ID: 946399097

View in Genome Browser
Species Human (GRCh38)
Location 2:219459507-219459529
Sequence CTCTCCAAGGGGCTTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946399091_946399097 16 Left 946399091 2:219459468-219459490 CCTTGTCTGGAAGAGGCCTGGGC 0: 1
1: 0
2: 1
3: 21
4: 246
Right 946399097 2:219459507-219459529 CTCTCCAAGGGGCTTGAGGATGG 0: 1
1: 0
2: 2
3: 22
4: 229
946399092_946399097 0 Left 946399092 2:219459484-219459506 CCTGGGCTGCTCTGACAGTCTGT 0: 1
1: 0
2: 1
3: 24
4: 229
Right 946399097 2:219459507-219459529 CTCTCCAAGGGGCTTGAGGATGG 0: 1
1: 0
2: 2
3: 22
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946399097 Original CRISPR CTCTCCAAGGGGCTTGAGGA TGG Intronic
901057287 1:6454498-6454520 CTCGCCAAAGGGCCCGAGGATGG - Intronic
902117528 1:14133681-14133703 TTCTCCAAGGGGTTTGTTGATGG + Intergenic
902477071 1:16693972-16693994 CTCGCCAAAGGGCCAGAGGATGG + Intergenic
902782119 1:18711614-18711636 CTTCCCCAGGGGCTTGAGGGAGG - Intronic
903184283 1:21620483-21620505 CTCTCCAAGGGGAGTGAGCTGGG + Intronic
904450199 1:30606145-30606167 CTACACAAGGGGCCTGAGGAGGG - Intergenic
907300373 1:53483054-53483076 CTCCCCTAGGCCCTTGAGGAAGG + Intergenic
907500345 1:54875197-54875219 CTCTGCAGGGGGCTTGATCATGG - Exonic
909667713 1:78154134-78154156 CCCTCCAAGGTGCAGGAGGAGGG - Intergenic
910804421 1:91176468-91176490 CTCCCTAAGGAGCTTGGGGAGGG - Intergenic
911132069 1:94399153-94399175 CACTCCAAGGGGCTGTAGAAGGG - Intergenic
911178714 1:94842679-94842701 CTCTCCAGGGGCCGTTAGGAAGG + Intronic
912373534 1:109191876-109191898 CTCTCCTGGGGGTCTGAGGAAGG - Intronic
912684693 1:111753121-111753143 CTTTCCAGGGAGCTAGAGGAGGG - Intronic
913103094 1:115587630-115587652 CCCAACATGGGGCTTGAGGAAGG + Intergenic
914803963 1:150979260-150979282 CTCTCCAAGGGGCTCCTGGCCGG - Intergenic
916022699 1:160807952-160807974 CTCTGCCTGGGGCCTGAGGATGG - Intronic
917170913 1:172173019-172173041 CTCTGGAAGGGGTTTGAGCAAGG + Intronic
918420479 1:184359754-184359776 CCTTCCAAGGGACTTAAGGAAGG - Intergenic
918472829 1:184892411-184892433 CTTTCAGAGGAGCTTGAGGAGGG - Intronic
919121338 1:193344289-193344311 CACTCCAAGGGGCTTTGGGCTGG + Intergenic
920363538 1:205435922-205435944 TTCTCCCAGAGGCCTGAGGATGG - Intronic
920367105 1:205453975-205453997 CACCCCATGGGGGTTGAGGAGGG - Intronic
921471628 1:215557041-215557063 CTCACCAGGGGGCCTAAGGATGG - Intergenic
921836565 1:219784587-219784609 CACTCAATGGGACTTGAGGAGGG - Intronic
922681952 1:227606219-227606241 CTCTCCAAGGGGAGTGTGGCAGG + Intronic
922714208 1:227858263-227858285 CCCTCCAAGGGGCTTTACAAAGG + Intergenic
922786097 1:228283030-228283052 GTCTTCCAGGGGCTTGATGATGG - Exonic
