTGGAGAAAGGTGAGGTAAGG - Intergenic
996990077 5:129619052-129619074 TAGTACAAATGGGTGAGGTAGGG + Intronic
998175349 5:139898479-139898501 TGGTGCAGTCAGGTGAGGTCTGG - Intronic
998757642 5:145398431-145398453 GAGTGAAAACAGGGGAGGTAGGG - Intergenic
1005247921 6:23909950-23909972 TGGGGTAAACACCTGAGGTAAGG + Intergenic
1006470462 6:34225949-34225971 TGTTGCAGACAGGTGAGATAAGG - Intergenic
1006826564 6:36940221-36940243 TGGTGGGAACAGGGGAGGCAAGG + Intergenic
1007045942 6:38774272-38774294 TGGAGCTAGTAGGTGAGGTAGGG + Intronic
1007112629 6:39321798-39321820 AGGTGCAAACAGGCCAGGAAAGG + Intronic
1011216897 6:85014749-85014771 TGGTGAACACAGCTGAGGTCAGG + Intergenic
1011477819 6:87764875-87764897 AGGTGGAAAGAGGGGAGGTAGGG + Intergenic
1016663776 6:146611210-146611232 TGCTGCAAGCAGGTGAGGCCGGG + Intronic
1016922848 6:149313410-149313432 AGGTGCAAACAGGGAAGGCACGG - Intronic
1017913266 6:158813255-158813277 GGGTGCAAATAGGGGAGGTCAGG - Intronic
1019293297 7:260911-260933 TGGTGCAAACAGGCCAGGTGGGG + Intergenic
1019556145 7:1632548-1632570 GGGTGCTTACAGGTGAGGTTAGG - Intergenic
1019556149 7:1632569-1632591 TGGTGTGTACAGGTGAGGTGGGG - Intergenic
1021968881 7:25949042-25949064 TGGTGCTGACAGGTAAGGGAAGG - Intergenic
1022341157 7:29469472-29469494 AGGTGCTAGAAGGTGAGGTAAGG - Intronic
1023425794 7:40034839-40034861 TCTTGAAAACTGGTGAGGTATGG + Intronic
1023744271 7:43307818-43307840 TGGGGTAAATAGGTGAGGGATGG + Intronic
1035286825 7:157812123-157812145 TGGTGCACACAGGTGAGCAGAGG + Intronic
1035944651 8:3948379-3948401 TGATGCATACAGGAGAGGGAGGG + Intronic
1036514532 8:9431476-9431498 AGGTGAAAAAAGGTGAGGTGAGG - Intergenic
1038118600 8:24586098-24586120 TGATGGAACCAGGTGAGGCATGG - Intergenic
1039446692 8:37638836-37638858 TGGGGCAAACATGAGAGGTGGGG - Intergenic
1041797027 8:61756141-61756163 TTGTGAAACCAAGTGAGGTAAGG - Intergenic
1046002802 8:108442265-108442287 TGGAGCCGACAGGTGAGGAATGG + Intergenic
1048612890 8:136042929-136042951 TGGTACAAAAATGTGATGTAGGG - Intergenic
1049358469 8:142200388-142200410 TGATGCAAACACAAGAGGTAGGG + Intergenic
1051900232 9:22030537-22030559 AGGTGGAAAAAGATGAGGTATGG + Intronic
1052743910 9:32421016-32421038 TGGTGCAAACAGGTAAGTGAAGG + Exonic
1053156781 9:35786546-35786568 TGGAGCAGACAGGTGAAATATGG + Intergenic
1056650678 9:88458558-88458580 TGCTGCTAACAGGTGTGGGAGGG + Intronic
1059842234 9:118230538-118230560 TGGTGCAAAAAGGTGGGGTTGGG - Intergenic
1060557853 9:124518394-124518416 TGGAGGAAACAGTTCAGGTATGG + Exonic
1062675483 9:137740748-137740770 TGCTGCAAACAAGTGAAGAATGG - Intronic
1185557317 X:1031681-1031703 CGGTGCTGACAGGTGAGGTGCGG + Intergenic
1186371126 X:8948512-8948534 TGGTGTAAAAAGGTGATGTTTGG - Intergenic
1189269697 X:39742386-39742408 TGTTGCAAACAACTGAGGTTTGG + Intergenic
1189489370 X:41457740-41457762 CGGTGCAAACAGCTGTGGTTGGG + Intronic
1193437388 X:81492546-81492568 TGTTGAAAAGAGCTGAGGTAAGG - Intergenic
1193669029 X:84360580-84360602 TGGTGCCAAGAGCTGAGGGAGGG - Intronic
1196436835 X:115682382-115682404 TGGGCCAAACAGAGGAGGTACGG - Intergenic
1199451006 X:147979082-147979104 TGCTGCAAACCCGTGAGGCATGG - Intergenic