ID: 946394471

View in Genome Browser
Species Human (GRCh38)
Location 2:219436195-219436217
Sequence CAGTGTGAAGAAAAGGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 410}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946394466_946394471 -5 Left 946394466 2:219436177-219436199 CCCATAGATTTCCAGGTGCAGTG 0: 1
1: 0
2: 2
3: 26
4: 173
Right 946394471 2:219436195-219436217 CAGTGTGAAGAAAAGGCTGAGGG 0: 1
1: 0
2: 3
3: 44
4: 410
946394460_946394471 12 Left 946394460 2:219436160-219436182 CCAGTGCTTGTCCCCCGCCCATA 0: 1
1: 0
2: 0
3: 9
4: 89
Right 946394471 2:219436195-219436217 CAGTGTGAAGAAAAGGCTGAGGG 0: 1
1: 0
2: 3
3: 44
4: 410
946394464_946394471 -1 Left 946394464 2:219436173-219436195 CCCGCCCATAGATTTCCAGGTGC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 946394471 2:219436195-219436217 CAGTGTGAAGAAAAGGCTGAGGG 0: 1
1: 0
2: 3
3: 44
4: 410
946394462_946394471 1 Left 946394462 2:219436171-219436193 CCCCCGCCCATAGATTTCCAGGT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 946394471 2:219436195-219436217 CAGTGTGAAGAAAAGGCTGAGGG 0: 1
1: 0
2: 3
3: 44
4: 410
946394463_946394471 0 Left 946394463 2:219436172-219436194 CCCCGCCCATAGATTTCCAGGTG 0: 1
1: 0
2: 0
3: 5
4: 76
Right 946394471 2:219436195-219436217 CAGTGTGAAGAAAAGGCTGAGGG 0: 1
1: 0
2: 3
3: 44
4: 410
946394467_946394471 -6 Left 946394467 2:219436178-219436200 CCATAGATTTCCAGGTGCAGTGT 0: 1
1: 0
2: 1
3: 10
4: 159
Right 946394471 2:219436195-219436217 CAGTGTGAAGAAAAGGCTGAGGG 0: 1
1: 0
2: 3
3: 44
4: 410
946394465_946394471 -2 Left 946394465 2:219436174-219436196 CCGCCCATAGATTTCCAGGTGCA 0: 1
1: 0
2: 0
3: 9
4: 128
Right 946394471 2:219436195-219436217 CAGTGTGAAGAAAAGGCTGAGGG 0: 1
1: 0
2: 3
3: 44
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946394471 Original CRISPR CAGTGTGAAGAAAAGGCTGA GGG Intronic
900813775 1:4827843-4827865 CAGTTTGGGGAAAACGCTGATGG - Intergenic
901286228 1:8081052-8081074 CTCTGAGAAGAAAGGGCTGATGG + Intergenic
901614106 1:10524221-10524243 CAGTGAGCAGAAAAGGATGAGGG + Intronic
901690147 1:10967487-10967509 GATTGTGCAGAAAAGGGTGAAGG - Intronic
902522757 1:17030277-17030299 CAGTGGGAGGCAAAGGCAGAAGG - Intronic
903236122 1:21951801-21951823 CATTCTGAAGAAGAGGCTGTCGG - Intergenic
903499950 1:23795284-23795306 CAGTGTGGGGAAACAGCTGAGGG - Exonic
903766052 1:25735031-25735053 CAGCTTGAAGAAAGGGCTGGAGG + Intronic
904190193 1:28737306-28737328 AAGCGGGAAGAACAGGCTGAGGG - Intronic
905252647 1:36659407-36659429 CAGTGAGAAGAATGGGCTGCCGG - Intergenic
905390012 1:37630359-37630381 CCCCGGGAAGAAAAGGCTGAGGG - Intronic
905605780 1:39298073-39298095 GAGCATGAAGAAAAGGTTGAAGG + Intronic
905893376 1:41530660-41530682 CAGGGTGAAGGCTAGGCTGAAGG - Intronic
906213951 1:44028404-44028426 CAGTGTGGAGAAAGGACTGGAGG + Intronic
906402058 1:45511983-45512005 CATTGTCAGGAAAAGGTTGAAGG - Exonic
907912852 1:58841768-58841790 CAGTGGAAAGAAAAGGCTGAGGG - Intergenic
909815777 1:79992008-79992030 CATTGAGAAATAAAGGCTGAGGG - Intergenic
910524880 1:88166156-88166178 CAGAGAGAAGAGAAGCCTGAAGG + Intergenic
911095902 1:94054835-94054857 CAGTGTGCAGAATGGACTGATGG + Intronic
911133415 1:94414500-94414522 CAGTGTGTAGAGTGGGCTGAAGG - Intergenic
911542864 1:99179459-99179481 CAGTAAGAACAAAAGGCTGTGGG + Intergenic
912229128 1:107771973-107771995 TACTGTTAATAAAAGGCTGATGG - Intronic
912232389 1:107810274-107810296 GAATGTGTAGAAAATGCTGATGG - Intronic
912364076 1:109118597-109118619 CTGTGTGAAAAACATGCTGACGG + Intronic
912672975 1:111648607-111648629 CAGTTTGTAGAACAGACTGAGGG - Intronic
914716587 1:150259357-150259379 CTGTCTGACGCAAAGGCTGAGGG - Intronic
915346644 1:155200919-155200941 CAGTGTGATGATGATGCTGATGG - Exonic
915516283 1:156414503-156414525 CAGGGAGAGGCAAAGGCTGAGGG - Intronic
915864671 1:159486223-159486245 CAGTGTGAACACAAAGGTGAAGG + Intergenic
916618186 1:166467035-166467057 CTGTGTGAAGAATAGACTGAAGG + Intergenic
917500667 1:175582355-175582377 CTGTGGCAAGAAAAGGCTGAAGG + Intronic
917586969 1:176437021-176437043 CAATGTGAAGGATAGGCTAAAGG - Intergenic
918746850 1:188212937-188212959 CACTGTGAAGAACAGTATGAAGG - Intergenic
918961821 1:191288877-191288899 CACTGTAAAGAAAAAGTTGACGG - Intergenic
919824040 1:201491185-201491207 CAGTGGGAAGCCAAGGCTGGAGG + Intronic
