ID: 946405095

View in Genome Browser
Species Human (GRCh38)
Location 2:219488289-219488311
Sequence CCTTTCATCCAGGAGATGTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946405095_946405104 20 Left 946405095 2:219488289-219488311 CCGCACATCTCCTGGATGAAAGG 0: 1
1: 0
2: 0
3: 15
4: 171
Right 946405104 2:219488332-219488354 CAGAGAGGGAGGCCAGCAAGTGG 0: 1
1: 1
2: 5
3: 62
4: 709
946405095_946405101 9 Left 946405095 2:219488289-219488311 CCGCACATCTCCTGGATGAAAGG 0: 1
1: 0
2: 0
3: 15
4: 171
Right 946405101 2:219488321-219488343 TCTGTCTCCCACAGAGAGGGAGG 0: 1
1: 0
2: 5
3: 38
4: 294
946405095_946405099 5 Left 946405095 2:219488289-219488311 CCGCACATCTCCTGGATGAAAGG 0: 1
1: 0
2: 0
3: 15
4: 171
Right 946405099 2:219488317-219488339 AGACTCTGTCTCCCACAGAGAGG 0: 1
1: 0
2: 2
3: 35
4: 343
946405095_946405100 6 Left 946405095 2:219488289-219488311 CCGCACATCTCCTGGATGAAAGG 0: 1
1: 0
2: 0
3: 15
4: 171
Right 946405100 2:219488318-219488340 GACTCTGTCTCCCACAGAGAGGG 0: 1
1: 0
2: 5
3: 37
4: 947

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946405095 Original CRISPR CCTTTCATCCAGGAGATGTG CGG (reversed) Exonic
900234879 1:1583660-1583682 CCTTTGATCCAGGACATCCGTGG + Intergenic
907158238 1:52353633-52353655 CCTTCCATCCAGGACCTGTGAGG + Exonic
908584742 1:65555338-65555360 CCATTCATCCAGGTGATATGTGG - Intronic
912152631 1:106879385-106879407 CCTCTCCTCCAGGAGAGGAGGGG - Intergenic
912698776 1:111860974-111860996 CCTTTCAAACAGGAGCTGTCTGG + Intronic
916275865 1:162992531-162992553 TCTTTCACCCAGGAGTTGTGGGG + Intergenic
916884289 1:169052132-169052154 CCTTACTTCCAGGAGAAATGGGG + Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
918529899 1:185507142-185507164 AGTTTCATACTGGAGATGTGGGG - Intergenic
922252188 1:223859588-223859610 CTTTTCATCCAGGACTTCTGAGG - Intergenic
923261897 1:232275635-232275657 CCTTTCCTCCTGGAGACGGGAGG + Intergenic
1066066191 10:31762598-31762620 GCTTTCTTCAAGGAGAGGTGGGG + Intergenic
1067730940 10:48811073-48811095 CACTTCCTCCAGGAGATGAGGGG + Intronic
1069546020 10:69329611-69329633 CCTGTCATTCATGAGTTGTGTGG - Intronic
1070031586 10:72682204-72682226 CCTTTTAGCTAGGAGATGTCTGG + Intergenic
1070361452 10:75693854-75693876 CCTTTCATCCAAGAAATATGGGG - Intronic
1072918720 10:99557411-99557433 CCTTTCATGCAGGGCATGTTTGG + Intergenic
1073580758 10:104663571-104663593 GCTTTGATCCAGAAAATGTGGGG - Intronic
1074738883 10:116465064-116465086 CCTCTCATCCAAGAGCTGTTTGG - Intronic
1075174557 10:120147340-120147362 CCATTTATCCAAGAGATGTTTGG + Intergenic
1075845637 10:125542994-125543016 CAAGTCATCCAGGAGATGAGCGG - Intergenic
1076141953 10:128086451-128086473 TCCTTCATGCAGAAGATGTGGGG - Intergenic
1076232672 10:128834835-128834857 CCCTTCATCAGGGAGATGGGTGG + Intergenic
1078707197 11:13755866-13755888 CCTTGCATCCAAGGGATCTGGGG + Intergenic
