ID: 946398557

View in Genome Browser
Species Human (GRCh38)
Location 2:219456095-219456117
Sequence GGTCTGTGAGGAGGGCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 299}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946398550_946398557 -1 Left 946398550 2:219456073-219456095 CCTACTTGGTGAGATTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 184
Right 946398557 2:219456095-219456117 GGTCTGTGAGGAGGGCAAGTTGG 0: 1
1: 0
2: 2
3: 18
4: 299
946398549_946398557 2 Left 946398549 2:219456070-219456092 CCACCTACTTGGTGAGATTCCTG 0: 1
1: 0
2: 1
3: 10
4: 124
Right 946398557 2:219456095-219456117 GGTCTGTGAGGAGGGCAAGTTGG 0: 1
1: 0
2: 2
3: 18
4: 299
946398547_946398557 11 Left 946398547 2:219456061-219456083 CCAGCCAGGCCACCTACTTGGTG 0: 1
1: 0
2: 1
3: 19
4: 210
Right 946398557 2:219456095-219456117 GGTCTGTGAGGAGGGCAAGTTGG 0: 1
1: 0
2: 2
3: 18
4: 299
946398548_946398557 7 Left 946398548 2:219456065-219456087 CCAGGCCACCTACTTGGTGAGAT 0: 1
1: 0
2: 0
3: 5
4: 120
Right 946398557 2:219456095-219456117 GGTCTGTGAGGAGGGCAAGTTGG 0: 1
1: 0
2: 2
3: 18
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946398557 Original CRISPR GGTCTGTGAGGAGGGCAAGT TGG Intronic
900151563 1:1181207-1181229 GGTCTGTGAGATGGACAGGTGGG - Intronic
900366447 1:2313733-2313755 GGTCTTGGTGGAGGGCAAGCAGG + Intergenic
900608709 1:3535474-3535496 GGTCTGTGTGGAGGACCAGAGGG - Intronic
900833866 1:4985113-4985135 GGTCCGTGGTGGGGGCAAGTGGG - Intergenic
900953615 1:5873579-5873601 GGGCTGTGAGGACTGCAGGTGGG - Intronic
903171476 1:21557189-21557211 GGAGTGTGGGGAAGGCAAGTGGG - Intronic
903459371 1:23509827-23509849 TGTCTGTGAGGAGGTAGAGTCGG + Exonic
904402685 1:30267139-30267161 GGGCTGTGGGGAGGGGAGGTAGG + Intergenic
904588234 1:31592103-31592125 AAATTGTGAGGAGGGCAAGTGGG + Intergenic
904696219 1:32333017-32333039 GGTCAAGGAGGAGGTCAAGTTGG + Exonic
905035909 1:34918312-34918334 GGTCTATGGGGATGGCAAGCAGG + Intronic
906212936 1:44022234-44022256 GGACTGGGAGGAGGGCAGGCAGG - Intronic
906804827 1:48770625-48770647 GATATGTCAGGAGAGCAAGTAGG - Intronic
906929267 1:50152979-50153001 AGTCTGTGAGGAGGTCAAAATGG + Intronic
907096036 1:51781894-51781916 GGTCTGTGAAGCTGTCAAGTAGG + Intronic
907254749 1:53170439-53170461 GGGCTGGGAGGAGGGAAAATGGG - Intergenic
907336120 1:53700775-53700797 GGGCTGGGAGGAGGGGAAATAGG - Intronic
907383813 1:54112602-54112624 GGTCTGTGGGAAGGGGAAGAGGG - Intergenic
908120683 1:60983477-60983499 GGTCTGTGAGGAGAGGCAGAGGG - Intronic
911653103 1:100411837-100411859 GGTCAGTGATAATGGCAAGTTGG + Intronic
912799249 1:112711007-112711029 GGTCTGTGGGGAGGGCAAAAAGG - Exonic
915229595 1:154435684-154435706 TGTCTGTGAGGAGAGCAATGTGG + Intronic
915610411 1:156987545-156987567 TGTCTCTGAGGAGGGAAACTGGG + Intronic
917431046 1:174969433-174969455 GGGCGGTGATGAGGGCAAATCGG - Intronic
917496695 1:175546857-175546879 GGTCATGGAGGTGGGCAAGTGGG + Intronic
918449736 1:184646956-184646978 GGACTGGGAGGAAGGCAAGTGGG - Intergenic