919914776 1:202132630-202132652 CAGGGTGAAGGAGAGGCCGAGGG + Exonic
919981421 1:202644575-202644597 GAGGGTGAAGGAGAGGCTGAGGG - Intronic
920198804 1:204246646-204246668 CTGGGTGAAGAAAAGGCAGAGGG + Intronic
920394133 1:205631690-205631712 CAGCGTGAGGAGGAGGCTGAGGG - Exonic
920648464 1:207819992-207820014 CAGTGTCAAGGAACAGCTGAGGG + Intergenic
921337653 1:214104469-214104491 CCTTGTGAAGACAAGGTTGAAGG + Intergenic
922240593 1:223753102-223753124 CAGGGAAAAGAAAAGGCTCAGGG - Intronic
924380452 1:243459038-243459060 GAGTGAGAAGAAAAAGCAGAGGG + Intronic
1063392119 10:5656845-5656867 CAGTGGGAAAAAGAGGCTGTTGG - Intronic
1063647990 10:7904949-7904971 CAGTGTGAGGGAAAGGATGCAGG - Intronic
1064036114 10:11914675-11914697 CAATGTGAAGACGAGGATGAAGG + Intergenic
1064387020 10:14904413-14904435 CAGTGTTAAGAAAAGGTTGTAGG + Intronic
1066149904 10:32605497-32605519 GATTGTGACGAAAATGCTGATGG + Intronic
1067012587 10:42728344-42728366 CAGTGTGGAGAAGAGGGTGGAGG + Intergenic
1067208195 10:44237495-44237517 AAGTGGGAAGAAAAGGAAGAAGG + Intergenic
1067310999 10:45113531-45113553 CAGTGTGGAGAAGAGGGTGGAGG - Intergenic
1068560512 10:58510434-58510456 TAGTGTGGAGAACAGACTGAGGG - Intergenic
1069891509 10:71655354-71655376 CCGTGGCAAGAAAATGCTGAGGG - Intronic
1071103899 10:82071737-82071759 CTGTGTCAAGAATTGGCTGAAGG + Intronic
1071468763 10:85963711-85963733 CAGGGTGAAGTAATGGCTCAAGG - Intronic
1071867757 10:89755494-89755516 CAGGATGAAGAAAAGGAAGAAGG - Intronic
1072962105 10:99938683-99938705 TAGTGTGGAGATAAAGCTGAGGG - Intronic
1074139993 10:110663416-110663438 CAGAGTGCAGAAAAAGCGGATGG + Intronic
1074427868 10:113368205-113368227 CATTGTGAAGTTAAGGATGAGGG + Intergenic
1074827548 10:117225286-117225308 CAGTGGGGAGAGAAGGCTGAGGG - Intergenic
1075649224 10:124116850-124116872 CAGTGTGAAGACATGGCTGTGGG + Intergenic
1075859910 10:125666701-125666723 CAGTGTGCTGGAAAGGGTGATGG + Intronic
1076049383 10:127320555-127320577 CAGTGTGAGGAATGGGCTCAAGG + Intronic
1076151185 10:128163169-128163191 CTGTGGGAATAAAAGGCGGACGG - Intergenic
1076294513 10:129374210-129374232 CAGTGTGAACAGAAAGCAGAGGG - Intergenic
1076741222 10:132486706-132486728 GCCTGTGAAGAAAAGCCTGAAGG - Intergenic
1077511800 11:2969431-2969453 GAGTGTGCAGGAAAGGGTGAGGG - Intronic
1077843810 11:6002873-6002895 CAGGAGGAAGAGAAGGCTGAGGG + Exonic
1077846240 11:6027573-6027595 CAGGAGGAAGAGAAGGCTGAGGG + Exonic
1077960980 11:7076780-7076802 AATAGTGAAGAAAAGGCTCATGG - Intergenic
1078087222 11:8241349-8241371 CCGTGTGAAGAATTGGCTGTGGG - Intronic
1079469481 11:20764755-20764777 CTGTGTTCACAAAAGGCTGAGGG + Intronic
1080413403 11:32047477-32047499 CAATATGAAGAAATGGCGGAAGG - Intronic
1081840076 11:46193901-46193923 CAGTGTGAAAAAAAAGCAAAAGG + Intergenic
1083623719 11:64061304-64061326 CAGCGTGAAGGAAGGGCAGACGG - Intronic
1084068984 11:66721559-66721581 CGGGGTGAAGAAAGGGGTGATGG + Intronic
1084623935 11:70293803-70293825 CAGGGTAAAGCAGAGGCTGAGGG - Intronic
1085894600 11:80623585-80623607 CAGTGAGAAGAAAAAGGTCAAGG - Intergenic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1086398984 11:86445461-86445483 CAGTGAGAAGGAAATGCAGAAGG + Intronic
1086815376 11:91364070-91364092 CAGTGATAAGAATAGTCTGAAGG + Intergenic
1086939310 11:92779053-92779075 CAGGGGGATGAAAAGGTTGAAGG + Intronic
1087626741 11:100604211-100604233 CAGTGAGAAGAAATGGATCAGGG - Intergenic
1088367429 11:109054177-109054199 CAGTGTGCAGAACACACTGATGG + Intergenic
1088628369 11:111749819-111749841 CAGTGTGAAAGCAAGGCAGATGG - Intronic
1089972038 11:122701781-122701803 CAGAGTTCAGAAAAGGCAGATGG - Intronic
1090844475 11:130519351-130519373 AAGAGTGCAGAGAAGGCTGAAGG + Intergenic
1090928815 11:131277362-131277384 CAGAGAGAAGAAAAGGCTCAGGG + Intergenic
1091461823 12:648864-648886 CAGTGTGAACAAAAAGCTGGAGG - Intronic
1092222932 12:6727722-6727744 TAGTGTAAACAAAAGCCTGAAGG + Intronic
1092766129 12:11854614-11854636 CATTGTGAAGGCAAGGGTGATGG - Intronic
1094046834 12:26176880-26176902 CAGTGTGAATAATGGACTGATGG - Intronic
1094199419 12:27780867-27780889 CAGCCTGAAGCAGAGGCTGAGGG + Exonic
1094566172 12:31600238-31600260 CAGCGGGAAGAAAAGATTGAAGG - Intergenic
1096106793 12:49000733-49000755 CAGTGTGAGGATGAAGCTGAGGG - Intergenic