923620864 1:235577946-235577968 CTCGTCAAGGACCTTGAGGAGGG - Intronic
923739167 1:236640061-236640083 ATCTCCAAGGAGTTTGGGGAAGG + Intergenic
1063125103 10:3130069-3130091 CTTTCCAAGGGGCATGGAGATGG + Intronic
1064613661 10:17130144-17130166 CTCTGCAAGGGAGGTGAGGAAGG - Intergenic
1066491202 10:35897077-35897099 CTCTCAAAGGTACTTGAGGCTGG + Intergenic
1067849353 10:49744964-49744986 CTCAGCAAGGGGCTTGGAGAAGG + Intronic
1068216552 10:53989709-53989731 CTCACCCAGGAGCATGAGGAGGG - Intronic
1068491931 10:57735260-57735282 CTCTACAGGGAGCCTGAGGAAGG - Intergenic
1070887103 10:79911156-79911178 CTCACCCAGGAGCATGAGGAGGG - Intergenic
1071148695 10:82606984-82607006 CTCCCCAAGAGGTTTGGGGATGG - Intronic
1071219264 10:83444780-83444802 CTCTCGGAGGGGCTTCGGGAAGG + Intergenic
1071504364 10:86223677-86223699 CACTCCCATGGGCTTGAGGGAGG - Intronic
1074524183 10:114250102-114250124 GTCTACAAGGGGTTTGAAGAGGG - Intronic
1076488110 10:130837157-130837179 CCCTCCAAGGAGCCTGGGGAAGG + Intergenic
1076796984 10:132803197-132803219 CCTTTCAAGGGGCTTGAGAAGGG - Intergenic
1077031920 11:472248-472270 GCCTCCAAGGGGCGTGGGGAGGG - Intronic
1077033074 11:478955-478977 CTCTCCCAGGGGCCTGTGAAGGG + Intronic
1077404440 11:2376952-2376974 TTGTCCAAGGTGCTTGAGGGAGG + Intronic
1077429453 11:2508801-2508823 CTCTCATACAGGCTTGAGGAGGG + Intronic
1078508696 11:11969617-11969639 TTCTGGAAGGGTCTTGAGGAAGG + Intronic
1079675464 11:23220982-23221004 CTCTGCCAGGGGCTTGAAGTTGG + Intergenic
1080173802 11:29338259-29338281 CTCTACAAGTGGATTGAGCATGG + Intergenic
1081105924 11:39069057-39069079 CACTCCCAGGGGCATAAGGATGG + Intergenic
1082811789 11:57482908-57482930 CACTCCCCGGGGCTTGGGGAGGG - Intergenic
1085262520 11:75215608-75215630 CTCTACTAGGCACTTGAGGAGGG + Intergenic
1085574468 11:77589883-77589905 CGCCCCGAGGGGCGTGAGGAGGG + Exonic
1086094148 11:83033813-83033835 ATGCCCAAGGGGCTTGAGGTTGG - Intronic
1086143556 11:83525642-83525664 CACTCCAGGGGGCATCAGGAAGG - Intronic
1087247371 11:95854918-95854940 CTATCCAGGGGGGTTGAGGCAGG - Intronic
1087648425 11:100835135-100835157 ATATCCAAAGGCCTTGAGGATGG - Intronic
1088787723 11:113197730-113197752 GATTCCAATGGGCTTGAGGAGGG - Intronic
1089189319 11:116642760-116642782 CATTCCTAGGGGCTGGAGGATGG + Intergenic
1089709078 11:120302139-120302161 CTCTCCATGGGACTTGAGGTGGG + Intronic
1089747712 11:120628672-120628694 AGCTCCTAGGGGCCTGAGGAAGG + Intronic
1089859485 11:121576028-121576050 CTCGCCAAGAGGCTTGTTGATGG - Intronic
1090221342 11:125029693-125029715 CTCTCCGAGGTGCTTGCTGAAGG - Intronic
1090252975 11:125264053-125264075 CTCTTGTAGGGGCTTGAGAAAGG - Intronic
