ID: 946396999

View in Genome Browser
Species Human (GRCh38)
Location 2:219448240-219448262
Sequence GGTGCCCGCCAGGGAGGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 439}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946396999_946397014 29 Left 946396999 2:219448240-219448262 CCGGGCCCTCCCTGGCGGGCACC 0: 1
1: 0
2: 1
3: 33
4: 439
Right 946397014 2:219448292-219448314 CGAGGCCTCAGGCCGCCTGTCGG 0: 1
1: 0
2: 1
3: 4
4: 122
946396999_946397012 18 Left 946396999 2:219448240-219448262 CCGGGCCCTCCCTGGCGGGCACC 0: 1
1: 0
2: 1
3: 33
4: 439
Right 946397012 2:219448281-219448303 ACGCCACTGAGCGAGGCCTCAGG 0: 1
1: 0
2: 2
3: 31
4: 380
946396999_946397008 11 Left 946396999 2:219448240-219448262 CCGGGCCCTCCCTGGCGGGCACC 0: 1
1: 0
2: 1
3: 33
4: 439
Right 946397008 2:219448274-219448296 ACCCCAGACGCCACTGAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946396999 Original CRISPR GGTGCCCGCCAGGGAGGGCC CGG (reversed) Exonic
900123346 1:1058891-1058913 GGTGCCAGGCAGGGAGAGGCTGG + Intergenic
900147236 1:1163562-1163584 GGTGCCCTCAGGGCAGGGCCTGG + Intergenic
900267433 1:1765239-1765261 GGTGCTCCCCAGGGCGGGCGAGG + Exonic
900339804 1:2182641-2182663 GGTGCCAGCCAGGATGGGGCCGG - Intronic
900343619 1:2200473-2200495 GCTGCACGCCAGGGAATGCCGGG + Intronic
900395666 1:2452301-2452323 GCTACCTGCCAGGCAGGGCCGGG - Intronic
900405612 1:2491700-2491722 GGTGACAGGCAGGGTGGGCCGGG + Intronic
900600764 1:3501812-3501834 GGTGTCCGCCGGGGAGGACTGGG - Exonic
900619572 1:3580641-3580663 GGTGCCCCCCAGGCTGGACCGGG + Intronic
900659753 1:3776579-3776601 GGCGGCTGCCAGGGAGGACCCGG + Intergenic
901632829 1:10656226-10656248 GCTGCCCGCCAGTGAGCGCGGGG - Intronic
901840778 1:11952657-11952679 GGTGGCCGAGTGGGAGGGCCAGG + Exonic
902339281 1:15772299-15772321 GGGACACGGCAGGGAGGGCCTGG - Intronic
902449972 1:16490839-16490861 GGGGCACAACAGGGAGGGCCAGG - Intergenic
902748044 1:18486378-18486400 TGTGCCCACCAGGGAGAGCCGGG + Intergenic
903181237 1:21606017-21606039 AGGGCCCCCCAGGGAGGGGCCGG + Intronic
903262066 1:22136780-22136802 CCTTCCTGCCAGGGAGGGCCTGG - Intronic
903263639 1:22143710-22143732 GGTGAGCGCCAGGGAGGGGCTGG - Intronic
903278400 1:22236225-22236247 GCAGCCCCCTAGGGAGGGCCGGG - Intergenic
903287425 1:22285754-22285776 GCAGCCCGCCTGGGACGGCCTGG - Intergenic
904256918 1:29260052-29260074 GGTGGACGCCGGGGAGCGCCGGG + Intronic
904374458 1:30071341-30071363 GGTAGCCAGCAGGGAGGGCCTGG - Intergenic
904566781 1:31433057-31433079 GGTGGCAGCCTGTGAGGGCCGGG + Exonic
905238716 1:36568230-36568252 GGTGCCAGTCAGGGAGAGGCTGG + Intergenic
905375675 1:37518558-37518580 GGTGCTCGTCAGGGAGGCTCGGG - Intergenic
905890096 1:41513390-41513412 GGTCCCAGCCAGGGGAGGCCCGG + Exonic
908939022 1:69409978-69410000 CATGCCTGCCAGGGTGGGCCAGG - Intergenic
910200072 1:84690314-84690336 GCGCCCCGCCAGGGAGGGGCGGG - Intronic
911208704 1:95117800-95117822 GGAGCCCGCCCGGGAGCCCCGGG - Intronic
912538710 1:110396383-110396405 GGTGCTCGTCAGGGAGGTTCAGG + Intergenic
913264734 1:117033309-117033331 GGAGACCCACAGGGAGGGCCAGG + Intronic
913300914 1:117367571-117367593 GGTTCCTGCCAGGCAGCGCCGGG + Exonic
914919473 1:151837943-151837965 GGTGGGCGCCAGGGATGACCCGG + Exonic
915721074 1:157986081-157986103 GGTACCTGCCAGGCAGGGTCTGG - Intergenic
915767117 1:158374209-158374231 GGTGCTCGTCAGGGAGGCTCGGG + Intergenic
920269449 1:204752210-204752232 TGTGCCCTTCCGGGAGGGCCAGG + Intergenic
922802705 1:228371556-228371578 GGAGGCCGCCAGGGAGGAGCAGG + Exonic
924034750 1:239924819-239924841 AGTGCCCGTCAGGGAGGCTCGGG + Intergenic
1062827655 10:584527-584549 GGTGCCCGTGAGTGGGGGCCAGG - Intronic
1062993335 10:1841349-1841371 GGTTCACGCCAGGGAGTGCATGG - Intergenic
1063114990 10:3067105-3067127 GGGGCGCGCCAGGGCGGGGCGGG - Intronic
1063364330 10:5480666-5480688 GGGGCCCTCCAGGGAGGGGAAGG - Intergenic
1063848753 10:10161199-10161221 AGTGCCCGTCAGGGAGGCTCGGG - Intergenic
1064461069 10:15535243-15535265 GGTGCGCGTCAGGGAGGCTCGGG - Intronic
1065261877 10:23932020-23932042 GCAGCCCGGCAGGGAGGGCAGGG + Intronic
1065972761 10:30818330-30818352 GGGACCCGCCAGAGAGGGCGAGG - Intergenic
1066464780 10:35641926-35641948 GGTGGCCGCCAGGGCTGACCCGG - Exonic
1067095828 10:43298896-43298918 GGTTCCAGCCAGCGAGGCCCAGG - Intergenic
