ID: 946410301

View in Genome Browser
Species Human (GRCh38)
Location 2:219512183-219512205
Sequence AACTGGGTATAAGGGGCATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946410301_946410311 11 Left 946410301 2:219512183-219512205 CCGCATGCCCCTTATACCCAGTT 0: 1
1: 0
2: 1
3: 8
4: 130
Right 946410311 2:219512217-219512239 TCTTTCCTTATAGAGGTTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 194
946410301_946410309 4 Left 946410301 2:219512183-219512205 CCGCATGCCCCTTATACCCAGTT 0: 1
1: 0
2: 1
3: 8
4: 130
Right 946410309 2:219512210-219512232 CCCGATTTCTTTCCTTATAGAGG 0: 1
1: 0
2: 0
3: 13
4: 128
946410301_946410313 30 Left 946410301 2:219512183-219512205 CCGCATGCCCCTTATACCCAGTT 0: 1
1: 0
2: 1
3: 8
4: 130
Right 946410313 2:219512236-219512258 AAGGCATCCTGCCTACCCTCAGG 0: 1
1: 0
2: 2
3: 13
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946410301 Original CRISPR AACTGGGTATAAGGGGCATG CGG (reversed) Intergenic
901230622 1:7640032-7640054 AACTGGGAACCACGGGCATGAGG - Intronic
901718381 1:11175291-11175313 ATCTGGGTATCAGGGGCAGAAGG + Intronic
907064728 1:51469635-51469657 AATTGGGTATGAAGGGTATGGGG - Intronic
907995477 1:59627034-59627056 ATCGGGGTATCAGGGACATGAGG - Intronic
910574001 1:88737698-88737720 GTCTGGGGTTAAGGGGCATGGGG + Intronic
912501202 1:110123141-110123163 AGCTGGGTACAAGGTGCATAGGG + Intergenic
912963130 1:114213660-114213682 CACTGGGTATTAGGGGTAAGAGG + Intergenic
916927383 1:169537062-169537084 CACTGGGTATAAGTGCCATGAGG + Intronic
920592357 1:207232443-207232465 ACTTGGCTATAACGGGCATGGGG + Intergenic
920999995 1:211034574-211034596 AGCTGGGTAAAAGGCCCATGGGG + Intronic
922738805 1:228004568-228004590 AGCTGGGTGTCAGGGGCCTGAGG - Intergenic
923539543 1:234878065-234878087 AACTGGGTAAAGGGGACATATGG - Intergenic
1063036052 10:2288033-2288055 ACCTGGGTCTAAGGGCCAAGTGG - Intergenic
1064538603 10:16383648-16383670 AACTGGGAAGAAAGGGAATGTGG + Intergenic
1065367954 10:24952976-24952998 ATCTGGGAATCAGGGGCCTGGGG - Intergenic
1065625653 10:27625994-27626016 AAATGGAAATGAGGGGCATGGGG + Intergenic
1066413845 10:35200620-35200642 ATCTGGGTATTAGGAGCAGGTGG + Intronic
1070424729 10:76274342-76274364 ATCTGGCTATAATGGGCCTGGGG + Intronic
1071161567 10:82752301-82752323 AACTGGGTAAATGGGGGATAAGG - Intronic
1074248168 10:111714657-111714679 CACAGGGTACAGGGGGCATGGGG + Intergenic
1075213347 10:120510658-120510680 AACTGGGTAAAGGAGGAATGAGG - Intronic
1076313721 10:129526302-129526324 AACAGGGAATAAGGGGCATTGGG - Intronic
1077661975 11:4077682-4077704 AACTGAGCATAAGAGACATGTGG - Intronic
1079318317 11:19429013-19429035 ACCTGGGGAGAAGGGGAATGGGG + Intronic
1081562611 11:44231736-44231758 AATTGGGTATACTGGGGATGAGG - Intronic