919215496 1:194548059-194548081 GGGCTCTGAGGAGGGCAGGCTGG + Intergenic
920035359 1:203061651-203061673 GGACAGTGAGGAGGGCAGCTGGG + Exonic
920719357 1:208372448-208372470 GGCCCATGATGAGGGCAAGTAGG - Intergenic
921469417 1:215530774-215530796 GGGCTGAGAGGAGGGGAAATGGG + Intergenic
923400540 1:233612115-233612137 GGTCTCTGAACAGGGCAAATAGG + Intergenic
924563735 1:245178825-245178847 TGTCTGAGTGGAGGGCAAGTGGG + Intronic
1062857586 10:786995-787017 GGTCTGAGAGGAGGGCGGGGTGG - Intergenic
1063505923 10:6599720-6599742 GGAGAGTGAGGAGGGAAAGTGGG + Intergenic
1063654092 10:7969866-7969888 GGTCTGCGAGGATGGGAGGTTGG - Intronic
1070518605 10:77231242-77231264 GATCAGTGAGTAGAGCAAGTAGG - Intronic
1070599659 10:77856848-77856870 GGTCAGTGAGGAGGGGTGGTGGG + Exonic
1070823764 10:79379308-79379330 GGTCTCTGAGGAGGGCAGGTGGG + Intergenic
1074145074 10:110710492-110710514 GCTCTCTGAGGAGGCCCAGTGGG - Intronic
1076454916 10:130584613-130584635 GGTCTGGGAGGAAAGGAAGTGGG - Intergenic
1076479968 10:130778449-130778471 GGACTGTGGGGAGGCCAGGTGGG + Intergenic
1077108721 11:852925-852947 GGCCTGTGGGGAGGGCATGGGGG + Intronic
1077142635 11:1031160-1031182 TGTCAGTGAGGAGGGTAGGTGGG - Exonic
1078639219 11:13079659-13079681 GAGCTTTGAGGAGGGAAAGTAGG + Intergenic
1080457640 11:32430711-32430733 GGTCTGGGAGGAGGCCTAGGAGG - Intronic
1081679789 11:44994234-44994256 GGCCTGTGAGGATGGCCAGGAGG - Intergenic
1083027166 11:59560553-59560575 GGGCTGGGAGGAGGCTAAGTCGG + Intergenic
1083678497 11:64340788-64340810 GATCTGAGAGGAGGGGAAGCGGG + Intronic
1083680628 11:64350126-64350148 GGGCTGTGAGGAGGCCATGCAGG + Intronic
1083734410 11:64671318-64671340 GGTCTCTGGGGAAGGCAAGGAGG + Intronic
1083742105 11:64716536-64716558 GGTCCGTGTGGAGGGAGAGTGGG + Intronic
1084012590 11:66360844-66360866 GGCCTGGGAGGTGGGCAGGTGGG + Intronic
1084740916 11:71139022-71139044 GGTCTTTGAGGGGGTCAGGTTGG + Intronic
1084942249 11:72618990-72619012 GGGATGTGAGGAAGGAAAGTAGG - Intronic
1087118708 11:94550373-94550395 GGTGTTGGAGGAGGGCAGGTAGG - Intronic
1087140722 11:94763183-94763205 GGACAATGTGGAGGGCAAGTGGG - Intronic
1087658467 11:100956018-100956040 GGTCTGAGAAGAGGACAAGATGG - Intronic
1087726092 11:101719025-101719047 GGCCTGTCAGAAGCGCAAGTAGG - Intronic
1089437420 11:118482092-118482114 GGTGAGTGAGGAGGGCAAGAAGG + Exonic
1089842488 11:121430536-121430558 GGGAGGTAAGGAGGGCAAGTTGG + Intergenic
1091526274 12:1304422-1304444 AGTCATTGAGGAGGGAAAGTGGG + Intronic
1091583419 12:1802271-1802293 GGTCAGTTAGGAGGGCAGGTGGG - Intronic
1091675602 12:2486810-2486832 GGTGGGGGAGGAGGGCAGGTGGG + Intronic
1091797193 12:3304169-3304191 GGTCTGTGAGGTGGGCAAGATGG + Intergenic
1092230307 12:6772459-6772481 GGGCCGGGAGGAGGGGAAGTGGG + Intergenic
1092973480 12:13721375-13721397 GTTGTGTGGGGAGGGCAACTGGG + Intronic
1093894383 12:24561119-24561141 GGTATGTGAGGATCTCAAGTGGG + Intergenic
1095147841 12:38751778-38751800 GCTCTGGAATGAGGGCAAGTGGG - Intronic