1096394523 12:51255672-51255694 CAGTGTGGACAATAGGCTGTGGG + Intronic
1096678823 12:53241633-53241655 CAGTGTGAACAAAGGACTGGAGG + Intergenic
1098040951 12:66353705-66353727 GAGTGGGAAAAAAAGGCTGCAGG - Intronic
1098519929 12:71423621-71423643 CAGTGTGAGCAAGAGGATGATGG - Intronic
1099352794 12:81593654-81593676 CAGTGTGCAGGAATGGGTGAAGG + Intronic
1099850740 12:88092958-88092980 AAGTGTTAAGAACAGACTGAAGG + Intronic
1100466191 12:94848042-94848064 CAATGTGAAGCAAAGGCAGAAGG - Intergenic
1101344963 12:103878504-103878526 CAGTGGGAAGAAGAGGCTTGAGG - Intergenic
1101533011 12:105591757-105591779 AAGTGTGAAGAGAGAGCTGAAGG - Intergenic
1104299112 12:127547906-127547928 AAATGTGAAGGAAAGGCAGACGG - Intergenic
1104673013 12:130693271-130693293 AAATGTGAAGAAAAGGCACAGGG + Intronic
1106024038 13:25940486-25940508 CAGTGTGGAGGAAAGGCCGGTGG - Intronic
1106622185 13:31381510-31381532 CTGTGTACAGAAAAGGCTCAAGG - Intergenic
1106671241 13:31907600-31907622 CTGTGTGAAGAAGTGACTGAAGG - Intergenic
1106782686 13:33075374-33075396 GTGTGTGAAGAAAAGGCTCTGGG - Intergenic
1106896657 13:34310121-34310143 CAGTGGGAAGAACAGGTAGAAGG + Intergenic
1106970388 13:35133846-35133868 GAGTGTGAAGAATGGGATGATGG + Intronic
1107135917 13:36944046-36944068 CAATGTGAAGACAAGAATGAAGG - Intergenic
1108115274 13:47120593-47120615 AGGTGGGAAGCAAAGGCTGAGGG + Intergenic
1108274753 13:48796545-48796567 CTTTGTGGAGAAAAGACTGAAGG - Intergenic
1110436849 13:75485185-75485207 CAGTGGGAAGAAAAGGCAGTTGG - Intergenic
1111276202 13:85950651-85950673 TTGTGTGAAGAACAGACTGAAGG - Intergenic
1111623145 13:90749609-90749631 TAGTGTGAAGAAAATGAGGAGGG - Intergenic
1113222788 13:108124345-108124367 CAGTGTGAGGGGAAGGCTGGTGG - Intergenic
1113633519 13:111904401-111904423 AAGGGTGATGAAGAGGCTGATGG - Intergenic
1115977591 14:39013650-39013672 GATAGTGAGGAAAAGGCTGATGG + Intergenic
1116475283 14:45331933-45331955 CGGTGTAAAGAAAAGAATGAGGG - Intergenic
1116760817 14:49011390-49011412 GACTTTGAAAAAAAGGCTGATGG - Intergenic
1117282075 14:54251362-54251384 CAGAGAGAAGAAAGGGATGAGGG - Intergenic
1118354776 14:65004175-65004197 CAATAGGAAGAAAAAGCTGATGG + Intronic
1118841525 14:69516980-69517002 CAATATGGAGAAAAGGATGAAGG + Intronic
1119611285 14:76064844-76064866 CAGGGTGGAGAAAAGCCTGGAGG - Intronic
1123807923 15:23894498-23894520 GAGTATGATGAAAAGGTTGAAGG + Intergenic
1123991793 15:25689033-25689055 CAGTGTTAAAAAGAGGCTGATGG + Intronic
1124497112 15:30193310-30193332 GAGGGTGAAGGAGAGGCTGAGGG - Intergenic
1124746464 15:32345337-32345359 GAGGGTGAAGGAGAGGCTGAGGG + Intergenic
1126126798 15:45301536-45301558 AAGAGTGAAGAAAATGCCGAAGG - Intergenic
1126142404 15:45448937-45448959 CAGTGTGCAGATAAGGTTCAGGG + Intergenic
1127687925 15:61366550-61366572 CAGGGTGAAGACTAGGATGAGGG + Intergenic
1128182201 15:65613829-65613851 GTAAGTGAAGAAAAGGCTGAGGG + Intronic
1128345741 15:66851375-66851397 CCGTGTGGAGAACAGGCTGCAGG + Intergenic
1128534752 15:68482036-68482058 CACTGTGGAGAAATGGCTGTGGG + Intergenic
1128729158 15:70009155-70009177 CAGGGGGAAGAAGAGGCAGAAGG - Intergenic
1128878130 15:71218775-71218797 AAGTTTGAGGAAAAGGCTGTTGG + Intronic
1129453586 15:75664179-75664201 CAGTGTGAACACAAGGGTGCTGG + Intergenic
1130428593 15:83823684-83823706 CTGTGTGAAGAACAGACTGGAGG - Intronic
1130948486 15:88567348-88567370 GAGTGTAAAGAAGAGGCTGGGGG + Intergenic
1131593381 15:93772780-93772802 CTGTGTGCAGGACAGGCTGAGGG + Intergenic
1131612864 15:93983376-93983398 CAGTGAAAAGGAGAGGCTGAAGG - Intergenic
1133605599 16:7384805-7384827 GAGTGTGAACAAAATGCTGCTGG + Intronic
1133962628 16:10507822-10507844 CAGTTTGGAGCCAAGGCTGATGG - Intergenic
1135599062 16:23766262-23766284 CAGTGTCTAGAAAAGGCTTCTGG + Intergenic
1136409959 16:30070366-30070388 CAGTGTGCCGGAAAGGGTGATGG - Exonic
1136478911 16:30529387-30529409 CAGTGTGCAGCCAAGGCTTATGG + Intronic
1136719810 16:32310754-32310776 CAGTGTGGGGAAGTGGCTGAGGG - Intergenic
1136838185 16:33517034-33517056 CAGTGTGGGGAAGTGGCTGAGGG - Intergenic
1137008969 16:35304841-35304863 CTGTGTGCAGAACAGGCTGAAGG + Intergenic
1137432459 16:48429299-48429321 AAGTGTGAAGAAAATGCTAATGG + Intronic
1137550564 16:49434723-49434745 GAGTGTGAAGAAGAAGATGAAGG + Intergenic
1137826959 16:51506397-51506419 CAGTGTGAAGAAAGGATGGAAGG - Intergenic