1069772691 10:70909692-70909714 GGTACCCAGCAGGGTGGGCCTGG - Intergenic
1069898152 10:71691692-71691714 TGTGACTGCCAGGCAGGGCCTGG - Intronic
1070716909 10:78729146-78729168 GGTGGAAGGCAGGGAGGGCCAGG + Intergenic
1072206078 10:93206466-93206488 GGAGCCTGCTAGGGAGGGCTGGG - Intergenic
1072341800 10:94459548-94459570 GGTGCCCGTCGGGGAGGCTCGGG + Intronic
1072903659 10:99431064-99431086 CGGGCCCGCCAGGCCGGGCCTGG - Intergenic
1073043253 10:100621521-100621543 TCTGGCCGCCAGGGAGGGGCTGG - Intergenic
1074406035 10:113181042-113181064 AGTGTCCTCCTGGGAGGGCCTGG + Intergenic
1074820315 10:117173595-117173617 GGTGCCTGCCAGTGCAGGCCAGG + Intergenic
1075336667 10:121613633-121613655 AGGGAGCGCCAGGGAGGGCCAGG - Intergenic
1075566063 10:123505209-123505231 GGTGCCAGACAGGCAGGGGCAGG - Intergenic
1075728500 10:124622854-124622876 GGGGGCTGTCAGGGAGGGCCTGG - Exonic
1076715445 10:132361724-132361746 GGTGGGCTCCAGGGAGAGCCAGG + Intronic
1077068679 11:657168-657190 GGTGCCAGGCAGGGAGCCCCAGG - Intronic
1077135391 11:995599-995621 GGTCCCCGCCAAGGAGTGCCAGG - Intronic
1077147513 11:1052671-1052693 AGTGCTGGCCACGGAGGGCCTGG + Intergenic
1077167327 11:1149707-1149729 GGTGGCCGCCAGGGCTGGGCAGG - Intergenic
1077232076 11:1462266-1462288 TGTGCCCGCCTGGGAGGGCTGGG - Intronic
1077382393 11:2250221-2250243 GGTGACCCCAGGGGAGGGCCAGG + Intergenic
1077550424 11:3197695-3197717 AGTGCCGGCCAGGGAGGAGCAGG - Intergenic
1078597611 11:12702009-12702031 GGAGCCAGCCAGAGAGGGCTGGG - Intronic
1078665285 11:13319842-13319864 GGGCCCTGCCAGGGAGTGCCAGG + Intronic
1079004247 11:16781152-16781174 GCTGCCCACCACGAAGGGCCTGG + Intronic
1079970691 11:27031946-27031968 GGTGCATGGCAGTGAGGGCCGGG - Intergenic
1080834483 11:35927765-35927787 GGCCCCTGCCAAGGAGGGCCGGG - Intergenic
1082109919 11:48263176-48263198 GGTGGCCGCCAGGGACTGCAGGG - Intergenic
1083271994 11:61577332-61577354 GATGCAGGCCAGGGAGGCCCGGG + Intronic
1083306926 11:61766155-61766177 GGTGCCCCCCGGGAAGGGCTTGG - Exonic
1084115968 11:67043119-67043141 GGTGCCCACCAGGCAGGACTGGG + Intronic
1084270478 11:68026820-68026842 GCTGCCCTCCAGGAAGGGCATGG - Intronic
1084328180 11:68413936-68413958 GGTGGCCGCCGGGGATGGCAAGG - Exonic
1084425893 11:69084482-69084504 GCTGGCCCCCAGGGAGGGGCCGG - Intronic
1084463437 11:69308867-69308889 GGAGCCCGCCAGGCAGCACCTGG + Intronic
1084564410 11:69921038-69921060 GGTGCTCCTCAGCGAGGGCCTGG + Intergenic
1085953992 11:81368446-81368468 GGTGCCCGTCAGAGAGGCTCAGG + Intergenic
1092137474 12:6159780-6159802 GGTGCTCGTCGGGGAGGGTCCGG - Intergenic
1093214539 12:16347749-16347771 GGTGGCAGGCAGGGAGGGCCAGG + Intronic
1094041801 12:26126522-26126544 CGTGCCCGGCGGGGCGGGCCGGG - Intronic
1094870560 12:34597086-34597108 GGTGCCAACCAGGGATGTCCAGG - Intergenic
1096148943 12:49296767-49296789 AGTGGGCGCCAGGGAGGGCAGGG - Intronic
1096217952 12:49808872-49808894 AGTGCCGGCCAGGCAGGGTCTGG + Intronic
1096467585 12:51855943-51855965 GGTGACGGCCAGGAGGGGCCGGG + Intergenic
1102043566 12:109815975-109815997 GGTGCCAGCCAGGCAGGGCTGGG + Intronic
1103509975 12:121467393-121467415 GGGGCCGGCGGGGGAGGGCCGGG + Intronic
1104487507 12:129164004-129164026 AGTTCCCACCAGGGAAGGCCTGG - Intronic
1104592090 12:130092701-130092723 GGGGGCTGGCAGGGAGGGCCAGG + Intergenic
1104714190 12:131005711-131005733 GAAACCCCCCAGGGAGGGCCAGG - Intronic
1104759205 12:131287036-131287058 GGTGGAGGCCAGGGAGGGGCAGG - Intergenic
1104821406 12:131679460-131679482 GGTGGAGGCCAGGGAGGGGCAGG + Intergenic
1104985004 12:132591761-132591783 GGGGCCGGGCAGGGAGCGCCTGG - Intergenic
1105722215 13:23127877-23127899 GGTGCTCGTCAGGGAGGCTCGGG - Intergenic
1106144523 13:27039539-27039561 GCTGCCCACCAGGAAGAGCCAGG - Intergenic
1106568346 13:30906060-30906082 AGTGTCCGCCAGGCAGGGCGGGG + Intergenic
1107111920 13:36707312-36707334 GGTGGCAGCCAGGGTGAGCCAGG + Intergenic
1108845719 13:54676876-54676898 GGTGCCCGTCAGGGAGGCTTGGG - Intergenic
1110024029 13:70511965-70511987 GGTGCTCGTCAGGGAGGCTCGGG + Intergenic
1113189040 13:107722558-107722580 GGGGCCCGCTAGGGAGGCACTGG - Intronic
1113941022 13:114018671-114018693 GGTGCCCTCTGGGGTGGGCCCGG + Intronic
1114307449 14:21437022-21437044 GGTGCCCTCCAGGGTGGGGATGG + Intronic
1116152076 14:41154300-41154322 GGCGCCCGTCAGGGAGGCTCGGG + Intergenic
