ID: 946407581

View in Genome Browser
Species Human (GRCh38)
Location 2:219500005-219500027
Sequence CTGGCACCTCACCCTTTTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 167}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946407581_946407599 16 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407599 2:219500044-219500066 GGTTGGGCTGGAGTGGTAGGCGG 0: 1
1: 0
2: 3
3: 32
4: 466
946407581_946407595 0 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407595 2:219500028-219500050 GGGAATGGGGGGAGGAGGTTGGG 0: 1
1: 0
2: 9
3: 103
4: 1190
946407581_946407602 22 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407602 2:219500050-219500072 GCTGGAGTGGTAGGCGGGATGGG 0: 1
1: 0
2: 1
3: 6
4: 210
946407581_946407596 4 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407596 2:219500032-219500054 ATGGGGGGAGGAGGTTGGGCTGG 0: 1
1: 0
2: 3
3: 59
4: 845
946407581_946407591 -8 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407591 2:219500020-219500042 GGTGCCAGGGGAATGGGGGGAGG 0: 1
1: 3
2: 4
3: 87
4: 924
946407581_946407597 9 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407597 2:219500037-219500059 GGGAGGAGGTTGGGCTGGAGTGG 0: 1
1: 0
2: 14
3: 154
4: 1327
946407581_946407601 21 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407601 2:219500049-219500071 GGCTGGAGTGGTAGGCGGGATGG 0: 1
1: 0
2: 2
3: 48
4: 462
946407581_946407594 -1 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407594 2:219500027-219500049 GGGGAATGGGGGGAGGAGGTTGG 0: 1
1: 0
2: 21
3: 238
4: 2868
946407581_946407600 17 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407600 2:219500045-219500067 GTTGGGCTGGAGTGGTAGGCGGG 0: 1
1: 0
2: 4
3: 39
4: 379
946407581_946407592 -5 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407592 2:219500023-219500045 GCCAGGGGAATGGGGGGAGGAGG 0: 1
1: 0
2: 9
3: 137
4: 1355
946407581_946407604 24 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407604 2:219500052-219500074 TGGAGTGGTAGGCGGGATGGGGG 0: 1
1: 0
2: 0
3: 26
4: 329
946407581_946407603 23 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407603 2:219500051-219500073 CTGGAGTGGTAGGCGGGATGGGG 0: 1
1: 0
2: 0
3: 23
4: 253
946407581_946407605 30 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407605 2:219500058-219500080 GGTAGGCGGGATGGGGGCAGAGG 0: 1
1: 0
2: 1
3: 70
4: 856
946407581_946407598 13 Left 946407581 2:219500005-219500027 CCCTCAAAAGGGTGAGGTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 946407598 2:219500041-219500063 GGAGGTTGGGCTGGAGTGGTAGG 0: 1
1: 0
2: 3
3: 53
4: 634

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946407581 Original CRISPR CTGGCACCTCACCCTTTTGA GGG (reversed) Exonic
900363684 1:2301822-2301844 GTGGGACCTCACCCCTGTGAAGG + Intronic
900592501 1:3466319-3466341 CTGGGACCTCAGCCTCTGGAAGG - Intronic
906507318 1:46389779-46389801 CTGTCACCTAACTCTATTGAAGG - Intergenic
906583411 1:46955150-46955172 CTGTCACCTGACTCTATTGAAGG + Intergenic
907037360 1:51228451-51228473 CTGTCACCTGACTCTATTGAAGG + Intergenic