1138118010 16:54375573-54375595 CGTTGTGAAGTAAAGGCTGGCGG + Intergenic
1138578309 16:57922983-57923005 CCTTGTGAAGGAGAGGCTGAGGG - Intronic
1138990986 16:62391030-62391052 CAGTGTAAAGAATAGACTCAAGG - Intergenic
1139821475 16:69724758-69724780 AAGTGAGAAGAGAAGGCAGAAGG - Intronic
1141792311 16:86244994-86245016 AAGGGTTGAGAAAAGGCTGAGGG + Intergenic
1142084876 16:88172241-88172263 GCGTGTGAAGAAACTGCTGAAGG + Intergenic
1203006621 16_KI270728v1_random:207015-207037 CAGTGTGGGGAAGTGGCTGAGGG + Intergenic
1203148355 16_KI270728v1_random:1817314-1817336 CAGTGTGGGGAAGTGGCTGAGGG - Intergenic
1143517040 17:7425044-7425066 CAGTGTGACGAAGTGGCTGGTGG + Intergenic
1144403418 17:14929020-14929042 AACTGTGAAGAAAAGTATGAAGG - Intergenic
1145984337 17:29034992-29035014 CAGTGAGAAGAAAAAGCTCTAGG + Intronic
1147022648 17:37549505-37549527 GAGTGAAAAAAAAAGGCTGAGGG + Intronic
1147320511 17:39643065-39643087 CTGTGTTGAGAACAGGCTGAAGG + Intronic
1147376770 17:40027205-40027227 CAATGTGAACATAGGGCTGAAGG + Intronic
1147470201 17:40651333-40651355 CTGTGGGAAGAAACGGGTGATGG + Intergenic
1148072875 17:44918455-44918477 GAGTGTGAGGAAAGGTCTGAGGG - Intergenic
1149480606 17:57000304-57000326 CAGTGTTAGGATAATGCTGATGG + Intronic
1150213042 17:63452059-63452081 CAGCATGAAGAAGAGGCAGAAGG + Intergenic
1151019486 17:70598440-70598462 CAGTGTGAAGTAATGGATTAAGG + Intergenic
1152432147 17:80254407-80254429 CAGTGAGAAGAAAGGGGTGGAGG - Intergenic
1152507765 17:80762419-80762441 CAGGGTGCAGGCAAGGCTGAGGG + Intronic
1153055553 18:942593-942615 CAGTGAGAAGAACAGCCAGAAGG + Intergenic
1153406812 18:4750105-4750127 CAGTGTTAAGAGAAGGTTAAAGG + Intergenic
1153969844 18:10216084-10216106 GAGTGTGAAGGAAAGTGTGAGGG + Intergenic
1155603596 18:27577240-27577262 GTGTGCTAAGAAAAGGCTGAAGG + Intergenic
1156604631 18:38651812-38651834 CAGTGTATAGGAAGGGCTGAAGG + Intergenic
1157293841 18:46427786-46427808 CAGTGTGAAGAGACAGCTCAAGG + Intronic
1157718895 18:49908242-49908264 CAGTATGGAGATGAGGCTGATGG - Intronic
1158135588 18:54204191-54204213 CAGTGTGAAGACAATGGTGGTGG + Intronic
1158413662 18:57230862-57230884 CAGTATGAAGTGAAGGCAGAGGG - Intergenic
1159331142 18:66995354-66995376 CAGTATGGAGAAAAGTCTTAAGG + Intergenic
1160308651 18:77767331-77767353 GAGTCTGAAGAAGAGCCTGATGG - Intergenic
1160660103 19:293963-293985 CAGTGGGCAGGGAAGGCTGAGGG + Intergenic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1163518044 19:17776595-17776617 CAGGGTGACAAGAAGGCTGAAGG + Intronic
1164441378 19:28282870-28282892 CAGTGGGAAGAAGAGGATGGTGG - Intergenic
1164508379 19:28877849-28877871 AGAGGTGAAGAAAAGGCTGAAGG - Intergenic
1164670019 19:30067141-30067163 CTGTGTGAAGCAAAGGGGGATGG + Intergenic
1165251123 19:34535955-34535977 CAGTATGAGGAAAAAGCTTAAGG + Intergenic
1165945834 19:39441639-39441661 TAGAGGGAAGAAAAGGCTTAGGG - Exonic
1168469777 19:56630562-56630584 CTGTGTGGAGAACAGGCTGGGGG + Intergenic
925019612 2:558191-558213 CCGTGTGAAGAGCAGACTGAGGG - Intergenic
926321260 2:11749676-11749698 CAGTGTGCAGAACAGCCTGTGGG - Intronic
926751310 2:16200827-16200849 CAGTGTGAAGAAAATGTGGCTGG - Intergenic
927279154 2:21288478-21288500 CAGAGTGAACAAAGGGCTGTAGG + Intergenic
928372184 2:30748255-30748277 CTCTGGGAAGAAAAGGCTAAAGG - Intronic
928495045 2:31822921-31822943 CAGTTTGGAGAACAGCCTGAGGG - Intergenic
929450749 2:42035472-42035494 GAGTGTGAGGAGTAGGCTGAGGG - Intergenic
930619171 2:53626335-53626357 CTCTGAGAAGAAAAGGGTGAAGG - Intronic
931376400 2:61712248-61712270 CAGTGTGGAGAACAGACTGGAGG - Intergenic
933009194 2:77036368-77036390 GAGTTTGAAGACAAGCCTGAGGG - Intronic
933417391 2:82003708-82003730 CAGTGTTAAGTAAAGGCAGATGG + Intergenic
934143336 2:89069594-89069616 CAGTGTGAAGGAAAGGACTATGG - Intergenic
934225905 2:90130961-90130983 CAGTGTGAAGGAAAGGACTATGG + Intergenic
935011187 2:99137635-99137657 CAGTGTGGAGAATAGGTTGTAGG + Intronic
937720329 2:125087895-125087917 TAGTGAGAAGAAAAGGGTTAGGG - Intergenic
937992558 2:127672691-127672713 CTGTGTGGAGAAAGGGCTGCTGG - Intronic
938137288 2:128769904-128769926 CAGTGTGAAGGAGAGGTGGAAGG + Intergenic
938938701 2:136149700-136149722 CAGTGTGAACAACTGGCTGAGGG + Intergenic
940865634 2:158815158-158815180 CCCAGTGAAGAGAAGGCTGAGGG - Intronic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
