ID: 946395025

View in Genome Browser
Species Human (GRCh38)
Location 2:219439331-219439353
Sequence GACCAAAATTTATGTCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946395018_946395025 19 Left 946395018 2:219439289-219439311 CCTACTATGTGCTTTTGATACAC 0: 1
1: 0
2: 1
3: 10
4: 167
Right 946395025 2:219439331-219439353 GACCAAAATTTATGTCCTCCAGG 0: 1
1: 0
2: 2
3: 21
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946395025 Original CRISPR GACCAAAATTTATGTCCTCC AGG Intronic
901442483 1:9286994-9287016 CCCCAAAATTCATGTCCACCTGG - Intergenic
902066463 1:13692289-13692311 TCCCAAAATCCATGTCCTCCTGG + Intergenic
902192802 1:14775372-14775394 GAACAGCATTTATTTCCTCCAGG - Intronic
903024111 1:20414920-20414942 AACCAAAATCTCTGTCCTCATGG + Intergenic
905926510 1:41753853-41753875 GAACAAAATCTCTGTCCTCTGGG + Intronic
907881911 1:58557351-58557373 TCCCAAAATTTATGTCCATCTGG - Intergenic
907911284 1:58828800-58828822 CCCCAAAATTTATGTCCACCTGG - Intergenic
910524224 1:88159194-88159216 GCCCAAGATTCATGGCCTCCAGG + Intergenic
910660004 1:89661656-89661678 GGCAAAAATTTCTGCCCTCCTGG + Intronic
918745296 1:188190180-188190202 CTCCAAAATTTATGTCCACCAGG - Intergenic
920873408 1:209812931-209812953 GACAAAAATTTCTGCCCTCGTGG + Intergenic
921778599 1:219133095-219133117 GACAAAAATCTCTGTCCTCAGGG + Intergenic
1064824351 10:19379458-19379480 TATCAAAATTTATGGGCTCCAGG - Intronic
1065989555 10:30994236-30994258 ACCCAAAATTTATGTCCTTCTGG - Intronic
1066621483 10:37356981-37357003 GGCCAAAATCTATGACCTGCTGG + Intronic
1067991899 10:51223358-51223380 GACAAAAATTTCTGTCTTCATGG - Intronic
1069097418 10:64276267-64276289 GACAGAAATTTAGGTTCTCCAGG - Intergenic
1070085947 10:73237183-73237205 CCTCAAAATTTATGTCCACCTGG - Intronic
1070874818 10:79793173-79793195 GACCAAAATTTCTGTCCTCATGG - Intergenic
1071092076 10:81930586-81930608 GATCAAAACCTATGTTCTCCTGG - Intronic
1071641742 10:87315342-87315364 GAGCAAAATTTCTGTCCTCATGG - Intergenic
1075680973 10:124330901-124330923 CTCCAAAATTCATGTCCACCTGG + Intergenic
1076411644 10:130255562-130255584 CCCCAAAATTCATGTCCACCTGG - Intergenic
1078394962 11:10972954-10972976 GACAAAAATTCTTGTCCTCATGG + Intergenic
1079359188 11:19756365-19756387 GCCAAAAATTCATGTCCTCCTGG - Intronic
1084447669 11:69213094-69213116 CGCCAAAATTCATGTCCCCCTGG + Intergenic
1086773670 11:90801473-90801495 CCCAACAATTTATGTCCTCCAGG + Intergenic
1087901069 11:103641744-103641766 CCCCAAAATTCATGTCCACCTGG + Intergenic
1091721664 12:2818458-2818480 GACAAAAATTGCTGCCCTCCTGG + Intronic
1094498477 12:31003919-31003941 CATCAAAAGTTATATCCTCCTGG + Intergenic
1095577370 12:43756377-43756399 GACCAATATTTACAGCCTCCAGG - Intronic
1096210836 12:49764311-49764333 AGCCAAAAATTATGTCCTACTGG - Exonic
1096910341 12:54977161-54977183 ACCCAAAATTTCTGTCCTCGTGG - Intronic
1098051686 12:66460892-66460914 AGCCAAAATTTATTTCCTCTTGG + Intronic
1098483994 12:70999782-70999804 GACAAAAATTGATGTTTTCCTGG - Intergenic