907505614 1:54915914-54915936 CTGTCACCTGACTCTATTGAAGG - Intergenic
910591017 1:88928196-88928218 CTGTCACCTGACTCTATTGAAGG + Intergenic
912463930 1:109856330-109856352 CTGTCACCTGACTCTATTGAAGG - Intergenic
916541154 1:165755771-165755793 CTGGCACCATACCTTGTTGAAGG + Intronic
919097753 1:193058741-193058763 CAGACACCTCACCCTTGAGAAGG + Intronic
920425229 1:205869657-205869679 CTGTCACCTGACTCTATTGAAGG - Intergenic
920835079 1:209502993-209503015 GGGGCACCACACCCATTTGAGGG - Intergenic
921092620 1:211857979-211858001 CTGTCACCTGACTCTATTGAAGG + Intergenic
922684707 1:227630131-227630153 CTGTCACCTGACTCTATTGAAGG - Intronic
924216171 1:241824655-241824677 CTGGATTCTCACCCTCTTGAAGG - Intergenic
924364273 1:243274092-243274114 CTGGCATCTCACTCTGGTGAGGG + Intronic
924664829 1:246060786-246060808 CTGTCTCCTCAGACTTTTGATGG - Intronic
1066076932 10:31888195-31888217 CTGGCACCTCTCCCTTATTCTGG + Intronic
1066303495 10:34117390-34117412 CTGTCAGCTCACCCTTCCGATGG + Intronic
1067188551 10:44050772-44050794 CTGAAACCTCACTCTTTTCAAGG - Intergenic
1068791842 10:61037833-61037855 CTGTCACCTGACTCTATTGAAGG - Intergenic
1071269957 10:83997984-83998006 CTACCATCTCATCCTTTTGATGG - Intergenic
1072471938 10:95721099-95721121 CTGTCACCTGACTCTATTGAAGG - Intronic
1072674090 10:97452635-97452657 CTGACACCTCATCCTTAGGATGG + Intronic
1073320859 10:102615555-102615577 CAGGCACCTCACCCTCATCAGGG - Intronic
1073755031 10:106572447-106572469 CTGGCACAGCACCCCTTTCATGG - Intergenic
1074492908 10:113955195-113955217 CTGGCCCCTCTCCCCTGTGAGGG + Intergenic
1075832568 10:125423862-125423884 CAGGAACCTCACCCTTCTGGGGG - Intergenic
1079601335 11:22315821-22315843 CTGTCACCTGACTCTATTGAAGG - Intergenic
1079933757 11:26594032-26594054 CTGTCACCTGACTCTATTGACGG - Intronic
1080777337 11:35398200-35398222 CTGGCCCCTCTCACTTTTGAAGG + Intronic
1084313687 11:68331501-68331523 CTGGCCCATCTCCCTGTTGAGGG + Intronic
1085114229 11:73916153-73916175 ATGTCACTTCAACCTTTTGAAGG - Intronic
1085857805 11:80195797-80195819 CTGGAACCCCAACCCTTTGATGG + Intergenic
1090577949 11:128129374-128129396 CAAGCACCTCACTCTTTTTAAGG - Intergenic
1090662431 11:128891568-128891590 CTGGAACCTCTCCCTGTTGTGGG - Exonic
1092070838 12:5630066-5630088 CTGACACCTCAGCCTCTTGAGGG + Intronic
1092294054 12:7184221-7184243 CTGTCACCTGACTCTGTTGAAGG + Intergenic
1095138955 12:38639506-38639528 CTCTCACCTGACTCTTTTGAAGG + Intergenic
1095283905 12:40387286-40387308 CTGTCACCTGACTCTATTGAAGG + Intergenic
1097065331 12:56316298-56316320 CCGGCAGCGCACCGTTTTGAAGG - Exonic
1097377281 12:58855989-58856011 CTGTCACCTGACTCTATTGAAGG - Intergenic
1097659292 12:62411278-62411300 CTGGCTCCTCACTTTTTAGATGG + Intronic
1101224153 12:102670964-102670986 CTCGCACCTCTCCCTTTTTATGG - Intergenic
1101797886 12:107992738-107992760 CTGCCTCCTCAGCCTCTTGAGGG - Intergenic
1103803030 12:123551892-123551914 CTGTCACCTGACTCTATTGAAGG + Intergenic
1106419306 13:29572358-29572380 CTGGCACCTGCCCCTTTAGGTGG - Intronic
1106993560 13:35453033-35453055 CTGCCACCTCAACCTTGTGTGGG - Intronic
1107026308 13:35805161-35805183 CTGGCACCTCACCAGTTAGAAGG + Intronic