941320509 2:164048711-164048733 AATTGTGCAGAAAAGGCTTACGG - Intergenic
941912507 2:170777603-170777625 CAGTGTTAATAAAATACTGAGGG + Intergenic
943886239 2:193219997-193220019 CATTGTGAAGAAAACACTTAGGG + Intergenic
944235774 2:197440259-197440281 CAGAGAGTAGAAAAAGCTGAGGG - Intergenic
944997999 2:205316235-205316257 CTGCTTGAAGAAAAGGTTGAAGG + Intronic
945925162 2:215795959-215795981 CAGTGGGAAGAAGAGACTGATGG - Intergenic
946258883 2:218468464-218468486 CTTTGAGAAGCAAAGGCTGATGG - Intronic
946394471 2:219436195-219436217 CAGTGTGAAGAAAAGGCTGAGGG + Intronic
946704346 2:222443577-222443599 CAGCGAGAAGAAATGGCAGAGGG - Intronic
947428354 2:230004130-230004152 CAGTGTTAAGCAAAGGCAAAAGG - Intronic
947549457 2:231036295-231036317 AAGTGGGAAGAAGAGGCTGCCGG + Intergenic
948299786 2:236895398-236895420 CAGGCAGAAGAAAAGGCTCATGG + Intergenic
1170539575 20:17374482-17374504 AAAGGTGAAGAAAAGGCTGGTGG + Intronic
1170565033 20:17595117-17595139 CAGTGGAAAGCAGAGGCTGATGG - Intronic
1170652405 20:18254899-18254921 CATTGTGAAGAAAAGGAGTAGGG + Intergenic
1171010141 20:21505203-21505225 GAGTGCGATGAAGAGGCTGAAGG - Intergenic
1171084624 20:22226052-22226074 CACTGTGAATAAAATGGTGAAGG - Intergenic
1171175543 20:23049014-23049036 CAGTGCGAAGTGAAGGCCGATGG - Exonic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173373336 20:42460038-42460060 CAGTGGGAAGAACAAGTTGAAGG + Intronic
1173474825 20:43351651-43351673 CTCTGGGAAGAAGAGGCTGAAGG + Intergenic
1173890995 20:46510228-46510250 CAGTGTGAAGAACAGCCTTGAGG + Intronic
1174416237 20:50369195-50369217 CAGTATGAGAAAAAAGCTGATGG + Intergenic
1176649028 21:9529131-9529153 CAGTGTGGAGAAAATGCAGTGGG - Intergenic
1177544127 21:22534634-22534656 CAGAGAGAAAAAAAGGCTGAAGG - Intergenic
1178272438 21:31203820-31203842 CAGTGTGAAGACAAGGCTTTTGG + Intronic
1179002134 21:37471458-37471480 CAATGTGCAGTAAAGGCTCATGG - Intronic
1179559985 21:42209516-42209538 CTGGGTGAAGAAAAAGCTAAGGG + Intronic
1179874838 21:44262358-44262380 AAGGGTGAAGAAAGGGATGAGGG + Intergenic
1182211415 22:28680064-28680086 CAGTGTGGGGAAATGGCCGAGGG - Intergenic
1182732065 22:32503722-32503744 AAGGGTGAAGAAGAGGTTGAGGG - Intergenic
1182920451 22:34074448-34074470 CACTTGGAAGAAAAGACTGAAGG - Intergenic
1182922604 22:34093904-34093926 AAGTGGGAACAAAATGCTGAAGG - Intergenic
1183023696 22:35047963-35047985 CAGGGTGAGGAAAAGGAAGAGGG + Intergenic
1183568962 22:38637864-38637886 CAGTGTAAAGAACAAGCTAAGGG + Intronic
1183850493 22:40582878-40582900 CTGTATGAAAAAAAGGCTGATGG + Intronic
1183853886 22:40616395-40616417 CAGTGTGGAGAATTGACTGAAGG + Intronic
1183888793 22:40907912-40907934 CAATGTGAAGAAGAGGCTGAGGG + Intronic
1184431303 22:44442744-44442766 CAGTTTGAAGCAAGGGCTGATGG - Intergenic
950198844 3:11028665-11028687 CAGTGTGCTGGAAAGGCTGTAGG + Intronic
950525550 3:13520800-13520822 CAGGGGGCAGAGAAGGCTGAGGG + Intergenic
950554486 3:13686914-13686936 CAGCGTTATGAAAAGTCTGAGGG - Intergenic
950587423 3:13904475-13904497 CAGTGAGAAGAAATGGTTCAGGG - Intergenic
951746434 3:25982801-25982823 CTGTGTTCAGAAAAGGCAGATGG - Intergenic
951800282 3:26588216-26588238 CAGAGGGAGGAAAGGGCTGAGGG - Intergenic
951804140 3:26626051-26626073 CAGTTTGGAGTAAAGGGTGAGGG - Intronic
952056834 3:29457340-29457362 CAGTGTGAAGAACAGATTGATGG - Intronic
952253845 3:31678906-31678928 CTGAGTGAAGAATAGACTGAAGG - Intronic
955122954 3:56079820-56079842 CTGTGTTAAGAATAGGCTGTAGG + Intronic
955625743 3:60917379-60917401 CTGTGTAAAGAAGAGGCTGAAGG - Intronic
956162749 3:66372311-66372333 CTGTCTCCAGAAAAGGCTGAGGG - Intronic
956253406 3:67258495-67258517 CAGAGTATAGAACAGGCTGAGGG + Intergenic
958478665 3:94618690-94618712 CAGTGAGAATAAAAGTCTCAGGG + Intergenic
959591432 3:108086275-108086297 CAGTGTAAAGGAAGGACTGAGGG + Intronic
959612278 3:108308582-108308604 CAGTATGAAGAAAAGTTTGGAGG - Intronic
960925007 3:122785957-122785979 CAGTATATAGAAAAGGATGAGGG - Intronic
963265853 3:143239297-143239319 CAGACTGAAGAAAAGTATGATGG - Intergenic
963817159 3:149844277-149844299 CAGTGAGAAGAAAAGGCACATGG + Intronic
964237289 3:154546229-154546251 TAGTGTGAAAAAAAGGCATAGGG + Intergenic
964379838 3:156087359-156087381 CAGTGTGAAGGAAAAGTAGAGGG - Intronic