1098849116 12:75573590-75573612 GACCAGAACTTCTGTACTCCCGG + Intergenic
1100209597 12:92387786-92387808 GGGCAAAATTTATGTGCCCCAGG - Intergenic
1100705538 12:97196568-97196590 GACAAAAATTCTTGTCCTCATGG + Intergenic
1100795734 12:98179907-98179929 CACTAAAATTCATGTCCACCTGG - Intergenic
1102423396 12:112821781-112821803 GACAAAAATTATTGTCCTCATGG - Intronic
1106650029 13:31680200-31680222 GAAAAATATTTATGTCCTCAAGG + Intergenic
1107450233 13:40501659-40501681 TACTTAAAATTATGTCCTCCAGG - Intergenic
1108823470 13:54381961-54381983 GCCCAAAATGTATGCCCACCTGG - Intergenic
1108898461 13:55365724-55365746 GATCAAAATTTATGACCAGCAGG - Intergenic
1109584180 13:64376234-64376256 GAGCAAAATTAAGGTCCTCGGGG - Intergenic
1111473902 13:88722629-88722651 CCCCAAAATTTATGTCCACCTGG + Intergenic
1111626643 13:90796457-90796479 GACTGAAATTTATGTCATCCAGG - Intergenic
1113112395 13:106837851-106837873 CCCCAAAATTTATGTCCACTTGG + Intergenic
1114017072 14:18440215-18440237 GACAAACATTTATAACCTCCTGG + Intergenic
1114850672 14:26379139-26379161 GACCAGAAAATATGTCCTGCTGG + Intergenic
1117449533 14:55837453-55837475 AACCAAAACTGCTGTCCTCCAGG - Intergenic
1118128929 14:62940380-62940402 CACCTCAATTTATGTCTTCCTGG + Intronic
1118179972 14:63482942-63482964 GACAAAGATTTCTGTCCTGCTGG + Intronic
1120512360 14:85430803-85430825 GGCAAAAATTTCTGTCCTCATGG + Intergenic
1121118265 14:91358640-91358662 GACCAAATTAAATGTCCTCCTGG - Intronic
1121558187 14:94854373-94854395 ATCCAAAATTCATGTCCCCCTGG - Intergenic
1121855910 14:97270125-97270147 GCCAAAACTTAATGTCCTCCAGG + Intergenic
1126568995 15:50129636-50129658 GCCCAAAATTCATGTCTACCTGG - Intronic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1128329626 15:66747153-66747175 GATAAGAATTTCTGTCCTCCTGG - Intronic
1128423128 15:67513660-67513682 GACTAAAAATCCTGTCCTCCTGG - Intergenic
1129949434 15:79572885-79572907 GCCCAAAATTGATCTCCTGCTGG + Intergenic
1131476906 15:92747503-92747525 TCCCCAAATTTATGTCCACCTGG - Intronic
1133456695 16:5948425-5948447 GCCCAAAATTCATGTCTACCTGG + Intergenic
1140338337 16:74133041-74133063 GATCAAAAGTTAAGTCTTCCTGG - Intergenic
1141133313 16:81449496-81449518 AATTAAAATCTATGTCCTCCAGG + Intronic
1146249557 17:31326683-31326705 GACCAACATTTGTGTCATCATGG + Intronic
1147347802 17:39814475-39814497 CTCCTAAATTCATGTCCTCCTGG + Intronic
1149483325 17:57021328-57021350 GGTTAAAATTTATGTCTTCCAGG + Intergenic
1149824498 17:59815450-59815472 GACAAAAATCTCTGCCCTCCTGG - Intronic
1150728950 17:67675060-67675082 TTCCAAAATTTATGACCTCCTGG + Intronic
1151222783 17:72625596-72625618 CACCAAAATCCATGTCCACCTGG - Intergenic
1153898827 18:9596476-9596498 GATAAAAATTTCTGTCCTCATGG - Intronic
1153959190 18:10125946-10125968 TACCAATATATATGTTCTCCAGG + Intergenic
1157047029 18:44113739-44113761 GTCCAATATTTATCTCCTTCTGG + Intergenic
1161228692 19:3161322-3161344 CCCCAAAATTCATGTCCACCTGG - Intronic
1161692018 19:5741242-5741264 CCCCAAAATTTATGTCAACCTGG + Intronic