1108876660 13:55057375-55057397 CTGTCACCTGACTCTATTGAAGG + Intergenic
1109931734 13:69225227-69225249 CTGTCACCTGACTCTATTGAAGG + Intergenic
1110871657 13:80459425-80459447 CTGACACTTCACCCTCTGGACGG + Intergenic
1111806164 13:93042508-93042530 CTGTCACCTGACTCTATTGAAGG + Intergenic
1112099297 13:96169546-96169568 CTGGCTCCCCACACCTTTGAGGG - Intronic
1113115897 13:106874593-106874615 CCGGAACTACACCCTTTTGAAGG - Intergenic
1121261036 14:92566346-92566368 CAGACACCTCACCCATTCGAAGG + Intronic
1126908992 15:53398894-53398916 CAGGCACCTTCCCCTTTTGAGGG - Intergenic
1137475361 16:48803482-48803504 CTGGCTCCTGTCACTTTTGATGG - Intergenic
1140809570 16:78564482-78564504 CTGCCACCTGATCCTTGTGAGGG - Intronic
1144214009 17:13038787-13038809 CTGGCACCTCACCCTTCTCTTGG + Intergenic
1149274108 17:55015097-55015119 CTGTCACCTGACTCTATTGAAGG - Intronic
1149953039 17:61012259-61012281 CTGTCACTTCACACTTTTGGAGG - Intronic
1151424424 17:74021510-74021532 CTGGCTCCTCACCACTTGGAAGG - Intergenic
1153401525 18:4688339-4688361 CTGTCACCTGACTCTATTGAAGG + Intergenic
1153601927 18:6789214-6789236 TTGGCACCTCAGCCTTTGCATGG + Intronic
1154050243 18:10948759-10948781 CTGTCAACTCACACTTATGATGG + Intronic
1155885855 18:31207151-31207173 CAGGCACCTCCCTCTTTTTATGG + Intergenic
1157533947 18:48444794-48444816 TGTGCACCTCACCCTTTTAAAGG - Intergenic
1164057334 19:21632848-21632870 CTGTCACCTGACTCTATTGAAGG + Intergenic
1164323161 19:24168614-24168636 CTGTCACCTGACTCTATTGAAGG - Intergenic
1164567448 19:29337507-29337529 CTGCCACTTCACCCTGTTCAAGG + Intergenic
1166998193 19:46729839-46729861 CAGTCTCCTCACCCTTTAGATGG - Intronic
924974161 2:157652-157674 CTGTCACCTGACTCTTTTGAAGG - Intergenic
933175278 2:79166846-79166868 CTGTCACCTGACTCTTTTGAAGG - Intergenic
935748668 2:106211646-106211668 CTGTCACCTGACTCTATTGAAGG + Intergenic
936387320 2:112041828-112041850 CTGTCACCTGACTCTATTGAAGG - Intergenic
939171688 2:138703442-138703464 GTGGCACCTCTGCCTTTAGAAGG - Intronic
939399713 2:141676189-141676211 CTGCCACCCCACTATTTTGAGGG + Intronic
939493671 2:142904142-142904164 CTGTCACCTGACTCTGTTGAAGG - Intronic
944812243 2:203339170-203339192 CTGTCACCTCACACTTGTTAGGG + Intronic
946407581 2:219500005-219500027 CTGGCACCTCACCCTTTTGAGGG - Exonic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
948651003 2:239443819-239443841 CTGCCATTTCACCCTTTTGGCGG + Intergenic
1171006733 20:21473389-21473411 CTGACATCCCCCCCTTTTGAAGG - Intergenic
1175374987 20:58518001-58518023 CTGCATCCTCACCCTTGTGATGG + Intergenic
1177263525 21:18756877-18756899 CTGTCACCTGACTCTATTGAAGG - Intergenic
1177896241 21:26858370-26858392 CTGTCACCTGACTCTATTGAAGG + Intergenic
1178410341 21:32358569-32358591 CCAGCACCTCACCATTTTCAGGG - Intronic
1179500381 21:41804902-41804924 CTGAAACCTCACCCCTTTGGTGG - Intronic
1179937514 21:44614586-44614608 CTGGCCCCTCTCCCCTCTGACGG + Intronic
1182119072 22:27775238-27775260 CTGGCCCCCCGCCCTTTCGATGG + Intronic
1184206225 22:43005437-43005459 TTGGCACCTGGCCCTTTTGTTGG - Intronic