964392221 3:156209799-156209821 CAGTTTGAACAAGATGCTGAAGG - Intronic
964416953 3:156457746-156457768 CTGTATGAAGAATGGGCTGAAGG + Intronic
965222814 3:165950073-165950095 CAGTGTGAAGGATACGCTGAGGG - Intergenic
965622444 3:170655078-170655100 CACTGAGAAGCAAAGGCTGGTGG - Intronic
967459156 3:189725098-189725120 CATTGTGAAAAAAAGTCTAAAGG + Intronic
967881243 3:194303278-194303300 CTGTGTGCAGAAGAGTCTGAAGG + Intergenic
968522309 4:1039571-1039593 CAGTGTGCAGGAGAGGCTGAGGG - Intergenic
968765105 4:2464043-2464065 CAGTGACAAGAACAGGCTAAAGG + Intronic
971018482 4:22511856-22511878 AACTGTGAAGAAAACGGTGAGGG - Intronic
971772550 4:30915821-30915843 CAATTTGAAAAAAAGGGTGAGGG - Intronic
971788766 4:31140031-31140053 GACTGTGAAGTAAAGACTGAAGG + Intronic
971895312 4:32585547-32585569 TAGTATGAAGAAAAGTCTGGAGG + Intergenic
972113140 4:35591566-35591588 CTTTGTGAAAGAAAGGCTGATGG - Intergenic
972296233 4:37741742-37741764 CTGAGTGAAGGAAAGGCTGAAGG + Intergenic
972340419 4:38148151-38148173 CTGTGTGAAGAACAGACTGAGGG - Intergenic
972653584 4:41044266-41044288 CAGTATGAAGAAAAGGTTAATGG - Intronic
972795785 4:42417944-42417966 CAGTGATGAGAGAAGGCTGAAGG + Intronic
975057836 4:69957468-69957490 GAGTCTGAGGAATAGGCTGAGGG + Exonic
975448025 4:74490466-74490488 CAGTGACAAGATGAGGCTGAAGG - Intergenic
975988554 4:80231530-80231552 CAGTGGGAAAATAAGGCAGAGGG - Intergenic
977182722 4:93897519-93897541 CAGTGTGACTAAAAAGTTGAAGG + Intergenic
977498086 4:97802378-97802400 CAGTGTAGAGAAAACACTGAAGG - Intronic
980706768 4:136507232-136507254 CCGTGTGAACAAGAGGATGATGG + Intergenic
982247078 4:153363805-153363827 CAGTATGAAGAGCAGGTTGAGGG + Intronic
983092734 4:163523913-163523935 AAATGTCAAGCAAAGGCTGATGG - Intergenic
983339812 4:166445975-166445997 CATTGTGTTGTAAAGGCTGATGG + Intergenic
984451671 4:179911257-179911279 CAGGGTGAAGAATAGTCTGGAGG - Intergenic
984542694 4:181060358-181060380 CAGAGGGAAGAAAAGGATGGGGG - Intergenic
984634702 4:182098255-182098277 CAGTATGAAGAACAGGATGGAGG + Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
987204818 5:15614126-15614148 CACTGGGAAGAAAAGACTGTTGG + Intronic
988876863 5:35456635-35456657 GATTGTGAACAAAATGCTGATGG + Intergenic
988947462 5:36220436-36220458 AATCTTGAAGAAAAGGCTGAGGG + Intronic
990691381 5:58368025-58368047 CAGTGTGAATAATGGGATGATGG + Intergenic
992296322 5:75330525-75330547 AAGTGTGAAAAAAAGACGGAAGG - Intergenic
992432675 5:76724590-76724612 CAGTATGTAGAAAAGACAGATGG - Intronic
992534157 5:77681680-77681702 CAGTGTATAGGAAATGCTGAGGG - Intergenic
992877870 5:81075668-81075690 TTGAGTGAAGAACAGGCTGAGGG + Intronic
992998266 5:82354021-82354043 CAGAGTAAAGAAAATGCAGAAGG - Intronic
994042956 5:95278210-95278232 GAGTTAGAAGAAAAGGTTGATGG + Intronic
994298807 5:98121791-98121813 CAGTGAGAAGAAATGGGTCAGGG - Intergenic
995744344 5:115388077-115388099 AATTCTGAAGAAAAGTCTGAAGG + Intergenic
996273714 5:121639603-121639625 CAGTGTGAGCAAAAAGCTGCGGG - Intergenic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
997101318 5:130972119-130972141 CAGTGTGAACAAAAGGGATATGG + Intergenic
997714340 5:136030597-136030619 CAGTGTGCAGAATAGAGTGAGGG + Intronic
998370190 5:141655844-141655866 GAGGGGAAAGAAAAGGCTGAGGG - Intronic
998622078 5:143806037-143806059 CAGTGGGAGGAAAAAGCAGAAGG - Intergenic
998920777 5:147065518-147065540 CAGTGTGAAGAATAGACTGGAGG + Intronic
999106521 5:149075748-149075770 CAGTGGGAAGAAGTAGCTGAGGG - Intergenic
999154610 5:149449669-149449691 CAGTGTCAAGAAAGGGGTGGGGG - Intergenic
999690648 5:154143278-154143300 CAGTGTCAGGAGAAGGCTGTGGG - Intronic
1000023292 5:157337526-157337548 AAGTGTGCAGAAATGGTTGAAGG - Intronic
1000129034 5:158276943-158276965 CAGTGTGAACCAAGGCCTGAAGG + Intergenic
1000241596 5:159413541-159413563 CAGTGTATAGAAGCGGCTGAGGG + Intergenic
1000379988 5:160620471-160620493 CAGGGTGCAGAGGAGGCTGAAGG + Exonic
1000565196 5:162837925-162837947 CAGTGAAAAGACAAGGCTCAAGG + Intergenic
1001249390 5:170134984-170135006 CAGTGTTCAGAAAAAGGTGAGGG + Intergenic
1001867365 5:175117123-175117145 CGGTGTGAAGAAAAGGTTATGGG + Intergenic
1002179638 5:177424400-177424422 CACTGTGAAGGATAAGCTGAGGG - Intronic
1002321268 5:178377518-178377540 GAGGGTGAAGAAAAGGCAAAAGG - Intronic