1079240921 11:18721605-18721627 TCCCTCTTCCAGGAGATGTGGGG + Exonic
1083947327 11:65931440-65931462 CCTGTCATCCAGGAAGTGGGAGG - Intergenic
1085407611 11:76272685-76272707 CCATTGAGCCAGGCGATGTGAGG - Intergenic
1086312481 11:85550143-85550165 TCTGGCATCCAGGAGAAGTGAGG - Intronic
1087582380 11:100074245-100074267 CCTTTCTTCCAAGAGATGGTTGG - Exonic
1088077958 11:105875242-105875264 GCCTTCATCCCTGAGATGTGAGG - Intronic
1088888066 11:114023110-114023132 CGTGTCTTCCAGGAGATTTGGGG - Intergenic
1089689329 11:120177305-120177327 CCTTTCATCCTGGTGATGTTAGG - Intronic
1093774296 12:23054187-23054209 GCTTTCATCCAGGAGTTCTGTGG + Intergenic
1095234613 12:39781840-39781862 CCCTTCCTCCAGGGTATGTGAGG - Intronic
1096562939 12:52450065-52450087 CCTTTCTTCCTGTAGATATGAGG - Exonic
1096565090 12:52471725-52471747 CCTTTCTTCCTGTAGATATGAGG - Exonic
1096567102 12:52491165-52491187 CCTTTCTTCCTGTAGATATGAGG - Exonic
1097871839 12:64608904-64608926 CCTATCATTCAGTAGCTGTGTGG + Intergenic
1101348397 12:103906097-103906119 CCATTCATTCAGGACATGTCAGG - Intergenic
1101736144 12:107464803-107464825 CCTTGCACCCAGGGGATGTTGGG + Intronic
1103026301 12:117576990-117577012 CCTTTCCTCCTGGAGTTGTGGGG - Intronic
1103032221 12:117625531-117625553 GGCTTCATCCCGGAGATGTGAGG - Intronic
1104079192 12:125415396-125415418 CCCTTCCTCTGGGAGATGTGGGG - Intronic
1105357438 13:19671587-19671609 CCTTTCATACAAGAGAGGTTAGG - Intronic
1106407687 13:29488057-29488079 CCTTTCCTGCTGCAGATGTGTGG + Intronic
1109693761 13:65927185-65927207 CCTGGCATCCAGGAAAAGTGAGG + Intergenic
1113646444 13:111999869-111999891 CATGCCATGCAGGAGATGTGGGG - Intergenic
1114354638 14:21893956-21893978 CCATTCATCAAGGAGAAGGGAGG - Intergenic
1116353113 14:43891687-43891709 CCTTTCTTCCAGGACATATCAGG - Intergenic
1116490762 14:45500089-45500111 ACTTTGTTCCAGGAGATGCGTGG - Intergenic
1120100492 14:80439259-80439281 CCCTTCACCCAGGAGCTGTTGGG - Intergenic
1120317580 14:82915713-82915735 CCTGTGAATCAGGAGATGTGGGG + Intergenic
1122648672 14:103212578-103212600 CCCTTCATTCAGGTAATGTGGGG + Intergenic
1123827701 15:24100750-24100772 CTTTTTGTCCAGGACATGTGTGG + Intergenic
1123842159 15:24260162-24260184 CTTTTTGTCCAGGACATGTGTGG + Intergenic
1123985755 15:25644416-25644438 CCTTTGTTCCAGGAGCTGAGCGG - Intergenic
1125285341 15:38086774-38086796 CTTTTCCTGCTGGAGATGTGTGG - Intergenic
1126807490 15:52366047-52366069 CCCTTCAGCTAGGAGAGGTGAGG + Intronic
1127921698 15:63499663-63499685 CCTTTTATGAAGGAGATGAGGGG - Intergenic
1128765142 15:70246805-70246827 CCTTTCATCCAGGGCCTTTGTGG - Intergenic
1129248079 15:74292175-74292197 CCTTTCCTCCAGGTAAGGTGGGG - Intronic
1134215153 16:12311499-12311521 CATTTCCTCCAGGAGATGCAGGG + Intronic
1135036919 16:19086295-19086317 CCCTTGATCCAGGTGATTTGAGG + Intergenic
1136418011 16:30115133-30115155 CCTTGCACCCAGGAGTTTTGAGG + Intronic
1140409957 16:74735412-74735434 CCCGTCACCCAGGGGATGTGAGG + Intronic