1092202960 12:6598298-6598320 CCCTCCAAGGGCTTTGGGGAGGG + Exonic
1092758365 12:11786072-11786094 CTGTCCTAGGGATTTGAGGACGG + Intronic
1094193965 12:27726176-27726198 GGCTAAAAGGGGCTTGAGGATGG - Intronic
1094632029 12:32185108-32185130 CTCTACCAGTGGCTTGAAGATGG - Intronic
1095832735 12:46604593-46604615 TTCTCCTGGGAGCTTGAGGATGG + Intergenic
1095941933 12:47733067-47733089 CTCTCCAAGGGCCAAGAGCAAGG + Intergenic
1096796638 12:54082048-54082070 CTCTCCAAGGGGCTGAAAGCTGG + Intergenic
1097799444 12:63896994-63897016 CTCTCCATGGGGCTACACGAGGG + Intronic
1102155326 12:110722256-110722278 CTCTTCAAGGTGGTTGAAGATGG - Exonic
1103538899 12:121652625-121652647 GTCTCCAAAGGGCTTGGGGTCGG - Intronic
1107964594 13:45587696-45587718 CTTTCCAAAGGGCCTGAGGGCGG + Intronic
1111107819 13:83669467-83669489 CTCTTCTAGGGTCTGGAGGATGG - Intergenic
1115878801 14:37891996-37892018 CTCTGCTAGGGGATTGTGGAAGG + Intronic
1116293519 14:43074110-43074132 CTCTGCTAGGGTATTGAGGAAGG + Intergenic
1122288498 14:100667009-100667031 CTCTCCAAGATGCCTGAGGTAGG - Intergenic
1122806401 14:104262087-104262109 ATCTCCAAGGGGCACGAAGAAGG + Intergenic
1122838164 14:104441451-104441473 TGCTCCAAGGGGCTGGAGGATGG + Intergenic
1123823968 15:24062779-24062801 CTCTCCTAGAGGTTTGAGCAGGG - Intergenic
1128785826 15:70396214-70396236 CTCTCCAATTTGCTTGAGGATGG - Intergenic
1130697148 15:86142032-86142054 ATCTCCGAGGACCTTGAGGATGG - Exonic
1130712837 15:86300708-86300730 CTTTCCAGGGGGCCTGAGGTGGG + Intronic
1130889099 15:88118193-88118215 CTCTGCAGAGGGCTTTAGGATGG - Intronic
1132564528 16:615438-615460 TTCTCCAAGGGGCTTGGAAACGG - Intronic
1132854490 16:2038722-2038744 CTCTCCGAGGGGCCTGAGGATGG + Exonic
1134601030 16:15533866-15533888 TTCTCCAAGGGTCTGGAGAAAGG - Intronic
1135136127 16:19886074-19886096 CTCTCCCGGGGGCTGCAGGAAGG + Intronic
1136617676 16:31408596-31408618 CTCTCCCTGGCGATTGAGGATGG - Intronic
1139282952 16:65785481-65785503 CTTTCCATGGGGCCTGAGGAAGG + Intergenic
1139958217 16:70703392-70703414 CCCACCATGGGGCTGGAGGAGGG + Intronic
1141438258 16:84013171-84013193 CTCTCCAGGGGGCCTGAGCCAGG - Intronic
1143981688 17:10875496-10875518 CTCTCCAAGGTGCTGGAGAGAGG + Intergenic
1145817998 17:27809194-27809216 AACCCCAAGGGGCTTGAGGATGG - Intronic
1145941362 17:28744858-28744880 CTCTCCCGGGGGCTGGAGTAAGG + Intronic
1146578194 17:34013048-34013070 CTCTCCAGGGGGGTTGAGCCAGG - Intronic
1147558069 17:41492121-41492143 CTCTGCAAAGGGCTTGGTGAGGG - Intronic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1148463260 17:47850159-47850181 CTGCCCCAGGGGCTGGAGGATGG + Intronic
1148496227 17:48054886-48054908 AGCTCCGAGGGGCCTGAGGAGGG - Intronic