1116297865 14:43135981-43136003 GGTGCCTGTCAGGGAGGCTCGGG + Intergenic
1117449853 14:55839773-55839795 GGTGCTCGTCAGGGAGGCTCGGG - Intergenic
1118704012 14:68463025-68463047 GGTGCCCTGCAGGGAGGCCTAGG - Intronic
1118837512 14:69487249-69487271 AGAGCCAGCCAGAGAGGGCCTGG + Intronic
1119480786 14:74956292-74956314 GCTGCCCCGCAGGGAGGGCCTGG - Intergenic
1119492784 14:75051194-75051216 GGGGCTGGCCAGGGAGGGGCTGG - Intronic
1120380363 14:83770431-83770453 GGTGCTGGCCAGGGAGCGCTGGG - Intergenic
1121145440 14:91578280-91578302 GGTGCCCCTCAGGGAGGCTCAGG - Intergenic
1121668685 14:95691803-95691825 GGAGCAGGCCAGGCAGGGCCTGG + Intronic
1121884406 14:97530029-97530051 GGTGACCTCCAGGGAGTGACTGG - Intergenic
1121961720 14:98266369-98266391 TGTTCCAGCCAGGGAGGGGCAGG + Intergenic
1122064138 14:99159911-99159933 GGTGCTGGGCAGGGAGGACCAGG + Intergenic
1122270931 14:100568203-100568225 GGGGCCGGCCCGGGATGGCCCGG + Intronic
1122278451 14:100607601-100607623 GGTACCCTCCAGGGTGGGCAGGG - Intergenic
1122399436 14:101458346-101458368 GGTGCCAGCCTGGGACGGCCTGG + Intergenic
1122692793 14:103539126-103539148 GGGGCCTGCCATGGGGGGCCAGG - Intergenic
1122697990 14:103566841-103566863 GGTGCCCAACAGGCAGGCCCAGG - Intronic
1122799822 14:104223938-104223960 AATGCCCTCCTGGGAGGGCCCGG + Intergenic
1122891256 14:104733265-104733287 GGGCCCAGCCAGGCAGGGCCAGG + Intronic
1122980051 14:105187358-105187380 GGTGCTTGGCAGGGAGAGCCTGG + Intergenic
1124118425 15:26867953-26867975 GGAGCGAGCCGGGGAGGGCCGGG + Intronic
1124439518 15:29675944-29675966 GGAGGCCGACGGGGAGGGCCTGG + Intergenic
1125550200 15:40539217-40539239 GGTAACAGCCAGGGCGGGCCAGG - Intronic
1127963697 15:63908483-63908505 AGTGGCCGCCAGGGAGGTCTGGG - Exonic
1128506836 15:68278408-68278430 GGCGGCGGCCATGGAGGGCCTGG + Exonic
1128995014 15:72289334-72289356 GGGGCGCGCCTGGGAGGGGCCGG - Intronic
1130648679 15:85749999-85750021 GGTGACTGTCAGGGAGGGGCGGG - Intergenic
1131119551 15:89814105-89814127 GTTGCTCACCAGGGAGGGCGTGG + Intronic
1131393873 15:92071247-92071269 GGTGCCTGCCAGGGAGCGTGAGG + Intronic
1132204472 15:99976959-99976981 GGTGGCCCCCAGGAAGGACCGGG + Intronic
1132372492 15:101308322-101308344 ACTGCCCCCCAGGGAGGCCCAGG - Intronic
1132498741 16:275643-275665 GGGGCGGGCCGGGGAGGGCCGGG + Intronic
1132574028 16:656554-656576 GCAGCACGGCAGGGAGGGCCGGG + Intronic
1132642967 16:986210-986232 GGAGGCCGCCCTGGAGGGCCCGG + Exonic
1133039042 16:3050169-3050191 GGAGCCCAGCAGGCAGGGCCAGG - Intronic
1133285711 16:4689692-4689714 GGCCCCTGCCAGGGAGGACCTGG + Exonic
1133286665 16:4693907-4693929 GGTGCCGGCGCGGGCGGGCCCGG + Intronic
1133417267 16:5616374-5616396 GGTGCTGGCCAGCGAGGTCCAGG + Intergenic
1135106197 16:19652001-19652023 GATGCCCGCCAGGGAGGGGATGG - Exonic
1135751019 16:25058964-25058986 GGTGCTCGTCAGGGAGGCTCGGG + Intergenic
1136666746 16:31819443-31819465 GGTCCCAGCCAGCGAGGCCCCGG + Intergenic
1138486799 16:57350549-57350571 GGTGGCTGCCAGGGTGGGTCTGG - Intergenic
1139198726 16:64950729-64950751 GGTCCCCTGCAGGAAGGGCCAGG - Intronic
1140069523 16:71637113-71637135 GGTTCCAGCCAGGGTTGGCCTGG - Intronic
1140416035 16:74774587-74774609 GCTGCGGGCCAGGGCGGGCCAGG - Exonic
1141671945 16:85496732-85496754 GGTGCACGAGAGGGAGGGGCAGG + Intergenic
1141848841 16:86630348-86630370 GCTGCCCGTGAGGGAAGGCCGGG - Intergenic
1141867603 16:86761352-86761374 GGAGCCTGTCAGGGAGGGCAGGG + Intergenic
1141896324 16:86960958-86960980 GCTGCCCACCAGGGTTGGCCTGG - Intergenic
1141948503 16:87325743-87325765 GGTGCCCTCCAGGGAGAGCAGGG - Intronic
1142137504 16:88458405-88458427 GGTGACCTCCAGGGAGGGGCTGG - Intronic
1142215722 16:88828883-88828905 GGTGCCCACCAGGCCGGGACAGG - Intronic
1142352237 16:89585804-89585826 GGGGTCCTCCAGGGAGGGTCAGG + Intronic
1142407068 16:89896170-89896192 GCTGCCCTCCAGGGTGGACCAGG + Intronic
1142412797 16:89924757-89924779 TGTGCCTGCCAAGGAGAGCCTGG + Intronic
1142433374 16:90042547-90042569 GGTGCCCCTGAGGGAGGGCAGGG - Intronic
1142717634 17:1755647-1755669 GGTGCCCGCCAGCCGGGGGCAGG + Intergenic
1142719549 17:1767031-1767053 GCTGCCTGCCAAGGAGGGGCGGG - Intronic
1143133215 17:4694204-4694226 GGAGGCAGCCAGGGAGGGCTTGG + Intronic
1143189830 17:5033282-5033304 GGTGCCCACCAGGGGTGGGCAGG + Exonic
1143369004 17:6426803-6426825 AGTGCCGGCCAGGGTGGGGCGGG - Intronic