1083059275 11:59852622-59852644 AACTGGGTAAAATGGGGATAAGG - Intergenic
1086725957 11:90184695-90184717 AACTGGGTGTAGGGGGCAAGGGG - Intronic
1090364267 11:126192932-126192954 AGTTGGCTTTAAGGGGCATGTGG - Intergenic
1090926058 11:131251374-131251396 AAATGGATATTTGGGGCATGAGG + Intergenic
1091458027 12:622625-622647 AACTGGGTGTCAGGGGAATTTGG - Intronic
1094280604 12:28733336-28733358 AACTGGAGACAAAGGGCATGAGG + Intergenic
1101370903 12:104129463-104129485 TACTTGGTATAAGAAGCATGCGG + Intronic
1103702267 12:122854022-122854044 AACTGTGCAAAAGGGGCAGGAGG - Exonic
1106017003 13:25879042-25879064 TACTTGGTCTATGGGGCATGTGG + Intronic
1118981799 14:70723114-70723136 AACTGTGTATCAAAGGCATGTGG + Intronic
1119040902 14:71273769-71273791 GACTGGGGATAAAGAGCATGAGG - Intergenic
1123067349 14:105625342-105625364 ACCTGGGCATGATGGGCATGGGG + Intergenic
1125343532 15:38697067-38697089 ATGTTGGTATAAGGGGCATGGGG - Intronic
1125482565 15:40090742-40090764 GACTGGGGATAAGGGGGAAGAGG + Exonic
1126657133 15:50990825-50990847 AACTGGCAAAAAGGGGCAGGAGG - Intronic
1127900560 15:63338054-63338076 AACTGGGCATCAGGGGAAAGGGG - Intronic
1130440456 15:83947534-83947556 AACAGGCTACAAGGGGTATGTGG - Intronic
1130680094 15:85989131-85989153 AGCTGGGTCTAAGGGCCCTGTGG + Intergenic
1136632171 16:31495350-31495372 AACTGGGGATCAGGGACCTGGGG + Intronic
1137423838 16:48359731-48359753 AACTGGTTATAATGTGCTTGTGG - Intronic
1139504013 16:67390100-67390122 GCCTGGGTCTAAGGGGCACGTGG - Exonic
1139915721 16:70427313-70427335 GACTGGGTTTGAGGGGCTTGAGG - Intronic
1141239420 16:82251337-82251359 GCCTGGGGATAAGGGGGATGGGG - Intergenic
1143371061 17:6439771-6439793 GACAGGGTATAAGGGGCATGGGG - Intergenic
1148035024 17:44653789-44653811 AACTGGGAGAAGGGGGCATGGGG + Intergenic
1149482577 17:57015801-57015823 AGCTAGGTAGAAGGGGCAGGAGG - Intergenic
1150319944 17:64204919-64204941 AACTGGGTGTCAGGCACATGGGG + Intronic
1150779343 17:68107560-68107582 CACTGGGTATGAGTGGCAAGAGG + Intergenic
1152409680 17:80117162-80117184 AACTGGGTGGAGGGGGCAGGTGG - Intergenic
1155178216 18:23320167-23320189 AACTGAGCATAAGAGACATGAGG - Intronic
1157335329 18:46733610-46733632 AAAGGGGGATAAGGGGCTTGGGG + Intronic
1157367407 18:47078226-47078248 AGATGGGTGTGAGGGGCATGAGG - Intronic
1157967998 18:52230815-52230837 AACTGGAGATAAGGTGCAGGTGG + Intergenic
1158226126 18:55203532-55203554 AACTGGACACAAGGGGCATTTGG + Intergenic
1160175677 18:76592258-76592280 AACAGGGGATGAGGGGGATGAGG - Intergenic
1162110468 19:8397187-8397209 TTCTGGGTATGAGGGGCCTGGGG + Intronic
1166215573 19:41332334-41332356 ACCTGGGGAGGAGGGGCATGTGG - Intronic
926847796 2:17161104-17161126 AAGTGGCAATTAGGGGCATGTGG - Intergenic