1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG + Intergenic
1004786029 6:18968370-18968392 GAGTGTGATGAAAAGAGTGACGG + Intergenic
1005449864 6:25962153-25962175 CTTTGTGGAGAAAAGGCTGTGGG - Intergenic
1006253680 6:32812497-32812519 AAGGGGGAAAAAAAGGCTGATGG + Intergenic
1006318745 6:33306611-33306633 CAGTGTGAAGAAGGAGTTGAAGG - Intronic
1006327414 6:33364970-33364992 CAGTGTGGGGAAACAGCTGAGGG + Intergenic
1006393693 6:33773465-33773487 CAGTGATGAGAAAAGGCTGGGGG - Intronic
1006433144 6:34010521-34010543 CAGTGTGGAGTAGAGGCTAAGGG + Intergenic
1006909034 6:37552030-37552052 AAATGTGAAGAAAATGCTGCGGG - Intergenic
1007133777 6:39501081-39501103 AAGAATGAAGAAAAGGGTGACGG + Intronic
1007135947 6:39522089-39522111 CAGTGAAGGGAAAAGGCTGAAGG - Intronic
1008344691 6:50412159-50412181 CAATGTGAATAGAAGCCTGAAGG + Intergenic
1008392544 6:50969590-50969612 CAGGATGTAGGAAAGGCTGAGGG + Intergenic
1008860508 6:56143524-56143546 GAGTATGAAGGAAAGGATGATGG - Intronic
1010016528 6:71110718-71110740 GAGTGTGAAGAAAAGGCCACTGG - Intergenic
1010316904 6:74462053-74462075 CACTGTGAAGAAAAGTTTGGAGG - Intergenic
1012222836 6:96671292-96671314 CAGAGTGAAGAAAATTATGAGGG + Intergenic
1012509641 6:99988446-99988468 CAGTGTGCAAAAGAGGCTGCTGG - Intronic
1013553571 6:111234047-111234069 CTGTGTGGAGAAAAGACCGAGGG - Intergenic
1013725011 6:113084082-113084104 CACTCTGGAGAAAAGTCTGAAGG - Intergenic
1013990829 6:116252659-116252681 CAGTATGAAGAGAAAGCAGATGG + Exonic
1014051744 6:116963071-116963093 CAGTGTGGAGAAAAGGCTGTGGG - Intergenic
1014081269 6:117288667-117288689 CAAGGTGAAGAAAAGTCTGAGGG - Exonic
1014259801 6:119203514-119203536 GAGTGTCATGAGAAGGCTGAGGG + Intronic
1014318719 6:119898737-119898759 CATTGTGAAGCTCAGGCTGAAGG - Intergenic
1015248116 6:131098119-131098141 CAGTATTGAGAAAAGTCTGAAGG - Intergenic
1015425036 6:133055562-133055584 CACTGTGAAAAAAAGTCAGAAGG + Intergenic
1015872880 6:137794787-137794809 AAGTGGGAAGAAAAGGAGGAAGG + Intergenic
1018459911 6:163988005-163988027 CAGTGTGAAGTTAAGGGTGCAGG + Intergenic
1020219182 7:6221610-6221632 CAGTGTGAGGAAATGAGTGAAGG + Intronic
1020437980 7:8186348-8186370 CACTGTGGAGAATAGGCTGTTGG + Intronic
1020444458 7:8254885-8254907 CAGTGGGAAGAAAACCCTGCAGG + Intronic
1020950960 7:14676685-14676707 CAGTGTAAATAAGATGCTGAAGG + Intronic
1021485811 7:21167200-21167222 CAGTCTGAATAAAAGGTTAATGG + Intergenic
1021598357 7:22340630-22340652 CAGTGTGGAGGAAGGGCTGTGGG - Intronic
1021757982 7:23873987-23874009 CAGAATGTAGAAAAGACTGATGG - Intergenic
1021975967 7:26011293-26011315 CAGTATAAAGACAAAGCTGATGG - Intergenic
1023305325 7:38819814-38819836 GAGTGAGAAGAGAAGACTGATGG - Intronic
1024527518 7:50361418-50361440 CAGGTTGAAGAACAGGCTTAGGG - Intronic
1025254382 7:57373551-57373573 CAGTATGAAAAAAAAGCTGATGG - Intergenic
1025580683 7:62711979-62712001 CAGTGTTTAGAAACTGCTGAAGG + Intergenic
1026090070 7:67292381-67292403 CAGTGTGAAAACAAGACTAATGG - Intergenic
1027476014 7:78632362-78632384 CAGTATGGAGAAAAGGGTGGAGG + Intronic
1027532143 7:79349215-79349237 CAGATTGTAGAAAAGGCTTAGGG + Intronic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1027578384 7:79960601-79960623 CCGACTGAAGAAAAAGCTGATGG - Intergenic
1028036344 7:85988707-85988729 CAGTGTGCAGATAAGGCTGGAGG + Intergenic
1029536365 7:101160115-101160137 CAGAGTGGGGAAAAGGCAGAGGG - Intronic
1029707095 7:102281874-102281896 CAGTGTGTAGAAGAAGCCGATGG - Intronic
1030618087 7:111759562-111759584 CAGTTTCAGGAAAAGGCAGAGGG + Intronic
1030827813 7:114182970-114182992 CAGAATGCAGGAAAGGCTGAAGG + Intronic
1031427587 7:121625058-121625080 CAAAGTGGAGAAAAGGTTGAGGG - Intergenic
1031562422 7:123254648-123254670 CACTGTAAAGAATAGGCTGAAGG - Intergenic
1032383651 7:131506940-131506962 CAGTGCGGAGAACGGGCTGATGG - Intronic
1033072515 7:138217128-138217150 CAGTGTTAAGCATAGGCTCATGG - Intergenic
1033152968 7:138932585-138932607 CTGTGTGCAGAACAGGCTAATGG + Intronic
1033509562 7:142041480-142041502 CAGTGTGCAGAACAGCTTGAAGG - Intronic
1034432886 7:151049782-151049804 CAGTATGTTGAAAAGGCAGAGGG - Intronic
1034539688 7:151749013-151749035 GAGGGTGAGGAAGAGGCTGACGG + Intronic
1034754315 7:153600715-153600737 CACAGGGAAGAGAAGGCTGAAGG + Intergenic
1034871647 7:154690528-154690550 CTGTGTGGAGAAACAGCTGAAGG - Intronic