1143893970 17:10122515-10122537 GGAGGGCGCCAGGGAGGGCGAGG - Intronic
1144626349 17:16846191-16846213 GGTGGCTGCCTGGGAGGGCCTGG - Intergenic
1144880083 17:18426528-18426550 GGTGGCTGCCTGGGAGGGCCTGG + Intergenic
1145152150 17:20517856-20517878 GGTGGCTGCCTGGGAGGGCCTGG - Intergenic
1145257557 17:21335188-21335210 GGTGCTTCCCAGGGAGGGCATGG - Intergenic
1145319082 17:21752847-21752869 GGTGCTTCCCAGGGAGGGCATGG + Intergenic
1146163509 17:30572074-30572096 GGTGGCTGCCTGGGAAGGCCTGG - Intergenic
1147215853 17:38898634-38898656 CCTGCCCTCCAGGGTGGGCCTGG + Intronic
1147250712 17:39151327-39151349 GGAGCCGGCCCGGGTGGGCCGGG - Intronic
1147459677 17:40560261-40560283 GGTCCCAGCTAGGTAGGGCCTGG + Intronic
1147580495 17:41624889-41624911 GGTGGCTGCCTGGGAGGGCCTGG - Intergenic
1147741538 17:42673377-42673399 GGTACACACCAGGGAGAGCCAGG - Exonic
1147805396 17:43127127-43127149 GGTGCCCGTCGGGGAGGCTCAGG - Intergenic
1148148374 17:45380385-45380407 GCTTCCTGGCAGGGAGGGCCTGG - Intergenic
1148647023 17:49225070-49225092 GGAGCCCGCCCGGGAGAGGCTGG + Exonic
1149660648 17:58332523-58332545 GGTTCCCTTCAGGGAGGGCAGGG + Intergenic
1150792273 17:68208120-68208142 GGTGCTCGTCAGGGAGGCTCAGG - Intergenic
1151156093 17:72123772-72123794 GGTGCCGGCCACGCACGGCCAGG + Exonic
1151804818 17:76398783-76398805 GGTGGTCGCCAATGAGGGCCCGG - Intronic
1152321977 17:79612817-79612839 GGTGCCTGCCAGGCAGTGGCTGG - Intergenic
1152512452 17:80799710-80799732 GGCGGCCGCCAGGGAGGGGAGGG - Intronic
1152559758 17:81072110-81072132 GGAGCCAGCCGGGGAGGGCACGG - Intronic
1152573790 17:81131548-81131570 GCTGCCCGCCAGGGAGGGATGGG - Intronic
1152970737 18:158775-158797 GGTGCCCGCCCGTGCAGGCCAGG - Intronic
1153431987 18:5027856-5027878 GGTCCCCTCCAGGGAGGACACGG + Intergenic
1153947808 18:10032520-10032542 AGTGGCCGCCAGCGAGGCCCTGG - Intergenic
1159040561 18:63319994-63320016 GGCCGCCGGCAGGGAGGGCCCGG + Exonic
1160198600 18:76777551-76777573 GGTGCTCGTCAGGGAGGCTCGGG - Intergenic
1160225486 18:77008259-77008281 GGTGCCTCCCAGGCAGGGGCTGG + Intronic
1160502965 18:79411325-79411347 GGAGCCCGTCGGGGAGGACCTGG + Exonic
1160723807 19:608805-608827 GGTGGCCGGCAGTCAGGGCCAGG + Intronic
1160765801 19:807119-807141 GGCCCCCGCGAGGGAGGGCCAGG - Intronic
1160779392 19:871137-871159 GCTGCCAGCCAGCGACGGCCTGG - Exonic
1160823065 19:1067253-1067275 AGGGCCCGCCAGTGACGGCCGGG + Intronic
1160824843 19:1074731-1074753 GGTGCCCGGGAGGGCGGGCTGGG + Intronic
1160876062 19:1296715-1296737 GGTGCGGGGCAGGGAGGACCTGG - Intronic
1161087319 19:2341089-2341111 GGCGGCCTCCAGGGAGGGCAGGG - Exonic
1161230473 19:3172509-3172531 GGGGCACCCCAGGGAGGGCAGGG - Intronic
1161326690 19:3667648-3667670 GGCACCCACCACGGAGGGCCTGG + Intronic
1161350119 19:3786507-3786529 GGTGCACGCCCGACAGGGCCAGG - Intronic
1161572174 19:5036552-5036574 GGTGCCAGCAGGGGAGGCCCTGG + Intronic
1161703257 19:5805965-5805987 GGTGTCCTCCGGTGAGGGCCGGG + Intergenic
1161723406 19:5915647-5915669 GGGACCCGCAAGGGAGGGGCAGG - Exonic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1162726777 19:12694758-12694780 GGGGCCAGGCAGGGTGGGCCAGG - Intronic
1162805732 19:13137164-13137186 AGAGCCCAGCAGGGAGGGCCTGG + Intronic
1162955912 19:14097742-14097764 GGTGCCCACCAGGCCGGGCGAGG - Exonic
1163702018 19:18790815-18790837 GGTGCGGGGCAGGGAGTGCCAGG - Intronic
1164538107 19:29101731-29101753 GGTGCACCCCAGGTAGGGCATGG + Intergenic
1164578235 19:29418567-29418589 GGTGCTCCCCAGGGAGGTCTGGG + Intergenic
1164615420 19:29664550-29664572 GGAGGAGGCCAGGGAGGGCCAGG + Intergenic
1164776612 19:30858093-30858115 AGTGCCCTCCAAGGTGGGCCCGG - Intergenic
1165076422 19:33282150-33282172 GGGGCCCTCCAGGGAAGTCCAGG - Intergenic
1165169328 19:33880072-33880094 GCTGCCTGCCAGGGAGGGGGTGG - Intergenic
1165433609 19:35785290-35785312 GGTGCCCCCCAGCCAGGGCAGGG - Exonic
1165941802 19:39418172-39418194 TGTGCCCGGCAGTGTGGGCCAGG + Intronic
1166078137 19:40425764-40425786 GGTGCCCGCCGGGGCTGCCCGGG - Intronic
1166568904 19:43781022-43781044 GGTGACGGCCAGGCAGGGCGGGG + Exonic
1166651817 19:44580715-44580737 GTGGCCAGCCAGGGAGGGACTGG + Intergenic
1166683006 19:44779399-44779421 GGTGGCCTCCAGGCAGGTCCTGG - Intronic
1166872239 19:45877692-45877714 GGTGCCTGCCAGGGAGGGCTTGG - Intergenic