1165765153 19:38345925-38345947 GACCCAAATCTCTGCCCTCCTGG + Intronic
926174537 2:10578187-10578209 GAGCACAAATTAAGTCCTCCAGG + Intronic
926937508 2:18101107-18101129 GAGAAACATTTATGTCCTCTAGG + Intronic
927398794 2:22686846-22686868 GAGGAAATTTTATCTCCTCCTGG - Intergenic
928209441 2:29312649-29312671 GGCCCAACATTATGTCCTCCTGG + Intronic
928292192 2:30049237-30049259 GACAGAGATTTATGTCCTACTGG - Intergenic
928306849 2:30177408-30177430 GAACAAAATTCTTGTCCTTCAGG + Intergenic
928697305 2:33862180-33862202 CTCCAAAATTTATGTCCACCTGG - Intergenic
928924129 2:36559658-36559680 GGCCAGAAATGATGTCCTCCTGG + Intronic
930023188 2:47013602-47013624 GACCTAAATTTAGGGCTTCCTGG - Intronic
932524542 2:72450049-72450071 GAACAACATTTATGGCCACCAGG + Intronic
932950387 2:76286543-76286565 TCCAAAAATTTATGTCCACCTGG + Intergenic
933844147 2:86311744-86311766 CTCCAAAATTCATGTCCACCTGG - Intronic
935086409 2:99849969-99849991 GACAAAAATTCCTGTCCTCATGG + Intronic
936412145 2:112269697-112269719 GACCGTAATTTATGACCTCATGG + Intergenic
937968327 2:127531429-127531451 GACCAGAACGAATGTCCTCCCGG - Intergenic
939301918 2:140353751-140353773 TATCATAATTTATGTCCTCAAGG - Intronic
939308991 2:140448468-140448490 GACATAAAATAATGTCCTCCAGG - Intronic
941083124 2:161085719-161085741 GAACTAAATCTCTGTCCTCCAGG + Intergenic
942838239 2:180327471-180327493 GCCCACACTTTATTTCCTCCTGG - Intergenic
943743166 2:191433277-191433299 GACTACAATTTATGTCTTCTGGG + Intergenic
945602539 2:211886329-211886351 GAACCAAATTTATGTTCTTCTGG - Intronic
946395025 2:219439331-219439353 GACCAAAATTTATGTCCTCCAGG + Intronic
946815144 2:223569476-223569498 GACCAAAACTTCTGTCTCCCTGG + Intergenic
946996746 2:225401024-225401046 TACCAAAATTTAAGTCCCCAGGG - Exonic
947986928 2:234456236-234456258 CTTCAAAATTTATGTCCACCTGG + Intergenic
1168862688 20:1057215-1057237 AACAGAAATTTATTTCCTCCTGG - Intergenic
1170467386 20:16635232-16635254 CGCCAAAATTTATGTCTACCTGG + Intergenic
1170468309 20:16643153-16643175 GAGCCAAATTGATGTCCTCCAGG - Intergenic
1173882365 20:46425454-46425476 TACCAAAATTTATTTCCTATTGG - Intronic
1174200995 20:48806245-48806267 GACAAAGATCTTTGTCCTCCTGG - Intronic
1174426108 20:50432594-50432616 GGCCAAAATTCAGGTCCTCTAGG + Intergenic
1175113896 20:56668165-56668187 CTCCCAAATTTATGTCCACCTGG + Intergenic
1175320852 20:58087217-58087239 GACCAAGATCTACCTCCTCCAGG + Intergenic
1178086954 21:29121845-29121867 GACCAACATTTATGAACACCAGG + Intronic
1179438100 21:41375768-41375790 CCCCAAAATTTATGTTCACCTGG - Intronic
1180441578 22:15371084-15371106 GACAAACATTTATAACCTCCTGG + Intergenic
1182852326 22:33485899-33485921 GACAAAAATTTCTGCCCACCTGG - Intronic
1183267377 22:36837129-36837151 GAGCAGAATTAATTTCCTCCTGG - Intergenic
949280139 3:2336275-2336297 GACCAAGATTCCTGACCTCCTGG - Intronic
950659797 3:14460236-14460258 GACAAAAATTCCTGTGCTCCAGG + Intronic
951507980 3:23470148-23470170 GACCCAATTTTAGGACCTCCTGG - Intronic
952153320 3:30616290-30616312 AACCAAAATATTTTTCCTCCAGG + Intronic