929879647 2:45824689-45824711 AACTGGGTGGTAGAGGCATGAGG - Intronic
932443988 2:71760715-71760737 AACTGGGTAAAGGGTACATGGGG + Intergenic
934530946 2:95088367-95088389 AGCTGGGTAACAGGGCCATGGGG + Intronic
935353917 2:102180401-102180423 ACCTGGGGAGAAGGGGCAGGTGG + Intergenic
937709512 2:124963019-124963041 AACTGGGTAAACGGTGCATAGGG + Intergenic
938161929 2:128993655-128993677 AACTGGGAAGAAGGTGGATGAGG + Intergenic
938802850 2:134778610-134778632 ACCTGGGTATAGGTGGCAGGTGG - Intergenic
939409438 2:141805084-141805106 AATGGGTTATATGGGGCATGGGG - Intronic
939463233 2:142525349-142525371 AACTGGGCATAAGGTATATGGGG - Intergenic
940281819 2:151996995-151997017 CACAGGGTATAAGGGCCAAGGGG + Intronic
942188267 2:173445377-173445399 CAATGGGTCTAAGGGTCATGGGG + Intergenic
942670254 2:178367720-178367742 AAATGTGCATAAGGGACATGAGG + Intronic
945148120 2:206760076-206760098 AACTGATTATAGGGAGCATGTGG + Intronic
946410301 2:219512183-219512205 AACTGGGTATAAGGGGCATGCGG - Intergenic
947100260 2:226613223-226613245 CAGTGGGCATGAGGGGCATGTGG - Intergenic
1170144611 20:13159314-13159336 AACTGAGTTTAAGAGGAATGGGG - Intronic
1170145521 20:13169744-13169766 AGCTGGGTAATAGGTGCATGTGG - Intergenic
1173590422 20:44220665-44220687 ATCTGGGTATAAGGGGGCAGTGG + Intergenic
1175791550 20:61743448-61743470 CAGTGGGCATGAGGGGCATGAGG - Intronic
1180241720 21:46511881-46511903 AACTTTGTATAAGGGGAATCAGG + Intronic
1181992296 22:26846839-26846861 AACTGGGTGGAGGGGGGATGTGG - Intergenic
1183089158 22:35509620-35509642 TACTGGCTAGCAGGGGCATGTGG - Intergenic
1185284460 22:49994125-49994147 ACCTGGAGATCAGGGGCATGGGG - Intergenic
954617009 3:51974311-51974333 AGCTGGGGATAAGGGGGATGGGG - Intronic
955198950 3:56832152-56832174 AAATGGGCCCAAGGGGCATGGGG - Intronic
957224437 3:77425584-77425606 GACTGGGTATGAGGAGGATGGGG + Intronic
958945151 3:100354175-100354197 GACTGGGTAGAAGTGGCATGGGG - Intronic
962735466 3:138321697-138321719 AGCTGGGTATAGGAGGAATGAGG + Intronic
965110851 3:164420302-164420324 ACCTGGCTATGAGGAGCATGAGG + Intergenic
970124383 4:12792760-12792782 AACTGCGTATATGGGGTAGGAGG + Intergenic
971082721 4:23233357-23233379 AAAAGGGTATAAGAAGCATGGGG - Intergenic
976688716 4:87845228-87845250 AACTGGGAATAAAGGGTTTGAGG + Exonic
979667200 4:123325384-123325406 AAATTGGTAGAAGGGGCTTGTGG - Intergenic
980546779 4:134274043-134274065 AACTTGGTAGAATGGGAATGAGG + Intergenic
982199019 4:152942067-152942089 GACTGTGTATAAGGGACATGTGG + Intronic
984650948 4:182269968-182269990 AAGTGGGGATAAGGAGCATTGGG + Intronic
984842807 4:184083514-184083536 TACTGGGGAGAAGGGGCTTGTGG + Intergenic
988334425 5:29887472-29887494 AGCTGGGTATAAGGAGGTTGGGG + Intergenic