1167166886 19:47804620-47804642 GGGTCCCGGCAGGGTGGGCCAGG - Intronic
1167476871 19:49706336-49706358 GGGGCTCACCAGGGAGGACCCGG + Exonic
1167605799 19:50480802-50480824 TGAGGCCGCCAGGAAGGGCCGGG - Intronic
1168145645 19:54418957-54418979 GCTGCCAGCCTGGGAGGGGCTGG + Intronic
1168330409 19:55564501-55564523 GGTGCCCGGGAAGGAGGGCTGGG + Intergenic
925101917 2:1254225-1254247 GGGACCCACCAGGGTGGGCCGGG - Intronic
926007598 2:9384711-9384733 GGTGGCACCCAGGGAGGGCATGG - Intronic
926658026 2:15430949-15430971 GGTGCCCGCCACAGTAGGCCCGG + Intronic
927695794 2:25239028-25239050 GAGGCCGGCCAGAGAGGGCCCGG + Intronic
928167447 2:28981405-28981427 GGTGGGGGCCAGGGTGGGCCAGG + Exonic
929535917 2:42784028-42784050 GGTGCATGCCATGGAGTGCCGGG + Intronic
930094875 2:47559336-47559358 GGAGCCCAGCAGGGAGGCCCTGG + Intronic
932239974 2:70148612-70148634 GGTGCTCGTCAGGGAGGCTCGGG - Intergenic
932269207 2:70394468-70394490 GGGGCCTGTCAGGGAGGGCAGGG - Intergenic
932756674 2:74414565-74414587 GCTGGCAGACAGGGAGGGCCAGG - Exonic
933139857 2:78779303-78779325 GGCGCCCGTCAGGGAGGCTCCGG - Intergenic
934117403 2:88810611-88810633 GGTGCCCACCGGGTTGGGCCAGG - Intergenic
934556209 2:95288349-95288371 CCTGCTCTCCAGGGAGGGCCGGG + Intronic
936092882 2:109512274-109512296 GATGCAGGGCAGGGAGGGCCGGG - Intergenic
936152679 2:110030238-110030260 GGTCCCTGCCAGGGTGCGCCTGG - Intergenic
936154855 2:110040920-110040942 GGTGCCCACCACGCAGAGCCCGG + Intergenic
936189827 2:110330494-110330516 GGTGCCCACCACGCAGAGCCCGG - Intergenic
937047292 2:118858598-118858620 GTTCCCCGCCAGGGTGGGTCAGG + Intergenic
937984285 2:127631639-127631661 GGTGAGCTCCAGGGTGGGCCAGG - Exonic
938332323 2:130456518-130456540 TGTGCATGCCAGGGAAGGCCAGG - Intergenic
938949583 2:136244246-136244268 GGGGGCCCCCAGGGAGGGCCGGG + Intergenic
939168967 2:138671620-138671642 GGTGCATGCCACGGAGGGGCTGG - Exonic
942292517 2:174486815-174486837 CGTGCCCGCAAGGGAGAACCAGG + Intronic
942313986 2:174682232-174682254 GCGGGCCGCCCGGGAGGGCCGGG + Intronic
945673835 2:212832529-212832551 GGACCTCGCCAGGGATGGCCGGG + Intergenic
946396999 2:219448240-219448262 GGTGCCCGCCAGGGAGGGCCCGG - Exonic
947171957 2:227320930-227320952 GGTGCCCATCAGGGAGGCTCAGG - Intergenic
947745769 2:232506590-232506612 CTAGCCCTCCAGGGAGGGCCAGG + Intergenic
947919156 2:233854467-233854489 GCTGCGCGCCATGGAGGGCGAGG - Exonic
948824626 2:240568356-240568378 GGCGCCGGGCGGGGAGGGCCAGG - Intronic
948830517 2:240596356-240596378 GGTGCCAGCCACGGGGGGCATGG - Exonic
949004575 2:241637827-241637849 GGTGCGGGCCAGGCTGGGCCGGG + Intronic
1170926850 20:20732853-20732875 GGTTCCCCTCCGGGAGGGCCAGG + Intergenic
1171483061 20:25468430-25468452 GGTGCCCACCAGTGAGAGTCAGG - Intronic
1171483178 20:25468793-25468815 GGTGCCCACCAGTGAGAGTCAGG - Intronic
1172109823 20:32538320-32538342 GGTGCACACCAAGGAGGGGCAGG + Intronic
1172125937 20:32625360-32625382 TGAGCCAGCCAGGGAGGGCTGGG + Intergenic
1172167493 20:32907936-32907958 AGTGGCAGCAAGGGAGGGCCTGG + Intronic
1172421964 20:34825483-34825505 AAGGCCCGCCCGGGAGGGCCGGG - Intronic
1172613035 20:36265893-36265915 CGTGCTTGCCAGGGAGGGCCAGG + Intronic
1172689052 20:36778042-36778064 GGTGCCAGCCAGGGAGGGGGTGG - Exonic
1173778810 20:45736198-45736220 GGTGCCCATCAGGGAGGCTCCGG - Intergenic
1173844083 20:46177143-46177165 AGTGCCAGCCAGTGAGGGCGGGG + Intronic
1175234743 20:57502122-57502144 GTTCCCTGCCAGGCAGGGCCTGG + Intronic
1175771610 20:61627873-61627895 GGTGTCCCCCAGCGAGGCCCAGG + Intronic
1175926304 20:62473255-62473277 GGTGCCCGCCCCGGTGGGTCAGG - Intronic
1176023729 20:62975382-62975404 GGGGCCCGGCAGGGAGTGCTGGG + Intergenic
1176116500 20:63433948-63433970 GGGGCGCGCCCAGGAGGGCCGGG + Intronic
1176172158 20:63700944-63700966 GGTGTCCCCCAGGGAGGGGATGG - Intronic
1176179331 20:63742068-63742090 GGCGGCCCCCAGGGAGGGGCGGG + Intronic
1178707928 21:34889849-34889871 AGGGCCCGGCAGGGAGGGCGTGG - Intronic
1179304466 21:40141815-40141837 GGTGCCCACCAGGCTGGGCCGGG - Intronic
1179430444 21:41317323-41317345 CTTGCACGCCAGGGAGGGGCTGG + Intronic
1179842279 21:44084940-44084962 GGTGGCGCCCAGGGAGGGCGTGG - Intronic
1179896810 21:44367609-44367631 AGTCCCCTCCAGGGAGGCCCAGG - Intronic
1179932305 21:44578908-44578930 GGTGCCCCCAGAGGAGGGCCTGG + Intronic