1095448991 12:42309660-42309682 GGGCTGTGGGGAGGGCTTGTTGG + Intronic
1095567250 12:43639666-43639688 GGTCTCTGGGGAGGTGAAGTGGG - Intergenic
1096518749 12:52172445-52172467 GGCCTGTGAGCAGGGGAAGGAGG + Intronic
1096670455 12:53195525-53195547 GGTCTGGAAGGAGGGCATATGGG + Intronic
1097144270 12:56929344-56929366 GGTCTCTGAGGGGGGCGAGTGGG - Intronic
1097960456 12:65527364-65527386 TGTCTGTGGGGAGGACTAGTGGG + Intergenic
1100440739 12:94615000-94615022 GGTGGGAGAGGAGGGAAAGTTGG - Intronic
1101047966 12:100830325-100830347 GGTCTGTGAGATGGGAAAATAGG + Intronic
1101574418 12:105984156-105984178 CGTCTGAGAGGAGGATAAGTGGG - Intergenic
1101748158 12:107559790-107559812 AGTCTGTGAGGAGAGCAAAATGG - Intronic
1104794741 12:131509583-131509605 GGCCTGTGAAAAGGGCAGGTGGG - Intergenic
1104969964 12:132526797-132526819 GGTCACTGAGCTGGGCAAGTGGG - Intronic
1108002308 13:45915427-45915449 GCTCTGTGAGGGGGTCAAGGCGG - Intergenic
1112509043 13:99991989-99992011 GGCCTGGGAGGAGCCCAAGTTGG - Intergenic
1113872030 13:113565416-113565438 GGTCTGTGAGGAGGGTCTGAGGG - Intergenic
1113914748 13:113863655-113863677 GGTCTTCGAGGAGGCCAAGCAGG - Exonic
1115754168 14:36517210-36517232 GGTCTGTGTGGCGGGCAGGAGGG + Exonic
1117163618 14:53012938-53012960 GGAATGTGAGGAGAGGAAGTAGG - Intergenic
1117585221 14:57194922-57194944 GGTGTCTGAGGATGGCAAGATGG - Intergenic
1118633512 14:67726961-67726983 GGCCTGTGAGGAGAGCCAGCAGG - Exonic
1118733629 14:68686761-68686783 GGGCTGTGAGGAGGGGAAAGAGG - Intronic
1119421716 14:74511266-74511288 GGCCTGTGAGGAGGGCTACCGGG - Exonic
1119457002 14:74764157-74764179 TGCCTGAGAAGAGGGCAAGTAGG - Exonic
1122125091 14:99574569-99574591 GGCCTGTGAGGAGGGGAGGCAGG + Intronic
1122862092 14:104587318-104587340 GGGCCGTGAGGAGGGCTGGTTGG - Intronic
1124798560 15:32806867-32806889 GGTGTGTGTGGAGGGGTAGTAGG - Intronic
1127210439 15:56769103-56769125 TGCCTGTGAGGAGGGAAAGTAGG + Intronic
1127405905 15:58645760-58645782 GGTCTTAAAGGAGGGAAAGTTGG - Intronic
1127840481 15:62827255-62827277 GGACAGTGAGCAGGGGAAGTGGG + Intronic
1128499702 15:68219353-68219375 GCACTGTGAGGAGGTCAGGTTGG + Intronic
1133275251 16:4634377-4634399 GGTCTGGGAGGTGGGCAGGCAGG - Intronic
1133386649 16:5375485-5375507 GTTCTGTGGGGAGGGCCAGGGGG + Intergenic
1135070651 16:19348834-19348856 GGACTCTGAGGAGGGGCAGTGGG - Intergenic
1135591193 16:23706211-23706233 GGTCCCTGGGGAGGTCAAGTGGG + Intronic
1136923036 16:34346895-34346917 GGGCTGTGAGGATGGGAAGGTGG - Intergenic
1136981537 16:35064911-35064933 GGGCTGTGAGGATGGGAAGGTGG + Intergenic
1139578556 16:67857869-67857891 GGTGTGGGTGGAGGGGAAGTGGG + Intronic
1141173337 16:81704456-81704478 GGGCAGGGAGGAGGGTAAGTGGG - Intronic
1142360275 16:89622882-89622904 TGTCTGTGAGGAGGACTAGGGGG + Intronic
1143625826 17:8109718-8109740 GGTCTGTGAAGGGGGCCGGTAGG + Intronic
1144508594 17:15855944-15855966 AGGTTGTGGGGAGGGCAAGTGGG - Intergenic