953490607 3:43347351-43347373 AACCAAAATTGATGTACCCCAGG + Exonic
954400162 3:50315296-50315318 GACCATCTTTTAGGTCCTCCGGG + Intergenic
955120808 3:56056217-56056239 GACCAAACCTTATGTCCTCTAGG - Intronic
957368032 3:79252225-79252247 GCCCAGAATTCATGTCCACCAGG + Intronic
958992788 3:100866768-100866790 GATCAAAATGTATTTCCTACTGG + Intronic
959096567 3:101962978-101963000 CCCCAAAATTTATGTCCACATGG - Intergenic
960241246 3:115344751-115344773 GACAAAAATTAATGCCCTCATGG + Intergenic
963326019 3:143863916-143863938 CACCAACACTTCTGTCCTCCTGG - Intergenic
964682798 3:159361074-159361096 GACCAAAATTCTTGTCCTCATGG + Intronic
969119915 4:4900566-4900588 CCCCAAAATTTGTGTCCACCTGG - Intergenic
970089967 4:12394794-12394816 AACTCAAATTTTTGTCCTCCAGG + Intergenic
971805573 4:31354541-31354563 TACCTAAATGTAAGTCCTCCAGG - Intergenic
975108566 4:70597567-70597589 GACCAAAATTTCTGTTTTGCTGG - Intronic
976189166 4:82472641-82472663 GACACAAATCTCTGTCCTCCTGG + Intergenic
977491960 4:97725543-97725565 TACCAACAGTTATGTGCTCCTGG - Intronic
980891798 4:138823486-138823508 GAGCAAAATTCAGGTCATCCGGG + Intergenic
984398302 4:179228445-179228467 TATCAAAACTTATGTTCTCCTGG - Intergenic
984419023 4:179496210-179496232 GACCTAAAGTTATGTCCTCTTGG - Intergenic
986422935 5:7602211-7602233 CACCAAAAATTATGTCCACTTGG - Intronic
986799650 5:11246254-11246276 TCCCAGAATTCATGTCCTCCTGG + Intronic
989251000 5:39314926-39314948 GATGAAAATTTGTGTCCTCATGG - Intronic
990729377 5:58791578-58791600 AAACATAATTCATGTCCTCCAGG + Intronic
991600316 5:68345602-68345624 GACCATAATTTGTTTCCTTCTGG - Intergenic
991603836 5:68380474-68380496 GACAAAAACCTCTGTCCTCCTGG + Intergenic
993742051 5:91553646-91553668 CTCCAAAATTCATGTCCACCTGG + Intergenic
995168201 5:109073122-109073144 CCCCAAAATTTATGTCTACCTGG - Intronic
995174911 5:109165084-109165106 GACAAGAATTCATGTCCTCATGG - Intronic
997444006 5:133928250-133928272 GAACAAAATCCCTGTCCTCCTGG + Intergenic
997941349 5:138160389-138160411 GATCAAAATCTCTATCCTCCAGG + Intronic
998528999 5:142868195-142868217 GCCCAAAAGTTCTTTCCTCCAGG - Intronic
1000373052 5:160555492-160555514 GCCCAATATTTGTGTCCTTCTGG + Intergenic
1003780501 6:9419655-9419677 GGCCAAAATCCATGTCTTCCAGG + Intergenic
1006050173 6:31336111-31336133 GAGCATAATGTATTTCCTCCTGG + Intronic
1008412318 6:51193925-51193947 GAGCAAAAACTGTGTCCTCCAGG + Intergenic
1009198420 6:60714993-60715015 GACCAAGATTCAAATCCTCCAGG + Intergenic
1009930490 6:70172130-70172152 GACAAAAATGTATGTACTCATGG + Intronic
1011166530 6:84454025-84454047 GCCCCAAATTAATGTCCACCTGG + Intergenic
1013697863 6:112725270-112725292 GTTCAAGATTTATGCCCTCCAGG + Intergenic
1016698916 6:147031884-147031906 GAACAAGATTTATGTCTTTCAGG + Intergenic
1018060724 6:160087599-160087621 GCCCAAAATTTATTTTCTTCTGG + Intronic
1018568659 6:165184300-165184322 CTCCAAAATTCATGTCCACCTGG - Intergenic
1019332991 7:470131-470153 CCCCCAAATTTATGTCCACCTGG - Intergenic
1023587852 7:41749905-41749927 CCCCAAAATTTCTGTCCTCCAGG + Intergenic