1179975638 21:44864322-44864344 GGTGCCAGCCAGGCTGGCCCAGG + Intronic
1180105665 21:45616664-45616686 GGAGCCCGGCGGGGAGGGGCTGG - Intergenic
1180587668 22:16907227-16907249 GGTGACAGCCAGAGAGGACCTGG + Intergenic
1180951625 22:19723071-19723093 GGGGCCCTCCAGGTCGGGCCGGG - Exonic
1181085339 22:20437129-20437151 GGTGCTAGCCGGGGAGGTCCTGG - Intronic
1181514336 22:23402601-23402623 TGGGCCGGCCAGGGCGGGCCGGG + Intergenic
1181695928 22:24592813-24592835 GCTGGCGGCCAGGGAGGGTCTGG - Intronic
1181986060 22:26800560-26800582 GGGGCCAGCCAGGAATGGCCAGG + Intergenic
1182299347 22:29329165-29329187 GGAGGCTGCCAGGGAGTGCCCGG + Intronic
1183675543 22:39297119-39297141 GGAGCCCGCCAGGCAGGGCTGGG + Intergenic
1184111737 22:42399517-42399539 GGAGCCTGCCTGGGAGGGGCAGG + Intronic
1184176870 22:42793770-42793792 GCTGACCAGCAGGGAGGGCCAGG + Intergenic
1184644047 22:45886482-45886504 GGTTCTCGGGAGGGAGGGCCTGG + Intergenic
1184684112 22:46088277-46088299 GGTGCTGGCCAGGGCGGGCGGGG - Intronic
1184728952 22:46362809-46362831 GATGCCCGCCTGGGCGGGGCTGG + Exonic
1184804163 22:46781694-46781716 GGGGCAGGCCAGGGAGGGGCCGG - Intronic
1185106218 22:48871429-48871451 GGTGCTCAGAAGGGAGGGCCAGG + Intergenic
950230616 3:11272504-11272526 CGAGCTCGCCAGGGAGGGCGAGG + Intronic
950658377 3:14451488-14451510 GGTGAGGGCCAGGTAGGGCCAGG + Intronic
951597743 3:24336213-24336235 GGGGGCCCCAAGGGAGGGCCTGG + Intronic
954359528 3:50112797-50112819 GGTGCCCTCTAGGTAGGCCCAGG + Intronic
956124561 3:65999229-65999251 GGTGCCTGTCAGGGAGTGCGGGG - Intronic
959637284 3:108589540-108589562 GGTGACGGCCGGGGTGGGCCAGG + Intronic
961537187 3:127577289-127577311 GGGCCCCGAGAGGGAGGGCCAGG - Intronic
961700747 3:128742980-128743002 GGTGCCCGTCGGGGAGGCTCGGG + Intronic
962177196 3:133167450-133167472 GGTGCCCGTCAGGGAAGCTCGGG + Intronic
963139771 3:141937785-141937807 GGTGCCTGCCAGGGCAGGCAGGG - Intergenic
964138306 3:153369805-153369827 GGTGCCCGTCAGGGAGGCTTGGG + Intergenic
964138535 3:153371330-153371352 AGTGCCACCCAGGGAGGGCATGG + Intergenic
964139177 3:153378389-153378411 GGTGCTCGTCAGGGAGGCTCGGG + Intergenic
967594874 3:191317066-191317088 GGTGCCCGTCAGGGAGGCTCGGG + Intronic
968524236 4:1047879-1047901 GGTGGCTGCCAAGGAAGGCCAGG + Intergenic
968748541 4:2373889-2373911 GGGGCATGACAGGGAGGGCCTGG - Intronic
968809320 4:2792966-2792988 GGGACCCGCCGGGGAGGGGCGGG + Intergenic
968961871 4:3749667-3749689 GGTGGGTGCCAGGGAGGCCCGGG - Intergenic
969054244 4:4391657-4391679 GATGCCCTGCAGGGAGGGCCAGG + Intronic
969060820 4:4432889-4432911 GGGGACCTCCAGGGATGGCCAGG - Intronic
969346925 4:6575687-6575709 GGTGCCCGCTGGGAAGGGGCCGG + Intronic
969426755 4:7128819-7128841 GCTGCCCGCCAGGGAGAGCATGG - Intergenic
969630518 4:8333175-8333197 GCTGCCCAACAGGGAGGGCAGGG + Intergenic
969631825 4:8343409-8343431 AATTCCAGCCAGGGAGGGCCGGG + Intergenic
970691945 4:18630624-18630646 GGTGCCCGCTGGGGAGGCTCTGG + Intergenic
973045431 4:45530760-45530782 GGTGCCCATCAGGGAGGCTCAGG - Intergenic
974020092 4:56685453-56685475 CGTGCCAGCCAGGTTGGGCCAGG - Intergenic
975112383 4:70642315-70642337 GCTTCAGGCCAGGGAGGGCCAGG + Exonic
975219732 4:71800233-71800255 GGGGCCTGCCAGGGAGGGTGAGG - Intronic
975491082 4:74989501-74989523 GGTGGCTGCCAGAGAGGGCATGG - Intronic
975754897 4:77562249-77562271 GTTGCCCGTCAGGGAGGCTCAGG - Intronic
977641218 4:99359986-99360008 GGTGCCCGTCAGGGAGGCTCGGG - Intergenic
977750921 4:100608818-100608840 GGTGCTCGTCGGGGAGGCCCCGG + Intronic
979290773 4:118977103-118977125 GGTGCTCGTCAGGGAGGCTCGGG + Intronic
980563057 4:134502103-134502125 GGTGCCCGTCAGGGAAGCTCGGG - Intergenic
982712326 4:158769369-158769391 GGTGCTCGCCGGGGAGGGGACGG + Intronic
982768979 4:159378399-159378421 GGTGCCTGTCAGGGAGGCTCGGG - Intergenic
983553012 4:169035888-169035910 GGTGCTCGTCAGGGAGGCTCGGG + Intergenic
983835351 4:172377590-172377612 GGTGCCCATCAGGGAGGCTCGGG + Intronic
984862524 4:184253248-184253270 GGTGCCGGTCAGGGAGGCTCGGG - Intergenic
985577182 5:678835-678857 GGTGCCACCCAGGCAGGGCTTGG + Intronic
985592099 5:770885-770907 GGTGCCACCCAGGCAGGGCTTGG + Intergenic
985650191 5:1104017-1104039 GGAGCCGCCCTGGGAGGGCCTGG - Intronic
985667248 5:1187538-1187560 GCTGCCCTTCAGTGAGGGCCCGG + Intergenic
985764420 5:1769265-1769287 GGTCGTCGCCAGGGAGCGCCAGG - Intergenic