1148640776 17:49185595-49185617 CTCTGCGAGGGGAGTGAGGAAGG + Intergenic
1149448500 17:56732238-56732260 CTCTCCAAGGTCCTACAGGATGG + Intergenic
1149448509 17:56732274-56732296 CTCTCCAAGGTCCTATAGGATGG + Intergenic
1149510814 17:57239937-57239959 ATCTGCAAAGGGCTTGAAGAAGG + Intergenic
1149638236 17:58186871-58186893 CTGTCCAAGGGAGGTGAGGATGG - Intergenic
1150291454 17:63984850-63984872 TTCCCCAAGGGGCTGGAGGGAGG - Intergenic
1151256386 17:72879989-72880011 CTCCTCAAGAGGTTTGAGGATGG - Intronic
1152075835 17:78159020-78159042 CTCTCCCAGATGCCTGAGGAGGG - Intronic
1152105207 17:78324665-78324687 GTCTCCATGGGGATGGAGGAGGG + Intergenic
1156452981 18:37277092-37277114 CTCTGCAGGTGGCTTGTGGAGGG - Intronic
1156526607 18:37774114-37774136 CTCCTCAAGGAGCTGGAGGAAGG + Intergenic
1158986540 18:62823451-62823473 CTATTCAGGAGGCTTGAGGAGGG + Intronic
1160025224 18:75210880-75210902 CTCTCCCAGGAGTTTGAGGGGGG + Exonic
1161851274 19:6739304-6739326 CCCTGCAATGGGGTTGAGGAAGG + Intronic
1162584519 19:11550986-11551008 CTCTCCCAGAGGCTTGTGGATGG + Intergenic
1167266590 19:48485777-48485799 TTCTCCACGGGGCCTGAGGATGG + Exonic
1167462155 19:49631161-49631183 CTCTGCAGGGGGCATGTGGATGG + Intergenic
1168412577 19:56148900-56148922 CTCTCCTAGAGCCTTGAGAAGGG - Intronic
1202711087 1_KI270714v1_random:19798-19820 CTCGCCAAAGGGCCAGAGGATGG + Intergenic
925007840 2:458608-458630 CTCTCCCAGGGGCTGGGGGGAGG + Intergenic
926398927 2:12475374-12475396 CTCTCTACTTGGCTTGAGGATGG - Intergenic
926701584 2:15807668-15807690 CACTCCAAGGCCCTAGAGGAGGG - Intergenic
927915584 2:26934046-26934068 CCCTCCAAGGGGCTTCAGTGAGG - Intronic
928696619 2:33856015-33856037 CTCCCCAAGGAGTTTGGGGATGG + Intergenic
929825855 2:45309304-45309326 CCCTCCAAAGGGCTGGAAGAGGG - Intergenic
930025043 2:47024680-47024702 TTCCCCAAGGGTCTTGGGGATGG + Intronic
930755588 2:54968850-54968872 CTCTCCCAGGGGCATGAGGAGGG + Intronic
930878424 2:56245411-56245433 CTCTGCCAGGGGATGGAGGAGGG + Intronic
931868907 2:66439280-66439302 CTCTCCGAGGGCCTTGGGGTTGG + Intronic
932564741 2:72898737-72898759 CCTTCCAAGGGGCCTGAGGTGGG - Intergenic
933349686 2:81137496-81137518 CTCACGAAGGGTCTTGAAGAAGG + Intergenic
935584720 2:104790375-104790397 CTCTCCTGGGGGCAGGAGGAGGG - Intergenic
937331176 2:121031302-121031324 CTCTCCAAGGGCCTCTAGAAAGG - Intergenic
937907312 2:127058602-127058624 CTCTTAAAGGGGCCTGAGGGAGG - Intronic
938238395 2:129724230-129724252 CCCACCAAGGGGATTGGGGATGG + Intergenic
938895929 2:135750716-135750738 CTCTCAAAGGTGCTTCAGGAAGG - Intronic
942443149 2:176056839-176056861 CTCTGAAAGGGGCTTTGGGAAGG - Intergenic
944440543 2:199739233-199739255 CTCTCCAGTGGCCTTGAGGCAGG - Intergenic