989197205 5:38727160-38727182 GACTGGGGAGAAGGGGCCTGGGG + Intergenic
989608735 5:43271566-43271588 AACTGGGTAAATGGTACATGTGG - Intronic
991687576 5:69195835-69195857 AAATGGGTATGAGGGGAAAGTGG + Intronic
994674578 5:102804456-102804478 AACTGGATTTAAGGGTGATGGGG + Intronic
997700938 5:135898960-135898982 AACTTGGTTTAAGTGGCATCCGG + Intergenic
998044060 5:138972095-138972117 AGCTGGGGATAAGGGTTATGGGG + Intronic
999898425 5:156060556-156060578 GACTGGTTATAATGGGAATGGGG + Intronic
1001619023 5:173066613-173066635 AACTGAACAAAAGGGGCATGAGG - Intronic
1003045661 6:2730670-2730692 AACAGGGTATGAGGGGGCTGTGG - Intronic
1003500798 6:6701206-6701228 AACTGGGGAGAGGGGGCTTGGGG - Intergenic
1003950207 6:11109442-11109464 AATTGGGTAGAAGGGGCAATGGG + Intronic
1004176228 6:13342515-13342537 AGCTGGGTATGGGGGGCATTAGG + Intergenic
1005822677 6:29610659-29610681 AACTGGGGATTAGAGGCAGGGGG - Intronic
1005999665 6:30955401-30955423 AAGGGTGTATAAGGGGGATGGGG + Intergenic
1009649345 6:66453107-66453129 AAATATGTCTAAGGGGCATGAGG - Intergenic
1016257221 6:142122012-142122034 AACTGGGAATGAGAGGCATGTGG - Intergenic
1017521718 6:155208612-155208634 GACTGGGTAGATGGGGAATGCGG - Intronic
1019788009 7:2991528-2991550 AACTGAGCAGGAGGGGCATGAGG + Intronic
1020254003 7:6491589-6491611 AACTTTGTAGAAGAGGCATGGGG + Intergenic
1021774733 7:24041596-24041618 AACTGGGTAAAGGGCACATGAGG - Intergenic
1028067657 7:86407428-86407450 TACAGGGTATAAGTAGCATGTGG + Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038967762 8:32594524-32594546 AACTGGGTAATACGGACATGTGG - Intronic
1039382682 8:37100609-37100631 CACTGGGTAGAAGAAGCATGAGG - Intergenic
1044980495 8:97711530-97711552 AACTGGGTAAAAGGGGTACAGGG - Intronic
1048404066 8:134101231-134101253 AACTTGGTATGGGAGGCATGTGG + Intergenic
1049924165 9:392835-392857 AGCAGGATATAAAGGGCATGGGG - Intronic
1058972117 9:110093346-110093368 AGATGGGTAGATGGGGCATGAGG + Intronic
1059462176 9:114439145-114439167 GAATGGGTAGAAGGGACATGGGG + Intronic
1061504735 9:131025453-131025475 AGCTGGGTGTCGGGGGCATGTGG + Intronic
1062464293 9:136674335-136674357 AACTGGCTGGAAGGGGCAAGAGG + Intronic
1187242714 X:17528163-17528185 AACTGGAGAAAAGGGGCATCTGG + Intronic
1189920920 X:45902507-45902529 ATCTGGGGGTAAGGGGCATTGGG + Intergenic
1193353525 X:80489482-80489504 AACTTGGTATGAGTGACATGTGG - Intergenic
1196185381 X:112739831-112739853 ACCTGGGGAAAAGGGGTATGGGG + Intergenic
1197604882 X:128574047-128574069 AACTTGGAATATGAGGCATGAGG - Intergenic
1198111771 X:133508518-133508540 AAGTGGTTAGGAGGGGCATGAGG + Intergenic
1198181110 X:134210105-134210127 AACTGGGTAAAGGGTACATGGGG + Intergenic
1198182842 X:134226287-134226309 AACTGGGTAAAGGGTACATGGGG + Intergenic