987047184 5:14119097-14119119 GGCTCCCTCCAGAGAGGGCCTGG + Intergenic
987315338 5:16718259-16718281 GGTGCTCGTCAGGGAGGCTCCGG - Intronic
987876993 5:23691432-23691454 GGTGCTCGTCAGGGAGGCTCGGG - Intergenic
988484363 5:31656300-31656322 GCTGCCAGCCAGGGAAGGCGGGG - Intronic
991930421 5:71748550-71748572 GCTGCCTGCCAGAAAGGGCCGGG - Intergenic
992050402 5:72935545-72935567 GGTGCCCGTCGGGGAGGCTCTGG - Intergenic
992488144 5:77215638-77215660 GGTGACCACCAGGTATGGCCTGG + Intronic
998128471 5:139639323-139639345 GGTGTCCACGATGGAGGGCCTGG - Intergenic
998136843 5:139678503-139678525 GGTGCCCACTGGGGAGGGACAGG + Intronic
998849369 5:146338931-146338953 GCAGCCTGCCAGGAAGGGCCCGG - Intronic
999368789 5:151040230-151040252 GGTTCCCTCTAGGGAGGGCCTGG + Intronic
1000291415 5:159874819-159874841 GGGGCCCTCTAGGGAAGGCCTGG - Intergenic
1001384168 5:171324703-171324725 GGTCCCTCCCAGGGCGGGCCGGG - Intergenic
1001559497 5:172659924-172659946 GGTGGTGGCCAGGGAGGGCTGGG - Intronic
1001639751 5:173236075-173236097 GCTGCCAGGCAGGGAGGGCACGG - Intergenic
1002212428 5:177606909-177606931 TGGGGCCGTCAGGGAGGGCCAGG - Intronic
1002692342 5:181059194-181059216 AGTGCCCGCCCGGGACGGTCTGG - Intronic
1002911968 6:1497529-1497551 TGGGCCAGCCAGGCAGGGCCAGG + Intergenic
1003175445 6:3750422-3750444 AGGGGCCGCCTGGGAGGGCCGGG - Intronic
1006316763 6:33296099-33296121 GGGGATCGCCGGGGAGGGCCAGG + Exonic
1006396231 6:33789133-33789155 GGTGCGCGCCAGGGGCGGGCGGG - Exonic
1006535593 6:34696591-34696613 GGTCCCCGCCATGGAGGGCATGG - Exonic
1007707366 6:43799067-43799089 CGTGACAGCCAAGGAGGGCCAGG + Intergenic
1007738574 6:43997531-43997553 TGTGCCAGCCAGGTAGGGGCGGG + Intergenic
1007918694 6:45586552-45586574 GGGGGCCACCAGGGAGGGGCGGG + Intronic
1008572482 6:52829236-52829258 GGTGCCCATCAGGGAGGCTCCGG + Intergenic
1011493493 6:87916332-87916354 GGAGCAGGGCAGGGAGGGCCAGG - Intergenic
1012399600 6:98833152-98833174 CGTGACCGCCACGCAGGGCCGGG - Intergenic
1012862511 6:104576516-104576538 CGTGCCCTCCATGGATGGCCAGG + Intergenic
1012997961 6:105992564-105992586 AGTGAGCGCCAGGGAGGGGCGGG + Intergenic
1013376998 6:109527047-109527069 GGTGAAAGCAAGGGAGGGCCAGG - Intronic
1013459052 6:110358112-110358134 GGTGGCCGCCAGGCCGGGCCCGG + Exonic
1015366375 6:132401543-132401565 CGCGCCCGCCCGGGAGGGGCAGG + Exonic
1016440037 6:144073907-144073929 GTTGGCCTCCAGGGAGGGCATGG + Intergenic
1017764031 6:157592711-157592733 GGGGCTCCACAGGGAGGGCCTGG + Intronic
1017834971 6:158168538-158168560 CGGCCCCGCCAGGAAGGGCCCGG - Intronic
1018901452 6:168053841-168053863 GGTGCCCATCTGGGAGGCCCGGG - Intergenic
1019086273 6:169480348-169480370 GGTGCCCGTCAGGGAGGCTCGGG - Intronic
1019217934 6:170455496-170455518 GGTGCCGGCAAGAGCGGGCCTGG + Intergenic
1019358033 7:591166-591188 GGGGCCCCCGGGGGAGGGCCCGG + Intronic
1019360354 7:601631-601653 GGTGGGCGTCAGGGAGTGCCCGG - Intronic
1019547695 7:1586381-1586403 GGTGCCTGGCGGGGAGGGCGAGG - Intergenic
1019609330 7:1929060-1929082 GGTGCCCTCGAGGGGAGGCCTGG - Intronic
1019614588 7:1953389-1953411 GGCCCCCGCCAGGGAGGAGCAGG + Intronic
1019998529 7:4740996-4741018 GGTGCCCGTCGGGGAGGGGACGG - Exonic
1021168303 7:17367914-17367936 GGTGCCCTTCATGGAGGGGCAGG + Intergenic
1022643765 7:32212295-32212317 GGTGGTGGGCAGGGAGGGCCCGG - Intronic
1023370528 7:39508373-39508395 GGAGCCCGCAAAGGAGGGGCTGG + Intergenic
1026736860 7:72954518-72954540 GGGGCCCGGCGAGGAGGGCCGGG - Intergenic
1026787079 7:73308591-73308613 GGGGCCCGGCGAGGAGGGCCGGG - Intronic
1027106874 7:75410545-75410567 GGGGCCCGGCGAGGAGGGCCGGG + Intronic
1029193939 7:98791278-98791300 GGTGCCAGCCCAGGAGTGCCTGG + Intergenic
1029737700 7:102473767-102473789 GCTGCCCTCCAGGAAGGGCCTGG - Intronic
1032088057 7:128893944-128893966 GCTGCCTGGCAGGGAGGGCCTGG - Intronic
1034128829 7:148698295-148698317 GGTGCGCACAAGGGAGGGGCAGG + Intronic
1035461380 7:159041225-159041247 GCTGCCCCACCGGGAGGGCCTGG - Intronic
1036427034 8:8654414-8654436 GGTGGCACCCAGGGAGGGCATGG - Intergenic
1037825194 8:22156512-22156534 GCTGCGGGCCAGGGGGGGCCCGG - Exonic
1038326623 8:26577299-26577321 GGAACCCGGCGGGGAGGGCCCGG - Intronic
1039434986 8:37553797-37553819 GGTGACAGCCTGGGAGGCCCAGG + Intergenic
1039471827 8:37818220-37818242 GGTGCCAGCCTGAGAGGGGCAGG - Intronic