1142577799 17:920978-921000 CCTGTCATCCAGGACTTTTGGGG - Intronic
1143268555 17:5658761-5658783 CCTGCCATTCAGCAGATGTGAGG - Intergenic
1143305936 17:5946782-5946804 CCTTCCATCCTGGAGAAGGGTGG + Intronic
1143530525 17:7500574-7500596 TCTATCATCCCTGAGATGTGGGG + Intronic
1146405856 17:32536967-32536989 CCTTTGACCCAGAAAATGTGTGG + Intronic
1148962835 17:51407774-51407796 CCATCCAGCCAGGAGATGAGAGG + Intergenic
1149249283 17:54749632-54749654 CCTTTCATCCATGTGAGGAGAGG - Intergenic
1149565516 17:57638189-57638211 CCTTTCAGCCTGGAGAGGAGAGG - Intronic
1149659129 17:58325265-58325287 CCCTTCACACAGGGGATGTGTGG + Intronic
1151674779 17:75591805-75591827 CCTTTCAGCCAGGAGAGGGGTGG + Intergenic
1156857645 18:41801198-41801220 CCATCCATCAAGGAGATTTGTGG + Intergenic
1157093112 18:44659960-44659982 CCTTTCAACCATGAAATGTCAGG + Intergenic
1157270722 18:46273975-46273997 CCTCTCAGCCAGGAACTGTGTGG + Intergenic
1160288189 18:77566670-77566692 TCTTTCATTCACGAGATGAGGGG - Intergenic
1162424302 19:10584775-10584797 CATTTCACACAGGAGAAGTGAGG + Intronic
1165247847 19:34507865-34507887 GCTCTGCTCCAGGAGATGTGTGG - Exonic
1165728769 19:38130786-38130808 CCTTTCAGCCAGGTGGTGGGTGG + Intronic
1166423563 19:42656472-42656494 CCTCTCCTCCAGCAGAAGTGGGG + Intronic
1166495777 19:43302143-43302165 CCTCTCCTCCATGAGAAGTGAGG - Intergenic
1168545131 19:57243953-57243975 ACTTTCACCCAGGAGGAGTGGGG + Exonic
925158713 2:1666372-1666394 CCTCTCGTCCAGGAGATCCGCGG + Exonic
926151566 2:10428439-10428461 GGTTTCAGCCATGAGATGTGGGG - Intergenic
927021636 2:19022972-19022994 ACTTTCATTCATGAGATTTGGGG + Intergenic
927913194 2:26915843-26915865 CCATTCATTCAGGAGAGGGGTGG - Intronic
930855943 2:56018236-56018258 CTTTTCATGCAGCAGATGTTTGG - Intergenic
932948739 2:76268350-76268372 CCTGTCATCCAGATGCTGTGAGG + Intergenic
935042953 2:99452099-99452121 CCTTTAATTCAGCAGATGTGGGG + Intronic
936404209 2:112187766-112187788 TTTTTCATCCAGGGGATGGGTGG + Exonic
937988723 2:127650446-127650468 CCTGCCACCCAGGAGATCTGAGG - Intronic
938081874 2:128374515-128374537 CTTTTCTTCCAGGAGATGATGGG + Intergenic
940861889 2:158779268-158779290 CCATTCATTCAGAAGATTTGTGG + Intergenic
940910941 2:159209515-159209537 GCTTTCAGCCAGGGAATGTGGGG + Intronic
941736772 2:168986137-168986159 TCCTTCATCCAGGACAAGTGTGG + Exonic
942053993 2:172165598-172165620 TCTTTCTTCCTGGAGATGTTAGG - Intergenic
942565513 2:177262200-177262222 ACATTCATTCAGGAGATGAGAGG + Intronic
943555212 2:189395022-189395044 CTTTTTATCCAGGAGGTTTGTGG - Intergenic
944608982 2:201380838-201380860 ACATTCCTCCAGGAGATGTATGG - Exonic
946405095 2:219488289-219488311 CCTTTCATCCAGGAGATGTGCGG - Exonic
948033108 2:234835917-234835939 CCTTGCATCCGGGAAATGTGAGG - Intergenic
1172883962 20:38219159-38219181 CCTGTCAGCCTGGAGCTGTGGGG - Intronic
1174835414 20:53852150-53852172 TGTTTCTTCCAGGAAATGTGAGG + Intergenic