1144610978 17:16715062-16715084 GGTTTGAGAGGAGGGATAGTGGG - Intronic
1144901761 17:18600303-18600325 GGTTTGAGAGGAGGGATAGTGGG + Intergenic
1144929312 17:18845757-18845779 GGTTTGAGAGGAGGGATAGTGGG - Intronic
1145130743 17:20345769-20345791 GGTTTGAGAGGAGGGATAGTGGG - Intergenic
1145172716 17:20673584-20673606 AGGTTGTGGGGAGGGCAAGTGGG - Intergenic
1145827624 17:27889067-27889089 GTGTTGAGAGGAGGGCAAGTGGG - Intronic
1146662421 17:34673672-34673694 GGGCTGTGAGCAGGGAAAGCCGG - Intergenic
1147038542 17:37699697-37699719 GCTCTGGGAGGAAGGGAAGTGGG + Intronic
1147991074 17:44333844-44333866 TGACTGTGTGGAGGGCAAGCGGG + Intergenic
1148478715 17:47946122-47946144 GGACAGTGAGAAGGGAAAGTGGG + Intronic
1149106681 17:52975674-52975696 TCTCTGGGAGGAGGTCAAGTGGG + Intergenic
1149428778 17:56580007-56580029 GGGCTGGGAGGAGGGGAAATGGG - Intergenic
1150732063 17:67704325-67704347 GGGCTGGGAGGAGGGCAGGATGG - Intergenic
1151551878 17:74826948-74826970 GGATGGGGAGGAGGGCAAGTAGG - Intronic
1151654098 17:75487626-75487648 GGCCTGTGAGGGGTGCAAGGTGG - Intronic
1151714175 17:75823127-75823149 TCTCTGGGAGGAGGGCAAGGAGG - Intronic
1152457257 17:80423536-80423558 GGTCTGTAAGGACGCCAAGGTGG - Exonic
1154192368 18:12241413-12241435 GGTCTGGGAGGAGGGGGAGATGG - Intergenic
1155085485 18:22453937-22453959 GGTGGGAGGGGAGGGCAAGTGGG + Intergenic
1155854149 18:30811140-30811162 GGTCAGTGAGGATGGAAAGGAGG + Intergenic
1155856054 18:30836300-30836322 GGACTGTGAGGAGGGGAAATGGG - Intergenic
1156449670 18:37259714-37259736 GGCCTGCGAGAAGGGAAAGTGGG - Intronic
1157204606 18:45687691-45687713 GGGCGGGGAGGTGGGCAAGTCGG + Intergenic
1157591729 18:48840263-48840285 GGTCTGTGAAGGGGGCAAGGTGG + Intronic
1158278100 18:55790701-55790723 GGTCAGTGAGAAGGGCAGCTGGG - Intergenic
1159212714 18:65347786-65347808 GGACTGTGAGGAGGGAGAGCTGG - Intergenic
1159931354 18:74315813-74315835 GGGCTGTGAGGAGGGCACGAGGG + Exonic
1160924898 19:1539292-1539314 GGGCTGTGAGGAGGGCCCCTGGG - Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161653526 19:5499149-5499171 GGTCTCTGAGGGGAGCAAGGGGG - Intergenic
1161937538 19:7381303-7381325 GGGCTGGGAGGAGGGAAGGTGGG + Intronic
1162386190 19:10361865-10361887 GGACCCTGAGGAGGGCAAGATGG - Exonic
1162725812 19:12689269-12689291 GGTCTGTGCTGAGGGCAACCTGG - Exonic
1163270846 19:16252557-16252579 GGGCTGTGAGGAGGGCACGGGGG + Intergenic
1163687272 19:18719006-18719028 GGCCTGGGAGGAGGTCACGTGGG + Intronic
1164752716 19:30668596-30668618 GATCTGTGGTGAGGGGAAGTCGG + Intronic
1165113344 19:33514534-33514556 GGTGTATCTGGAGGGCAAGTGGG - Intronic
1165278690 19:34777812-34777834 GGTCTGGGAGGAGGATAAGTGGG + Intergenic
1166032120 19:40139700-40139722 GGACTGTGGGGAGGGCCAGATGG - Intergenic
1167147965 19:47694197-47694219 GGGGTGTGGGGAGGGCAGGTGGG - Exonic
1167392302 19:49203616-49203638 GACCTGTGGGGAGGGGAAGTGGG - Intronic
925429800 2:3781365-3781387 GGTCTTTGAGGAGGTCAAGCCGG - Intronic
925498299 2:4477203-4477225 GGTCTGTGAGGAGTGGGAGCAGG + Intergenic