1035293153 7:157852951-157852973 CAGTGGGCAGAAAAAGCTGGTGG - Intronic
1036190038 8:6661852-6661874 CTGTGTGGGGAAAGGGCTGATGG + Intergenic
1038145395 8:24890020-24890042 CTTTGTGAAGATAAGGCTTAGGG - Intergenic
1038774175 8:30513105-30513127 CAGTGTGAAGAACAGGTTGTGGG + Intronic
1039355803 8:36814346-36814368 CAGTGTGAAGAACATGATGAAGG - Exonic
1040345013 8:46483944-46483966 TTGAGAGAAGAAAAGGCTGAAGG - Intergenic
1041347252 8:56912443-56912465 CAGTAAGGAGAAAAGGATGATGG - Intergenic
1043979727 8:86624016-86624038 CTGTGTGAAGAAAAGGCCTTAGG - Intronic
1044416866 8:91948972-91948994 CAGGGTGAAGAAGGGGTTGAGGG - Intergenic
1044559794 8:93601792-93601814 AAGTGAGATGGAAAGGCTGAGGG - Intergenic
1044741260 8:95328735-95328757 CATTGTGAAGAAGAAGTTGAAGG + Intergenic
1044831055 8:96249672-96249694 CAGTGTGGAGAACAGTCTGGAGG + Intronic
1045369257 8:101505190-101505212 CAATATGAAGAAAAGGATGGGGG - Intronic
1045492438 8:102680458-102680480 ACATTTGAAGAAAAGGCTGAAGG - Intergenic
1045550239 8:103164800-103164822 CAATGAGAAGAAAAGGCGTATGG - Intronic
1046373428 8:113343095-113343117 CAGGAGGAAGAAAAGACTGAAGG + Intronic
1046452888 8:114416441-114416463 CAATGTGAAGAAAAAACTCACGG - Intergenic
1047693699 8:127382546-127382568 CAGAGGGAAGAAAAGGCAGTAGG + Intergenic
1049012899 8:139899459-139899481 CAACGTGAAGATAAGGATGAAGG - Intronic
1049302341 8:141878287-141878309 CACTGTGCAGAGAAGGCTGAGGG - Intergenic
1050248807 9:3721313-3721335 CAGAGTGAATTAAAAGCTGAAGG + Intergenic
1051194982 9:14554360-14554382 CTGGATGAGGAAAAGGCTGAAGG - Intergenic
1051818211 9:21134217-21134239 CAGGGTGAAGAACAGCCTGATGG - Intergenic
1052022450 9:23540879-23540901 CAGTGTGCAGCAAAGGCTCCTGG - Intergenic
1052492178 9:29183861-29183883 CAGTGTGAACGGAAGACTGAGGG - Intergenic
1054761949 9:69012248-69012270 AAGGGTGAAGAAAAGTCTGCTGG + Intergenic
1055183416 9:73419137-73419159 CATTGTGGAGCAAAGGCTAAAGG - Intergenic
1056213353 9:84385749-84385771 CAGTAGGAAGAAAAGGATGTGGG - Intergenic
1057334226 9:94143248-94143270 GTGTGTGGAGAACAGGCTGAGGG - Intergenic
1058180305 9:101790358-101790380 CAGTGTGAAGAATGGATTGAAGG + Intergenic
1058775576 9:108280071-108280093 CTGTGTTAAGAACAGGCTGAAGG + Intergenic
1059550771 9:115226632-115226654 AAGTGGGAAGAATAGCCTGATGG - Intronic
1059850177 9:118329501-118329523 CAGTGTAGAGAAAATGCTAAGGG - Intergenic
1060085306 9:120694612-120694634 CTCTGGGAAGAAAAGGCTGTTGG - Intronic
1060129301 9:121079365-121079387 CAGTTTGAAGTACAGGTTGAAGG + Intronic
1061297760 9:129686237-129686259 CAGAGTCAAGACAAGGGTGAGGG + Intronic
1061404812 9:130387659-130387681 CAGTGGGAAGAACGGGCTGAGGG + Intronic
1203626764 Un_KI270750v1:32680-32702 CAGTGTGGAGAAAATGCAGTGGG - Intergenic
1186158907 X:6755817-6755839 CAGTGAGAAGATAAAGTTGATGG + Intergenic
1187992918 X:24895418-24895440 CAAGATGGAGAAAAGGCTGAAGG + Intronic
1188710389 X:33389915-33389937 CATTGTGAATAACAGACTGAAGG + Intergenic
1189840143 X:45066859-45066881 GCGTGTGAAGCAAAGGCTGGGGG - Intronic
1191209677 X:57871796-57871818 CAGTGTGAAGGAATGGATCAAGG + Intergenic
1192051034 X:67724063-67724085 CAATGGGAAGCAAAGTCTGAAGG - Exonic
1192315809 X:70050427-70050449 CAGACTGACTAAAAGGCTGAAGG - Intergenic
1194097581 X:89661899-89661921 GAATGTGAAGAAAAGGATGCTGG - Intergenic
1194368986 X:93047307-93047329 CAGTGTGAAGAAAAAAATGTGGG + Intergenic
1195031183 X:100929059-100929081 CAGGATGAAGAAAAGGCTGGAGG + Intronic
1195422085 X:104687051-104687073 CAGTGGGTAGAAAAAGTTGAAGG + Intronic
1195590775 X:106623044-106623066 AGGTGAGAAGAAAAGGTTGAAGG - Intronic
1195713032 X:107790345-107790367 CAGTGTGAAGGATAGACTAAGGG - Intronic
1196996796 X:121392521-121392543 CAGTTTGAAGAAACAGCAGACGG + Intergenic
1198158250 X:133983984-133984006 CAACCTAAAGAAAAGGCTGAGGG + Intronic
1198217623 X:134570271-134570293 CAGAGGGAAAAGAAGGCTGAGGG + Intronic
1198520889 X:137451313-137451335 CAGAGGGAAGAAAGGGATGATGG + Intergenic
1198574406 X:137994225-137994247 TAGAGTGAAGACAAGTCTGAAGG + Intergenic
1198719488 X:139600551-139600573 GAGTTGGGAGAAAAGGCTGAGGG - Intronic
1199860621 X:151797835-151797857 CAGTGTGGAGAACAGACTGCAGG - Intergenic
1200450602 Y:3323273-3323295 GAATGTGAAGAAAAGGATGCTGG - Intergenic
1200677192 Y:6163641-6163663 CAGTGTGAAGAAAAAAATGTGGG + Intergenic