ID: 946407581

View in Genome Browser
Species Human (GRCh38)
Location 2:219500005-219500027
Sequence CTGGCACCTCACCCTTTTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 167}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946407581_946407604 24 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407604 2:219500052-219500074 TGGAGTGGTAGGCGGGATGGGGG 0: 1
1: 0
2: 0
3: 26
4: 329
946407581_946407596 4 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407596 2:219500032-219500054 ATGGGGGGAGGAGGTTGGGCTGG 0: 1
1: 0
2: 3
3: 59
4: 845
946407581_946407592 -5 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407592 2:219500023-219500045 GCCAGGGGAATGGGGGGAGGAGG 0: 1
1: 0
2: 9
3: 137
4: 1355
946407581_946407603 23 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407603 2:219500051-219500073 CTGGAGTGGTAGGCGGGATGGGG 0: 1
1: 0
2: 0
3: 23
4: 253
946407581_946407598 13 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407598 2:219500041-219500063 GGAGGTTGGGCTGGAGTGGTAGG 0: 1
1: 0
2: 3
3: 53
4: 634
946407581_946407594 -1 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407594 2:219500027-219500049 GGGGAATGGGGGGAGGAGGTTGG 0: 1
1: 0
2: 21
3: 238
4: 2868
946407581_946407595 0 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407595 2:219500028-219500050 GGGAATGGGGGGAGGAGGTTGGG 0: 1
1: 0
2: 9
3: 103
4: 1190
946407581_946407605 30 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407605 2:219500058-219500080 GGTAGGCGGGATGGGGGCAGAGG 0: 1
1: 0
2: 1
3: 70
4: 856
946407581_946407597 9 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407597 2:219500037-219500059 GGGAGGAGGTTGGGCTGGAGTGG 0: 1
1: 0
2: 14
3: 154
4: 1327
946407581_946407591 -8 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407591 2:219500020-219500042 GGTGCCAGGGGAATGGGGGGAGG 0: 1
1: 3
2: 4
3: 87
4: 924
946407581_946407600 17 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407600 2:219500045-219500067 GTTGGGCTGGAGTGGTAGGCGGG 0: 1
1: 0
2: 4
3: 39
4: 379
946407581_946407601 21 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407601 2:219500049-219500071 GGCTGGAGTGGTAGGCGGGATGG 0: 1
1: 0
2: 2
3: 48
4: 462
946407581_946407599 16 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407599 2:219500044-219500066 GGTTGGGCTGGAGTGGTAGGCGG 0: 1
1: 0
2: 3
3: 32
4: 466
946407581_946407602 22 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407602 2:219500050-219500072 GCTGGAGTGGTAGGCGGGATGGG 0: 1
1: 0
2: 1
3: 6
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946407581 Original CRISPR CTGGCACCTCACCCTTTTGA GGG (reversed) Exonic