926704811 2:15829452-15829474 GGTCTGAGAGCAGGACAAGATGG + Intergenic
927326293 2:21809626-21809648 GGTCTGAGAGGAAGGCAGTTTGG - Intergenic
927509655 2:23636508-23636530 GGGCTGTGAGCAGGCGAAGTGGG - Intronic
929950917 2:46408962-46408984 GCTCTGTGGGCAGGGCAGGTAGG - Intergenic
930285420 2:49422162-49422184 GCTATGTAAGGAGGGCAAGGTGG + Intergenic
931198345 2:60074021-60074043 GCACTCTGAGGACGGCAAGTTGG + Intergenic
932000023 2:67876699-67876721 GGTCAGGAAGGAGGGGAAGTAGG - Intergenic
932148454 2:69345652-69345674 GGGCTGTGGGGAGGGGAAATGGG - Intronic
932344227 2:70985269-70985291 GGTTTGTGGGGAGGGCAGGGTGG - Exonic
933992511 2:87643737-87643759 TGTGTATGAGGGGGGCAAGTGGG + Intergenic
934341356 2:92271227-92271249 GGGCTGGGAGGAGGGAAAATGGG + Intergenic
934768710 2:96894738-96894760 GGTCTGTGGGGGGGGTGAGTGGG - Intronic
935625677 2:105170617-105170639 GGTCTGTGAGGTGGGGCAGGTGG - Intergenic
936029764 2:109061992-109062014 GGTCTGTGAGGATGACAGGAGGG - Intergenic
936301340 2:111307104-111307126 TGTGTATGAGGGGGGCAAGTGGG - Intergenic
936402747 2:112177693-112177715 GGGCTGTGGGGAGGGCAATGGGG - Intronic
936480334 2:112879725-112879747 GCTCTGTGAGGTGGGAAAATGGG + Intergenic
937032647 2:118753279-118753301 GGTCTGTGAGGAGGCAGAGCAGG - Intergenic
937861509 2:126714972-126714994 GGCCAGTGTGGATGGCAAGTGGG - Intergenic
940987683 2:160064522-160064544 GGTCTGTGAGTAGGATAAGAAGG + Intergenic
941309702 2:163913443-163913465 GGTCTGTGAGGACTGCCAGCAGG - Intergenic
943298201 2:186164345-186164367 GGTGTCCGAGAAGGGCAAGTAGG + Intergenic
944777488 2:202981630-202981652 GGAGAGTGAGGAGAGCAAGTGGG - Exonic
946378576 2:219329250-219329272 GCTCTGTGAGGAGGGAAACCAGG + Exonic
946390694 2:219415078-219415100 GGGCTGGGAGGAGGGGAAGGTGG + Intergenic
946398557 2:219456095-219456117 GGTCTGTGAGGAGGGCAAGTTGG + Intronic
946784630 2:223229763-223229785 GGTCTGTGTGGAGTGCATGATGG + Intergenic
947401631 2:229736469-229736491 GGTATGTGAGTAGGCCACGTGGG + Intergenic
948725272 2:239930388-239930410 GGTCTCTGAGGAGGGCATCCTGG - Intronic
1168805873 20:672018-672040 GGTCTGTGGGGAGGGCCTGGTGG + Intronic
1170781270 20:19427672-19427694 GGCCTGGGAGGAGGACAAGTCGG - Intronic
1172214285 20:33224052-33224074 GGCCTGTGAAGAGGGAAGGTAGG + Intronic
1173162685 20:40664226-40664248 AGGGTGTGAGGAGGGCAAGGGGG - Intergenic
1175307532 20:57987232-57987254 GTTCTGTGAGGTGGACAAGGTGG + Intergenic
1175772881 20:61634808-61634830 GGCCTGGCAGGAGGGGAAGTGGG - Intronic
1176092226 20:63323558-63323580 GGTCTGTGAAGAGGTGAAGCTGG - Intronic
1176380093 21:6108031-6108053 GGCCTGGGAAGAGGGCAGGTAGG - Intergenic
1179743381 21:43430207-43430229 GGCCTGGGAAGAGGGCAGGTAGG + Intergenic
1180164071 21:46011387-46011409 GGTCTGTGTGTGGGGCCAGTCGG - Intergenic
1182269520 22:29144792-29144814 GAGATGTGAGGAGGGCAAGGTGG - Intronic
1183448546 22:37876919-37876941 GTTCTGGCTGGAGGGCAAGTAGG + Intronic
1185204265 22:49528757-49528779 AGTCTGTGCGGGGGGCATGTAGG + Intronic