1039573314 8:38603911-38603933 GGCTCCCTCCAGGGAGGGCTGGG + Intergenic
1039608420 8:38901172-38901194 GGAGCCCGCCGGGGAGGGAGAGG - Intergenic
1039743646 8:40404562-40404584 GGTGCCAGGCAAGGAGGACCAGG + Intergenic
1043670679 8:82880994-82881016 GGTGCTCGTCAGGGAGGCTCAGG - Intergenic
1047356251 8:124124963-124124985 GGTGCCTGCCAGAGAGGACAAGG + Intergenic
1048605220 8:135961343-135961365 GTTGCCCACAAGGGTGGGCCTGG + Intergenic
1048692461 8:136983030-136983052 TGTGCCTGCCAGGGAGTCCCTGG + Intergenic
1049180850 8:141221426-141221448 GGTCACCGCCAGGGTGGCCCCGG + Intronic
1049246425 8:141565226-141565248 GCTGCCTGCCAGGCAAGGCCTGG - Intergenic
1049394863 8:142395303-142395325 GGTGCCTCCCGGGGAGGGCAAGG - Intronic
1049518632 8:143076464-143076486 GGAGCCCCCAAGGCAGGGCCAGG + Intergenic
1049529769 8:143148382-143148404 GGTGCCCATCTGGGAGGTCCTGG - Intergenic
1049592910 8:143470651-143470673 CGTGCCCGCCTGGCAGGACCGGG + Intronic
1049593267 8:143472120-143472142 GGTGCCAGCCAGGGCAGGCAGGG - Intronic
1049719468 8:144108952-144108974 GGATCCCCCTAGGGAGGGCCAGG + Intronic
1049742427 8:144247514-144247536 TGGGATCGCCAGGGAGGGCCTGG + Intronic
1049767263 8:144360670-144360692 GGTGCCCACCAGGGGCGGGCAGG - Exonic
1051399494 9:16664266-16664288 GATGCCAGCCAGGGAAGGACTGG - Intronic
1051419680 9:16877142-16877164 GGTGCTCGTCAGGGAGGCTCCGG + Intergenic
1051549726 9:18315389-18315411 GGCGCCCGTCAGGGAGGCTCGGG + Intergenic
1052014884 9:23452304-23452326 GGAGCCCACCAGGGAGGCTCAGG - Intergenic
1053009234 9:34623958-34623980 GGTGACCGCCAAGGGCGGCCTGG - Exonic
1053283089 9:36834209-36834231 GGTGGCGGGCAGTGAGGGCCTGG - Exonic
1053413477 9:37930553-37930575 GGCCCCCACCAGGGTGGGCCAGG - Intronic
1053811996 9:41862451-41862473 GGTGCTCGTCAGGGAGGCTCGGG + Intergenic
1054618599 9:67324988-67325010 GGTGCTCGTCAGGGAGGCTCGGG - Intergenic
1056675480 9:88673406-88673428 GGTGTTTGCCAGGGAGAGCCTGG - Intergenic
1058719652 9:107752091-107752113 TGTGCCCTGCAGGGAGGGCCTGG - Intergenic
1060479725 9:124011216-124011238 GGCACCCGCCTGGGAGGCCCGGG - Intronic
1060596817 9:124853498-124853520 GGAGCCCGCCGGGGCGGGGCGGG + Exonic
1061504197 9:131021912-131021934 GGTGGCACCCAGGGAGGGCATGG - Intronic
1061749689 9:132769220-132769242 GATGCCCGCCAGGCAGTGGCAGG - Intronic
1062030388 9:134359555-134359577 GGTGCCCGCCTGGGGAGGGCTGG + Intronic
1062344903 9:136110086-136110108 GGAGGCCTGCAGGGAGGGCCTGG + Intergenic
1062381798 9:136290380-136290402 GGTGTCCTCCAGGGAGTGGCCGG - Intronic
1062452805 9:136622613-136622635 GCGGCCCACCAGGGAGGGCACGG + Intergenic
1062529621 9:136994183-136994205 GGGCCCAGCCAGGCAGGGCCAGG + Intergenic
1062569995 9:137180602-137180624 GGTGCCCCCCAGGCAGAGCAGGG + Intronic
1062716718 9:138014301-138014323 GGTGCCCTCCAGGCAGGATCAGG - Intronic
1187304649 X:18084110-18084132 GGTGCTCGTCAGGGAGGCTCGGG - Intergenic
1189009907 X:37036641-37036663 GGGGCAAGCCAGGAAGGGCCAGG - Intergenic
1189512441 X:41676544-41676566 GGCGCCCGCCAGGTAGACCCAGG - Intronic
1190136883 X:47806148-47806170 GGTACCTGCCTGGGGGGGCCTGG + Intergenic
1190225148 X:48539628-48539650 GGCGACCTCCAGGCAGGGCCAGG + Exonic
1190322524 X:49187218-49187240 GGGGCCCGCGATGAAGGGCCTGG - Intergenic
1191141630 X:57121232-57121254 GGTGGACGCCAGGCAGGGCAAGG - Exonic
1191143271 X:57137199-57137221 GGTGGACGCCAGGCAGGGCAAGG - Intronic
1192022509 X:67408964-67408986 GGTGCCTGTCAGGGAGGCTCGGG - Intergenic
1192081669 X:68053714-68053736 GCTGCCCGGCAGGGAGGATCTGG + Exonic
1192324248 X:70118837-70118859 GGTCCCTGCCAGTGAGGCCCTGG + Intergenic
1194340407 X:92699540-92699562 GGTGCCCATCAGGGAGGCTCGGG + Intergenic
1197774555 X:130110781-130110803 GGCGGACGCCGGGGAGGGCCGGG + Intergenic
1200001936 X:153066608-153066630 TGTGTCCTCCAGGGAGAGCCTGG - Intergenic
1200005796 X:153083417-153083439 TGTGTCCTCCAGGGAGAGCCTGG + Intergenic
1200047103 X:153408982-153409004 GGGGCCCAGCAGGGAGGTCCAGG - Intergenic
1200142828 X:153910307-153910329 GGTGCCCGCTGGGCAGGACCCGG - Exonic
1200249830 X:154547004-154547026 GGTGCCCGAGAGGCAGGGGCTGG - Exonic
1200648775 Y:5816292-5816314 GGTGCCCATCAGGGAGGCTCGGG + Intergenic
1201424288 Y:13831650-13831672 GGTGCCCGTCAGGGAGGCTGGGG - Intergenic
1201728982 Y:17185660-17185682 GGTGCCCAGCAGGGAAGCCCAGG + Intergenic