1024410180 7:49031458-49031480 TTCCAAAATTTATGTCCACCTGG + Intergenic
1028972335 7:96872712-96872734 CCCCAAAATTCATGTCCACCTGG - Intergenic
1029195195 7:98800861-98800883 ACCCAAAATTCATGTCCACCTGG + Intergenic
1031029127 7:116715563-116715585 TCCCAAAATTCATGTCCACCTGG - Intronic
1031881242 7:127200859-127200881 CCCCAAAATTTGTGTCCACCTGG - Intronic
1032570321 7:132989214-132989236 GACCAAAATAAATGTCCTCTTGG - Intronic
1032607460 7:133371059-133371081 GAGAAAAGTTGATGTCCTCCTGG + Intronic
1032811861 7:135427606-135427628 GACCATAATTTATGTATTACAGG + Intronic
1033384043 7:140853872-140853894 GACAAAAACCTATGCCCTCCTGG - Intronic
1037288844 8:17329594-17329616 GAAGAATATTTATGTTCTCCAGG + Intronic
1037627348 8:20619634-20619656 CACCAAAATTCATGTTCACCTGG + Intergenic
1037758546 8:21727091-21727113 TCCCAACATTTATGTCCACCCGG - Intronic
1041083776 8:54238185-54238207 TCCCCAAATTTATGTCCACCTGG + Intergenic
1043438699 8:80258190-80258212 GACAAAAATTCCTGTCCTCTGGG - Intergenic
1046204483 8:110974999-110975021 GACAAAAATTTTTGTCCTCATGG + Intergenic
1048491779 8:134900964-134900986 CCCCAAAATTCATGTCCACCTGG - Intergenic
1052332669 9:27285913-27285935 GAACAAAATATATTTGCTCCAGG + Intronic
1055968611 9:81889369-81889391 CCCCAAAATTTATGTCCTCCTGG + Intergenic
1056799123 9:89679161-89679183 CTCCAAAATTTCTGTCTTCCAGG - Intergenic
1058974616 9:110114440-110114462 CCCCAAAATTCATGTCCACCCGG - Intronic
1059248954 9:112871183-112871205 AGGCAAACTTTATGTCCTCCTGG + Exonic
1060162311 9:121375528-121375550 GACCAAAATTCCTGTCCTCGTGG + Intergenic
1060280487 9:122212806-122212828 GACCAAAGCTTCTGTGCTCCTGG - Intronic
1060855527 9:126912363-126912385 GACAAAAATTCTTGTCCTCGTGG - Intergenic
1186399458 X:9243224-9243246 CCCCAAAATTGATGTCCACCTGG - Intergenic
1187088921 X:16073329-16073351 CCCCAAAATTTATATCCACCTGG + Intergenic
1187191565 X:17040497-17040519 GACAAAATTTTCTGTCCTCCTGG + Intronic
1188456174 X:30369028-30369050 GACAAAAATTCATGTCCTCAGGG + Intergenic
1188537114 X:31209577-31209599 GACCACTATTTATGACCGCCTGG - Exonic
1189699151 X:43698601-43698623 GATCAAAATTTCTGCCCTCATGG + Intronic
1192535779 X:71926343-71926365 GGCCAAAATATTTGTCCTCGTGG + Intergenic
1194567765 X:95514559-95514581 GACCAAGATTTATCTACTTCTGG + Intergenic
1198297037 X:135296910-135296932 AAGCAAGATTTCTGTCCTCCAGG - Intronic
1198854675 X:141003386-141003408 CACCCAAAATAATGTCCTCCTGG + Intronic
1198877342 X:141241761-141241783 CACCCAAAATAATGTCCTCCTGG - Intronic
1198908026 X:141583982-141584004 CACCCAAAATAATGTCCTCCTGG - Intronic
1198908765 X:141590442-141590464 CACCCAAAATAATGTCCTCCTGG + Intronic
1198918304 X:141697709-141697731 CACCCAAAATAATGTCCTCCTGG - Intronic
1199871139 X:151899997-151900019 GAACAAAATATATACCCTCCTGG + Intergenic
1201939915 Y:19448502-19448524 GGGCATAATTTATCTCCTCCTGG - Intergenic
1202330362 Y:23745172-23745194 GGGTAAAATTTATTTCCTCCTGG + Intergenic
1202540407 Y:25924889-25924911 GGGTAAAATTTATTTCCTCCTGG - Intergenic