951401351 3:22235796-22235818 AGTCTGGGAGGAGTGCAAATTGG + Intronic
952858850 3:37795547-37795569 GGCCTTTGAGGAGGGCAAACAGG - Intronic
952991870 3:38837343-38837365 GGACTGTGAGGAAGGCAGGGAGG + Intergenic
954462144 3:50633443-50633465 GGGGTATGAGGAGGGCATGTGGG - Intronic
955509392 3:59664331-59664353 GGGCTTTGATGAGGACAAGTAGG + Intergenic
956782983 3:72619027-72619049 GGTTTCTGAGGAGGGCAGCTGGG + Intergenic
956924181 3:73964934-73964956 GGACTGGGAGGAGGGAAAATGGG + Intergenic
960568618 3:119162934-119162956 GGACTAAGAGGAGGGCAAATAGG + Intronic
961868137 3:129968941-129968963 GCTCAGTGAGGTGGGCAAGAAGG + Intergenic
964558090 3:157963139-157963161 GGCATGTGATGAGGGCCAGTGGG + Intergenic
965113201 3:164452822-164452844 ATTCTGGGAGGAGGGCAACTGGG + Intergenic
968706729 4:2081882-2081904 GGTCTATCATGGGGGCAAGTGGG + Intronic
969130202 4:4985400-4985422 GCTCTGGGAGGTGGGCTAGTTGG + Intergenic
969457923 4:7311093-7311115 TGTCTGGGAGGAGGCCAAGGAGG - Intronic
969831188 4:9798497-9798519 GGTGGGTGAGGCGGGGAAGTTGG - Intronic
972289522 4:37678506-37678528 GGGCTTTGAGGAGGGGATGTTGG - Intronic
975561874 4:75716137-75716159 GGGCAGTGGGAAGGGCAAGTTGG + Intronic
976620852 4:87126101-87126123 GGACTGTGAGGAGGGCCTGGAGG - Exonic
981016433 4:139978813-139978835 GTTCTGTGGGGAGGCCAGGTGGG - Intronic
982503996 4:156195294-156195316 GGTTTGTGAGGAGGACCAGAGGG + Intergenic
985776379 5:1846187-1846209 GGTCTGTGAGGATGGGACCTCGG + Intergenic
985899829 5:2779900-2779922 GGCCTGTGAGGAGGGAGAGAGGG - Intergenic
986164489 5:5261923-5261945 GGTCTTGGAGGAGGGGGAGTTGG - Intronic
986662149 5:10068937-10068959 GGGCTGGGAGGAGGGGAAATGGG - Intergenic
986741993 5:10712593-10712615 TGTCTGTGAGGAGGGCTGGATGG + Intronic
986983169 5:13472476-13472498 GGGCTGTGGGGAGGGGAAATGGG + Intergenic
989332720 5:40278620-40278642 AGTCAGTGAGGAGGGGAAATTGG + Intergenic
991582626 5:68172733-68172755 GGTCTGTGTGGAAGGCTGGTAGG - Intergenic
992243087 5:74790779-74790801 GGTCTGTGCTGCTGGCAAGTTGG - Intronic
992630526 5:78675830-78675852 GTTCTCTGAGGAGGGGATGTGGG + Intronic
993559920 5:89393597-89393619 GGTGTGTTAAGAAGGCAAGTAGG - Intergenic
994331487 5:98511752-98511774 GGTCTGAGAGCATGACAAGTGGG - Intergenic
994724316 5:103416428-103416450 GGTGTGTGTGGAGGGGGAGTTGG + Intergenic
999742720 5:154568824-154568846 GGGCTGTGTGGAGGGCACCTGGG - Intergenic
1000035378 5:157443661-157443683 GGTATGTGAGGAGGGGGAGGTGG - Intronic
1001003885 5:168032452-168032474 GGGCTGGGAGAAAGGCAAGTAGG + Intronic
1001593914 5:172885738-172885760 GGCCAGTGGGGAGGGCATGTGGG - Intronic
1003093669 6:3125440-3125462 GGCCTGTGGGGAGGGGAACTGGG - Intronic
1003159547 6:3623606-3623628 GGGCTGAGAGGAGGGGCAGTGGG - Intergenic
1005627450 6:27676735-27676757 TGTATTTGAGGAGGGCAAGGAGG + Intergenic
1006400294 6:33813637-33813659 GGTCTGTGAAGAGGGCACATCGG - Intergenic
1007714607 6:43848501-43848523 GGTCTCAGAGGAGGCCAAGCTGG - Intergenic
1011484852 6:87830542-87830564 AGGCTGTGAGGAAGGCATGTTGG - Intergenic