946371569 2:219284730-219284752 CTGTCCAAGGGGCATGAGGCAGG - Exonic
946399097 2:219459507-219459529 CTCTCCAAGGGGCTTGAGGATGG + Intronic
949066058 2:241990936-241990958 CTCTCTCTGTGGCTTGAGGATGG + Intergenic
1169395188 20:5222894-5222916 TTCTTCAGGGGGCTTCAGGATGG - Intergenic
1171848101 20:30290061-30290083 CTCTCCAAGGGGCTGAAAGCTGG + Intergenic
1172020173 20:31908496-31908518 CTGCCGAGGGGGCTTGAGGAAGG - Intronic
1172340681 20:34155098-34155120 CTCTCATAGCCGCTTGAGGAAGG - Intergenic
1174549858 20:51354636-51354658 CTCTTTAAGGAGCATGAGGAAGG - Intergenic
1174900032 20:54489805-54489827 CTCTCCAATGGGTATGATGAGGG - Intronic
1175495692 20:59412637-59412659 CTCTGAAAGGGGCTTCAGGAAGG - Intergenic
1175785371 20:61708585-61708607 GTCTACAAGGGGCATGAGGCTGG - Intronic
1177869806 21:26557757-26557779 CTCTCCACTGGGCTTCAGAATGG + Intronic
1180703429 22:17794246-17794268 CTATCCAGGGGCTTTGAGGAGGG - Intronic
1180867275 22:19126840-19126862 TTCTCCAAGGGGACTGAGGTTGG - Intergenic
1181394722 22:22612937-22612959 CACTCCAGGGAGCCTGAGGAGGG - Intergenic
1183400730 22:37602449-37602471 CTCTCCAAGGGGCTTTTACATGG + Intergenic
1184116008 22:42422721-42422743 CCCTCAAAGGGGCATCAGGATGG + Intronic
1184415181 22:44348017-44348039 CCCACCAGGGGACTTGAGGATGG + Intergenic
1185149148 22:49154243-49154265 CTCCCCAGGGGGCCTGGGGAGGG + Intergenic
950329386 3:12144375-12144397 CTCTCCTGGGGGCCTGATGAGGG + Intronic
950493093 3:13318050-13318072 CTGTCCAGGGGGCATGAGGCAGG + Intronic
952453057 3:33449312-33449334 CTCTCGTAGCCGCTTGAGGAAGG - Intergenic
953345510 3:42172149-42172171 CCCTCCTAGGAGCTGGAGGAGGG - Intronic
953929826 3:47000324-47000346 CTCTCCAATGTGCTGGAGGACGG + Exonic
954124674 3:48521389-48521411 CTCCCCAAGTGCCTTGTGGAAGG - Intronic
954643762 3:52118113-52118135 CTCCCAGAGGGGCTTGAGGGTGG - Intronic
954744723 3:52780684-52780706 CTCTCCCATGGGCGTGAGGCGGG - Intronic
956644030 3:71438996-71439018 CTCTCCAAGGCTCTATAGGAAGG + Intronic
957570012 3:81935062-81935084 TTCTCCAAAGTGCTGGAGGAGGG - Intergenic
959717071 3:109444527-109444549 CTGTCCAAGGGCCTTGGGGGTGG + Intergenic
959731983 3:109614560-109614582 CTCTCCACTGGGCTTGCAGATGG - Intergenic
961342596 3:126238463-126238485 CTCTGCTAGGGGATTGTGGAAGG - Intergenic
961795149 3:129403761-129403783 CTCTCGAAAGGGCTGGAGGCAGG + Intronic
962240529 3:133747435-133747457 CTCTCCAGGATGCATGAGGAGGG - Intronic
962372310 3:134830927-134830949 CTCAGCAAGGGCCTTGAGGAAGG + Intronic
963231018 3:142908989-142909011 TTCTCCAAGTGCCTTGAGGACGG + Intergenic
965420791 3:168455993-168456015 CTCCCCTAGGGGTTTGAGCACGG - Intergenic
968662702 4:1805360-1805382 CTCCCCAAGGGGCTTGCCCAGGG - Exonic