1175433243 20:58922181-58922203 CCTTTGCTCCAGGAGCTGTTTGG - Intergenic
1176031431 20:63014879-63014901 CCTTTCACACAGCAGCTGTGAGG + Intergenic
1177033340 21:16010966-16010988 CCTTTCATCCAGGAGCTAAAAGG - Intergenic
1178585252 21:33865985-33866007 TTTTTTCTCCAGGAGATGTGGGG - Intronic
1181341563 22:22184296-22184318 CCCTAGATCCAGGAGATTTGAGG - Intergenic
1182277706 22:29201010-29201032 CCATTCATCCTGGAGCTGTCAGG + Intergenic
1182747752 22:32618571-32618593 CCTTTCATTCTGAAAATGTGTGG + Intronic
1184379468 22:44136119-44136141 CTTTGCAGCCAGGAGAGGTGAGG - Intronic
1184444190 22:44537731-44537753 CCACTCCTCCAGGGGATGTGGGG + Intergenic
949839362 3:8303556-8303578 TCCTTCATCCAGCAGCTGTGTGG - Intergenic
950654366 3:14427581-14427603 ACCTTCAGCCAGGAGCTGTGGGG + Intronic
952252605 3:31669505-31669527 GCCTTCATTCAGGGGATGTGTGG - Intronic
954998018 3:54899827-54899849 CCGTTCATCCAGGAGCTGGATGG - Exonic
961359672 3:126358947-126358969 GCTTTCACCAAGGAGATGGGAGG - Intergenic
965223169 3:165953747-165953769 CCTTTCATTCAGGAGTTTTGAGG - Intergenic
967253434 3:187566060-187566082 CCTTTCATCATGGAACTGTGGGG + Intergenic
967346335 3:188460414-188460436 TATTTCATCCAGGAGAAGTTGGG + Intronic
972836855 4:42881426-42881448 CCATCCATCCAGAAGTTGTGAGG + Intergenic
973145669 4:46822473-46822495 ACATTCATCCAGGTCATGTGAGG - Intronic
973854511 4:54997374-54997396 CCTTTCATTCAGGAGACTGGTGG - Intergenic
974468326 4:62286381-62286403 CCTTCCATTCAGGAGGTCTGAGG + Intergenic
975901894 4:79163381-79163403 CCTTTCTTCCATGAGAACTGTGG + Intergenic
976365220 4:84225626-84225648 CCACTCATCAGGGAGATGTGTGG - Intergenic
978379415 4:108111433-108111455 CCCTTCAGGCAGGAGTTGTGTGG - Intronic
979062881 4:116087803-116087825 AATTTCATCCAGGGGATGAGGGG + Intergenic
980298951 4:130963215-130963237 CCTATCATTCAGGAGTTGTGAGG + Intergenic
982663132 4:158229580-158229602 CCTTTCCTCCAGTAGTTCTGAGG - Intronic
983210342 4:164952049-164952071 CATTTGATCCCGGAGGTGTGAGG - Intergenic
984285170 4:177719652-177719674 TGTTTCTTCCAGAAGATGTGAGG - Intergenic
985085485 4:186308650-186308672 ACTTGCATGCAGGAGATTTGGGG + Intergenic
987195413 5:15520854-15520876 CCTGTCCTCCAGGGGTTGTGTGG + Intronic
988285953 5:29216100-29216122 GATTTCATCCAGGTGATATGCGG - Intergenic
991473821 5:66998846-66998868 CCTTTCATGCAGGAGCTCTCAGG + Intronic
993147485 5:84113773-84113795 CCTTTCATTCTGAAGATGTCTGG - Intronic
995301192 5:110585338-110585360 CCCTTCATCCTGGTTATGTGGGG + Intronic
997425474 5:133799889-133799911 CCTTTCCTCCTTGAGAAGTGTGG - Intergenic
999723895 5:154419146-154419168 CATTTCAAGCAGGAGATGTTGGG + Exonic
1000736720 5:164911862-164911884 AGTTTTATCCAGGGGATGTGGGG + Intergenic
1002865172 6:1115433-1115455 CCTCTCCTCCAGCAGATGAGAGG - Intergenic
1004228927 6:13814009-13814031 CGTTTCCTGCAGGAGAGGTGAGG - Exonic