1012186438 6:96223031-96223053 GGGGTCTGGGGAGGGCAAGTGGG - Intergenic
1012220740 6:96646295-96646317 GATTTGGGAGAAGGGCAAGTGGG - Intergenic
1012493354 6:99807724-99807746 GATCTCTGAGGAGGGAAAGCTGG - Intergenic
1016134236 6:140519404-140519426 GGTCTGAGAAGAGGGGAAATGGG + Intergenic
1018048781 6:159989297-159989319 GGTTGGGGAGGAGGGCACGTGGG + Intronic
1019305942 7:335802-335824 AGCCTGTGTGGAGGGCAAGAGGG + Intergenic
1020649854 7:10861072-10861094 GGTCTGTGGGGAGGGAAATTAGG - Intergenic
1020749828 7:12126381-12126403 GCTCTGTGAGCAGGGCAGATGGG - Intergenic
1022506967 7:30913478-30913500 GGGCTGTGGGCAGGGCATGTGGG + Intronic
1022677235 7:32511543-32511565 GGTCTATGAGGAGGGCGAGGGGG + Intronic
1023684126 7:42717605-42717627 GCCCTGTTAGAAGGGCAAGTGGG - Intergenic
1023830933 7:44038755-44038777 GCTCTGAGAGGCCGGCAAGTGGG - Intergenic
1024508251 7:50181499-50181521 TGTCTGTGAGGATGGCCATTTGG + Intergenic
1026614198 7:71887159-71887181 GATCTGTGAGGTTGGCAAGACGG + Intronic
1026626436 7:71996621-71996643 AGTCTGTCAGGAGAGCAAGGGGG + Intronic
1028912720 7:96226176-96226198 GGGCTGTGAGGAGGGGGAATGGG - Intronic
1029741267 7:102493064-102493086 GCTCTGAGAGGCCGGCAAGTGGG - Intronic
1029759257 7:102592233-102592255 GCTCTGAGAGGCCGGCAAGTGGG - Intronic
1029776626 7:102688143-102688165 GCTCTGAGAGGCCGGCAAGTGGG - Intergenic
1031633031 7:124066914-124066936 CTTCTGTGTGGGGGGCAAGTGGG - Intergenic
1032405264 7:131651263-131651285 GGGCTGTGAGGAAGGGAAATGGG - Intergenic
1033496987 7:141909029-141909051 GGCCTGGGAGGAGGGCAACCTGG + Intronic
1034373936 7:150627144-150627166 GGGCTGGGAGGAGAGCAAGCAGG - Exonic
1037367122 8:18134999-18135021 GTTGTGGGAGGAGAGCAAGTGGG + Intergenic
1037509058 8:19563268-19563290 GGTCTGTCAGGAGGGTCAGGGGG + Intronic
1037627483 8:20620664-20620686 GGCCTCTTAGGAGGGCAAATAGG + Intergenic
1038451100 8:27639451-27639473 GGTCAGTGAAGAGGGCAGGAAGG + Intronic
1038701733 8:29855499-29855521 AGTCAGGGAGGAGGGCAAGGAGG - Intergenic
1040464572 8:47682367-47682389 GGCCTGAGAGGAGAGGAAGTGGG + Intronic
1040738496 8:50541406-50541428 GGTGAGGGAGGAGGGCAAGAGGG - Intronic
1041956540 8:63562374-63562396 GGTCTGTGGGGAGGGAGAATGGG + Intergenic
1042441009 8:68826601-68826623 GCTCGGTGAGGAAGGCATGTCGG - Intergenic
1042521104 8:69711493-69711515 GTTCGGTGGGGAGGGCAAGGGGG + Intronic
1042860387 8:73307336-73307358 GGTCTGCGTGGAGGGCAGGGAGG + Intronic
1043198871 8:77337728-77337750 GTTCTATTAGGAGGGCAATTTGG - Intergenic
1043425657 8:80146049-80146071 GGGCTGTAGGCAGGGCAAGTGGG - Intronic
1043449106 8:80349046-80349068 AGTATGTGAGGTGGGCAAGGAGG + Intergenic
1044992817 8:97811652-97811674 GGTATGTGAAGAGGGCAGGTAGG - Intronic
1047234551 8:123028441-123028463 AGGCTGGGAGGAGGGAAAGTGGG + Intronic
1048240815 8:132740150-132740172 GGTGTGTCAGGAATGCAAGTGGG - Intronic
1048991017 8:139760182-139760204 GCTCTGTGAGTAGGGGAAGGAGG + Intronic
1049468409 8:142764208-142764230 GTTCCGTGATAAGGGCAAGTGGG + Intergenic