968714119 4:2141793-2141815 CTCTCCAAGGAGCCTGAGAGGGG - Intronic
968753431 4:2402100-2402122 CTCTCCCTGGCGCTGGAGGAGGG + Intronic
969459808 4:7322941-7322963 ATCTACTAGGGCCTTGAGGACGG + Intronic
969502342 4:7560720-7560742 CTCTCCAGCAGGCTTGAGGATGG - Intronic
970929872 4:21496987-21497009 CTCTCTAAGGGGCATGTGGAGGG + Intronic
973634573 4:52850162-52850184 CTCTGCAAGGTGCTTAAGAAAGG - Intergenic
974573725 4:63689212-63689234 CTCTACAAGGGCAGTGAGGAGGG + Intergenic
981443196 4:144806576-144806598 TCCTCCTGGGGGCTTGAGGATGG + Intergenic
981541560 4:145851904-145851926 ATCCCTAAGGGGCTTGAGGGAGG - Intronic
981557405 4:146009794-146009816 CTCTCCCAAGGGCCTAAGGATGG - Intergenic
983457764 4:167986007-167986029 CCCTCCTAGGGGCCTGAGGATGG - Intergenic
984702842 4:182829117-182829139 CTCTCCATGGGGCTCTGGGATGG + Intergenic
985967359 5:3347881-3347903 CTCTCCCAGGGGATAGAGGCTGG - Intergenic
991925094 5:71697921-71697943 CTCCCCACGGGGCCTCAGGAAGG - Intergenic
993431733 5:87841040-87841062 TTCTCCCAAGGGCCTGAGGATGG - Intergenic
997781953 5:136667819-136667841 CTTTCCTGGGGGCTTGAGGTGGG + Intergenic
998154346 5:139776034-139776056 CTCCCCAAGGTCCCTGAGGAGGG + Intergenic
999499558 5:152133034-152133056 CTGTCCTAGGGCCTTGTGGAAGG - Intergenic
999657263 5:153822739-153822761 CCCTCCTAGGGGCTGGAGCAGGG + Intergenic
1001226300 5:169947324-169947346 TTTTCCAAGGGGAATGAGGAGGG + Intronic
1001236370 5:170032845-170032867 CTCTCCAGGGGCCCTTAGGAGGG - Intronic
1002163497 5:177331202-177331224 ATGTGCAAGGGGCTGGAGGATGG - Intergenic
1003563640 6:7204153-7204175 CTCTCCCAGGGTGTGGAGGAAGG - Intronic
1006196118 6:32243580-32243602 CTGTCCAGGGGGGTGGAGGAAGG + Intergenic
1007317689 6:41002710-41002732 CTCTCCTAGGAGCTTGGAGAAGG - Intergenic
1007829607 6:44628371-44628393 CTCTGACAGGGGCTGGAGGAAGG + Intergenic
1008547283 6:52594371-52594393 CTCTCCAAGGGGCATGGGGGAGG + Intergenic
1014256025 6:119160533-119160555 CTCTGCAAGGGGCTGGGAGAAGG - Intergenic
1014724308 6:124956378-124956400 TTCTCCTGGGGGCTTGAGGATGG + Intergenic
1017029280 6:150206620-150206642 TTCTACACGGGGCATGAGGATGG + Intronic
1019521322 7:1461711-1461733 GGCTCCAAGGGGCTTCAGGGTGG - Intergenic
1026858118 7:73768439-73768461 ATCTCAGAGGGGCTTGAGGCCGG - Intergenic
1029147635 7:98458153-98458175 CTCACCAAGATGCTTAAGGAGGG - Intergenic
1029853562 7:103489958-103489980 CTCTCCCAGAGGCTGGAGGCAGG - Intronic
1032169973 7:129576586-129576608 GACTGCCAGGGGCTTGAGGAAGG + Intergenic
1032470495 7:132174998-132175020 GTCTCCTAGGGGCTTGGGTAAGG - Intronic
1035303555 7:157915506-157915528 CTCTCCATTGGGCTGGAGGATGG - Intronic
1037881697 8:22576671-22576693 TTCTCCAAGGGCCTGGACGAGGG - Intergenic