1184365137 22:44046393-44046415 CTGGCGCCTCACCCTCATCATGG + Intronic
949899188 3:8795667-8795689 CTGGCACCTCATCATTTAGGGGG + Intronic
950458145 3:13104777-13104799 CTGGCCCCTGACCCATGTGAGGG + Intergenic
951200698 3:19873114-19873136 CTGTCACCTGACTCTATTGAAGG - Intergenic
951837853 3:27002589-27002611 CTGTCACCTGACTCTATTGAAGG + Intergenic
952922241 3:38293546-38293568 CTGTCACCTGACTCTATTGAAGG - Intronic
955390952 3:58521886-58521908 CTGCCACCCCACCCTTTAGCTGG + Intronic
957000295 3:74876522-74876544 CTGTCACCTGACTCTATTGAAGG - Intergenic
963915752 3:150857638-150857660 CTGTCACCTGACTCTGTTGAAGG + Intergenic
964491518 3:157241485-157241507 CTGGCAGCATAGCCTTTTGAGGG - Intergenic
964953413 3:162324657-162324679 CTGTCACCTGACTCTATTGAAGG + Intergenic
965054808 3:163698618-163698640 CTGTCACCTGACTCTATTGAAGG - Intergenic
966353485 3:179056128-179056150 CTGTCACCTGACTCTATTGAAGG + Intronic
967623548 3:191661891-191661913 CTGTCACCTGACTCTGTTGAAGG + Intergenic
968391191 4:194235-194257 CTGTCACCTGACTCTATTGAGGG - Intergenic
972494118 4:39616807-39616829 CTGGGAACTAACCTTTTTGAAGG - Intronic
972781362 4:42289474-42289496 CTGTCACCTGACTCTATTGAAGG - Intergenic
974391997 4:61283135-61283157 CTGGCAGATCACACTTTAGAAGG + Intronic
974673829 4:65064940-65064962 CTGGTATCTCACCCTTTGAAGGG - Intergenic
975811015 4:78169614-78169636 CTAGCATCTCATCCATTTGAGGG - Intronic
976464729 4:85354307-85354329 CTGTCACCTGACTCTATTGAAGG - Intergenic
978586816 4:110282892-110282914 CTGCCACCTGACTCTATTGAAGG - Intergenic
979820420 4:125163087-125163109 CTGGCACCTGTCCCTAGTGAAGG + Intergenic
983330545 4:166322304-166322326 CTTGCACCTCAGCCTATAGATGG - Intergenic
983667031 4:170193903-170193925 CTGTCACCTGACTCTATTGAAGG - Intergenic
984088938 4:175346373-175346395 CTGACAACTCACCCTGTTAAAGG - Intergenic
984723733 4:183000693-183000715 CTGTCACCTGACTCTATTGAAGG + Intergenic
988957189 5:36331554-36331576 CTGTCACCTGACTCTATTGAAGG - Intergenic
996668275 5:126086447-126086469 CTGTCACCTCACACTTGTTAGGG + Intergenic
999487987 5:152019020-152019042 GTAGCACCTCTCCCTGTTGAAGG + Intergenic
1002692587 5:181060448-181060470 CTGGCTCCCTACCCTTTTGCCGG - Exonic
1005323678 6:24679406-24679428 CTGTCACCTGACTCTATTGAAGG - Intronic
1007047705 6:38794275-38794297 CTAGCCTCTCACCCTTGTGAGGG + Intronic
1008582383 6:52918670-52918692 CTGTCACCTGACTCTCTTGAAGG - Intergenic
1011203310 6:84862394-84862416 CTGGCATCTCACTTTATTGATGG + Intergenic
1011539874 6:88417854-88417876 CTGTCACCTGACTCTATTGAAGG - Intergenic
1011845590 6:91560130-91560152 CTGGAAGCTCACCCTTTGCATGG - Intergenic
1013543529 6:111134363-111134385 CTGTCACCTGACTCTATTGAAGG + Intronic
1018687506 6:166315452-166315474 CTGTCACCTGACTCTATTGAAGG + Intergenic
1018761033 6:166894574-166894596 CTGTCACCTGACTCTATTGAAGG + Intronic
1019609869 7:1930948-1930970 CTGCCATCTCACCCTTTGCAGGG + Intronic
1023367194 7:39475670-39475692 CTAGCACCTCTCCCTTGTCACGG + Intronic
1023439311 7:40169924-40169946 CTGTCACCTGACTCTATTGAAGG - Intronic
1027164306 7:75823641-75823663 CTGGGACCACACCCTTTCCAGGG - Intergenic