1049631432 8:143660384-143660406 AGTCTGGGAGGAGGCCAAGGCGG - Intergenic
1050711957 9:8475256-8475278 GGTCTGCTAAGAGGGCAAGAAGG - Intronic
1051435925 9:17031776-17031798 GGGCTGGGAGGAGGGAGAGTGGG - Intergenic
1051580813 9:18671788-18671810 TGCCTGTGAGGAGGCCAAGGTGG + Intronic
1053754379 9:41289268-41289290 GGTCTGGAAGGAGGGGAAATTGG - Intergenic
1054259898 9:62853603-62853625 GGTCTGGAAGGAGGGGAAATTGG - Intergenic
1056182848 9:84102386-84102408 GGACAGTGAGGAGGGAAAGAAGG + Intergenic
1058724768 9:107791837-107791859 AGACTGTGTGGAGGGCAATTTGG - Intergenic
1059166112 9:112077996-112078018 GGTCTGTGGGGAGGGGGAGGGGG - Intronic
1059239188 9:112788555-112788577 GGTGTGTGAGGAGCCCAGGTAGG - Intronic
1059752923 9:117265531-117265553 GGTCAGTGTTGAGGGCATGTGGG + Intronic
1061216391 9:129224361-129224383 GCTCTGTGAGGAAGGCAGGGGGG + Intergenic
1061297564 9:129685182-129685204 GGCCAGGGAGCAGGGCAAGTTGG + Intronic
1061609800 9:131739207-131739229 GCTCTGCAAGGAGGGCAGGTGGG - Intronic
1061879499 9:133561690-133561712 GATCTGTGACGAAGGGAAGTAGG + Intronic
1062067300 9:134535635-134535657 GGTCTCTGGGGAGGGCAGATGGG + Intergenic
1062129659 9:134885620-134885642 AGTCTGTGAGGAGAACAGGTGGG + Intronic
1062221747 9:135419761-135419783 ATTCTGTGAGGAAGGCAGGTGGG + Intergenic
1062528895 9:136991222-136991244 GTGCTGTGGGGAGGGCCAGTGGG - Intergenic
1186009226 X:5110094-5110116 GGTCTGGGGAGAGGGCAAATGGG + Intergenic
1186655305 X:11605565-11605587 GCCATGTGAGGAAGGCAAGTAGG + Intronic
1188080310 X:25830738-25830760 TGTCTGTGAGAAGAGAAAGTGGG + Intergenic
1188512367 X:30950139-30950161 GGTCTAGGAAGAGGGCAAATGGG - Intronic
1189205087 X:39230932-39230954 AGCCTTGGAGGAGGGCAAGTAGG + Intergenic
1189682500 X:43531360-43531382 GGACTGAGAGCAGGACAAGTGGG - Intergenic
1190245371 X:48687270-48687292 GGGCTGTTAGGAGAGCAGGTGGG + Intronic
1191716655 X:64198354-64198376 GGTGGCTGAGGAGGGCAAATGGG - Intronic
1192239702 X:69319421-69319443 GGTCTGTGTGGAGGGAACGATGG - Intergenic
1194563240 X:95448489-95448511 GGTGTGTGAGGTGGGAAAGCGGG - Intergenic
1195273505 X:103255438-103255460 GGTCTTGGAGGAGGGGAGGTGGG - Intergenic
1197295043 X:124708370-124708392 GGTCTTTCTGGAGGGCAATTTGG + Intronic
1197984807 X:132256132-132256154 AGGCAGTGAGCAGGGCAAGTTGG - Intergenic
1198509957 X:137340587-137340609 TGTCTGTGAAGAGGGGAAGAGGG + Intergenic
1198510097 X:137341766-137341788 TGTCTGTGAAGAGGGGAAGAGGG - Intergenic
1198792999 X:140365747-140365769 GGTCTGTGAGGTGGGAAAAAGGG + Intergenic
1199282124 X:146014400-146014422 GGTTTGTCAGGAGGGTAAATGGG - Intergenic
1199565697 X:149213385-149213407 GCCCTGTGTGGAGGGCAAGCAGG - Intergenic
1199708772 X:150453114-150453136 GCAATGTGAGGAGGGCAACTTGG + Intronic
1199730742 X:150629801-150629823 TGTCTATGAGGAGGGCAATGAGG - Intronic
1199872543 X:151912525-151912547 GCTCTGTGAGGAGGCAAGGTGGG + Intronic
1201077967 Y:10200745-10200767 GGGCGGGGAGGATGGCAAGTAGG + Intergenic