1038489096 8:27956918-27956940 CTCTCCAAAAGGGTGGAGGACGG + Intronic
1039387131 8:37146036-37146058 CTCTCCCAGGGGCTTGTCCATGG - Intergenic
1039442741 8:37606621-37606643 CTTTCCCACGGCCTTGAGGATGG - Intergenic
1039597900 8:38807293-38807315 ATATCCAAGTGGCTTCAGGATGG - Intronic
1041773312 8:61496333-61496355 CTGTCCAAGGTGCTGGAGGGAGG + Intronic
1042774940 8:72419698-72419720 CTCTCTAAGGGCCTTTAGGAAGG + Intergenic
1044825176 8:96189117-96189139 CCCACCAAGGGTCTTGAGGTGGG + Intergenic
1047255930 8:123213427-123213449 CTCTCAAAGAAGCTTCAGGAAGG - Intergenic
1047992179 8:130297652-130297674 CTCACCAAGTGGCTTAAGAAGGG + Intronic
1049309619 8:141926693-141926715 CTGTCCCAGGGGCTGGAGGCTGG + Intergenic
1049813080 8:144584996-144585018 CTCTGCAAGGAGCCTGTGGATGG + Intronic
1051508276 9:17848746-17848768 TTTTCCCAGGGGCTGGAGGAAGG - Intergenic
1052830978 9:33215330-33215352 ATTTCCAAAGGGCTTGAAGATGG + Intergenic
1053786231 9:41654713-41654735 CTCTCCAAGGGGCTGAAAGCTGG + Intergenic
1054158820 9:61659486-61659508 CTCTCCAAGGGGCTGAAAGCTGG - Intergenic
1054174946 9:61868657-61868679 CTCTCCAAGGGGCTGAAAGCTGG + Intergenic
1054449805 9:65397701-65397723 CTCTCCAAGGGGCTGAAAGCTGG + Intergenic
1054478594 9:65590491-65590513 CTCTCCAAGGGGCTGAAAGCTGG - Intergenic
1054662592 9:67712136-67712158 CTCTCCAAGGGGCTGAAAGCTGG - Intergenic
1055641713 9:78324056-78324078 CTTTCCAAGGTACTGGAGGAGGG - Intronic
1056083781 9:83124643-83124665 CTCACAATAGGGCTTGAGGAGGG - Intergenic
1056168029 9:83957119-83957141 CACTCCCTGGGGCTTGGGGAAGG - Intergenic
1062187625 9:135227124-135227146 CTCTGCAAGGGTCGTGAGGCTGG + Intergenic
1062249292 9:135586250-135586272 GGCTCCAAGTGGCTCGAGGAAGG + Intergenic
1189042625 X:37558609-37558631 CTTTCCAGGGGGCTGGATGAGGG - Intronic
1189165336 X:38855603-38855625 CTTTCCATGGCCCTTGAGGAAGG + Intergenic
1190549433 X:51563621-51563643 CCCAACATGGGGCTTGAGGAAGG - Intergenic
1192149516 X:68703510-68703532 CTCTCCTTGGGGCTGGGGGAGGG + Intronic
1193396496 X:80990173-80990195 CACTGCAAGGGGATGGAGGACGG - Intergenic
1193970092 X:88039828-88039850 TTCTCCCAGGTGCCTGAGGATGG + Intergenic
1194975996 X:100396492-100396514 CTCCCCAAGGGGCTGGAGGCAGG - Intronic
1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG + Intronic
1196030383 X:111090221-111090243 CTCTTCAAGGGGCTTCATTATGG - Intronic
1197753849 X:129981976-129981998 TTCTCCCAGGGGCCTGAGGGAGG - Intronic
1198929705 X:141840857-141840879 CTATTCAAGGGGATTGAGAATGG + Intronic
1199719550 X:150532724-150532746 TTTTCCAAGGGGTTTGAGGATGG - Intergenic
1201555734 Y:15263400-15263422 CTCTCATAGCCGCTTGAGGAAGG - Intergenic