1028147877 7:87338729-87338751 ATGGCACATAACACTTTTGAAGG + Intergenic
1028377649 7:90162979-90163001 CTGGCACATCACTCTTCTTATGG - Intronic
1028556959 7:92134913-92134935 GTGGCACCTCACCCTTCTCCGGG + Intronic
1028588598 7:92474328-92474350 CTGTCACCTGACTCTTCTGAAGG - Intronic
1030337283 7:108340792-108340814 CTGTCACCTGACTCTATTGAAGG + Intronic
1031458174 7:122010622-122010644 CTGCCACCTCACACTGTGGAAGG + Exonic
1031708460 7:125013125-125013147 CTTGCACATCACCCTTTTATTGG - Intergenic
1032426105 7:131823304-131823326 CTGTCACCTGACTCTATTGAAGG - Intergenic
1032725818 7:134589381-134589403 CTGTCACCTGACTCTATTGAAGG + Intergenic
1033476199 7:141695721-141695743 CTGGCACCTCCTCTCTTTGATGG - Intronic
1033608035 7:142941691-142941713 CTGGCACCTGAGTCTGTTGAGGG + Intronic
1034249175 7:149674724-149674746 CTGTCACCTGACTCTATTGAAGG + Intergenic
1037570985 8:20157617-20157639 CTGTCACCTGACTCTATTGAAGG + Intronic
1038397954 8:27260990-27261012 CTGGCACCTCACCCTATTTTAGG + Intergenic
1041663881 8:60423974-60423996 CTGTCACCTGACTCTATTGAAGG - Intergenic
1042921435 8:73923850-73923872 CTGTCATCTCAGCATTTTGAGGG - Intergenic
1047443892 8:124902627-124902649 CTGTCACCTAACTCTATTGAAGG - Intergenic
1048535114 8:135286127-135286149 CTTCCACCTCACCCTCCTGAAGG - Intergenic
1049375915 8:142289098-142289120 CTGGCAGCTCACCCTTCTGCAGG - Intronic
1050120538 9:2302908-2302930 GTGGCACCTCATGCTTTTTAGGG + Intergenic
1052064800 9:24005031-24005053 CTCCCACCTCAGCCTTTTAAAGG - Intergenic
1052538526 9:29777708-29777730 CTGTCACCTGACTCTATTGAAGG - Intergenic
1056691512 9:88812222-88812244 GTGGGACCTTCCCCTTTTGAGGG + Intergenic
1057139608 9:92718527-92718549 CTGGCACCTCACCTGCTTGTTGG + Exonic
1058923855 9:109642665-109642687 CTCCCACCTCAGCCTTCTGATGG + Intronic
1061078986 9:128358840-128358862 GTGGCCTCTCACCCTTTGGAAGG + Intronic
1187260673 X:17682650-17682672 CTGTCACCTCCCCCTTCTTAAGG + Intronic
1188272647 X:28159680-28159702 CTCTCACCTCATCCCTTTGATGG - Intergenic
1190295231 X:49022688-49022710 CTCCCACCTCAGCCTTTTGTTGG + Intergenic
1191167103 X:57402600-57402622 CTGTCACCTGACTCTATTGAAGG - Intronic
1192939985 X:75901964-75901986 CTGTCACCTGACTCTATTGAAGG - Intergenic
1193171981 X:78347427-78347449 CTGTCACCTGACTCTATTGAAGG - Intergenic
1199496716 X:148460247-148460269 CTGGAACCTCACCCTTCTGGGGG + Intergenic
1199645990 X:149912432-149912454 CTGCAACCTCCACCTTTTGAGGG - Intergenic
1200180909 X:154150219-154150241 GTGGCAACTCACCCCCTTGAGGG - Intronic
1200186552 X:154187333-154187355 GTGGCAACTCACCCCCTTGAGGG - Intergenic
1200192204 X:154224471-154224493 GTGGCAACTCACCCCCTTGAGGG - Intronic
1200197959 X:154262275-154262297 GTGGCAACTCACCCCCTTGAGGG - Intronic
1200237146 X:154473147-154473169 CTGGCACCTCACCCTTGCCATGG + Exonic
1200851601 Y:7889149-7889171 CTGTCACCTGACTCTATTGAAGG - Intergenic
1201477772 Y:14402202-14402224 CTGGAATGTCACCCTTTTGGTGG - Intergenic
1202257063 Y:22932429-22932451 CTGGCAGTTCTCCCTTTTAAAGG + Intergenic
1202410054 Y:24566177-24566199 CTGGCAGTTCTCCCTTTTAAAGG + Intergenic
1202460728 Y:25103895-25103917 CTGGCAGTTCTCCCTTTTAAAGG - Intergenic