1010162165 6:72869289-72869311 CCTTCTATCCCGGACATGTGGGG + Intronic
1020145242 7:5637332-5637354 CCTGTCACTAAGGAGATGTGTGG - Intronic
1022037248 7:26546130-26546152 CCTTTCAGCCAGAAGATGGAAGG - Intergenic
1023837484 7:44076839-44076861 CCTTTCATAGAGGAGAGGAGAGG - Intronic
1026123347 7:67556955-67556977 CCTTTCTTCTGGGAGATGAGGGG - Intergenic
1029598751 7:101551400-101551422 CCTTTCATTCATGCGCTGTGTGG + Intronic
1030664932 7:112266227-112266249 CCTTGAACCCAGGAGATGGGAGG - Intronic
1030688345 7:112508710-112508732 CTTTGCATCCCTGAGATGTGAGG - Intergenic
1030930710 7:115520836-115520858 CCTTTCATCCAGGATATTCATGG - Intergenic
1031490431 7:122381143-122381165 GCTTTCAGCCAGGAGCTGGGGGG - Intronic
1032186213 7:129728901-129728923 CATTTCATCCTGAACATGTGTGG - Intronic
1033165118 7:139033441-139033463 CATTTCATACAAGAGATGTGAGG + Intronic
1033550871 7:142446410-142446432 TCTTTCATGAAGGATATGTGAGG + Intergenic
1042298241 8:67245197-67245219 CATTTCATGCAGGACATGTCTGG - Intronic
1043507876 8:80920765-80920787 CCTTCCATCAAGGAGATGCCTGG + Intergenic
1046754749 8:117961871-117961893 CCTTTCAACTATGAGATCTGTGG - Intronic
1047488859 8:125357690-125357712 CCTGTAATCAAGGAGATGTTGGG - Exonic
1047808844 8:128385999-128386021 CCTTTCTTCCAGGAGACGGCTGG + Intergenic
1049711948 8:144068781-144068803 CCTTGCAGCCAGGAGCTGGGAGG - Intergenic
1052530455 9:29677124-29677146 CCTTCCATCTTGGAGAAGTGTGG + Intergenic
1053543055 9:38994264-38994286 CCTCTCCTCCAGGAGATTTTGGG + Intergenic
1053807494 9:41817781-41817803 CCTCTCCTCCAGGAGATTTTGGG + Intergenic
1054623098 9:67369646-67369668 CCTCTCCTCCAGGAGATTTTGGG - Intergenic
1054871771 9:70053772-70053794 CTGTTCATTCAGGAGCTGTGAGG + Intronic
1055017033 9:71629864-71629886 CCTTTTATCCAAAAAATGTGTGG + Intergenic
1057496379 9:95564535-95564557 TCTTTCTTCCAGGAGAGCTGGGG + Intergenic
1057611165 9:96545021-96545043 ACTTTGATTCAGTAGATGTGGGG - Intronic
1058730086 9:107841430-107841452 CCTGTTACCCAGGAGATGGGTGG + Intergenic
1058949638 9:109891569-109891591 GCTTGAATCCAGGAGATGGGAGG - Intronic
1059487714 9:114639625-114639647 CTTTTCAGCCAAGAGATTTGGGG + Intronic
1060424634 9:123494042-123494064 CCATTCTTCTAGGAAATGTGGGG - Intronic
1061402399 9:130375670-130375692 TCCTTCATCCAGGTGATGTTGGG - Intronic
1187962552 X:24580528-24580550 CCTTTCATCTAGAATATGTGGGG + Intronic
1188323639 X:28772503-28772525 GCTTTCCGCCAGGAAATGTGAGG + Intronic
1189380638 X:40500124-40500146 CTTTCCAGCCAGGAGATATGAGG - Intergenic
1190014282 X:46813333-46813355 TCCTTTATGCAGGAGATGTGAGG - Intergenic
1190430642 X:50374974-50374996 CTTTTCATCCAGGAAAGCTGTGG + Exonic
1193748071 X:85308209-85308231 CCTTTCTTCCTGCAGATGAGGGG - Exonic
1195511220 X:105717423-105717445 CCTTTCATCCAGTAGATCATTGG - Exonic
1195924812 X:110014864-110014886 CCTTTCACCCAGGAGCTCTGGGG - Intronic
1198910189 X:141605164-141605186 CCTTTCGTACAGCAGATATGTGG - Intronic