ID: 946410839

View in Genome Browser
Species Human (GRCh38)
Location 2:219514466-219514488
Sequence TCTCCTCGATCGTCTCCTTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946410839_946410841 -3 Left 946410839 2:219514466-219514488 CCACAAGGAGACGATCGAGGAGA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 946410841 2:219514486-219514508 AGAGAGACAAGCGGCAGCAGAGG 0: 1
1: 1
2: 5
3: 28
4: 392
946410839_946410846 29 Left 946410839 2:219514466-219514488 CCACAAGGAGACGATCGAGGAGA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 946410846 2:219514518-219514540 CAGAGGCAGCACCAGGGCTGCGG 0: 1
1: 3
2: 10
3: 107
4: 719
946410839_946410843 12 Left 946410839 2:219514466-219514488 CCACAAGGAGACGATCGAGGAGA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 946410843 2:219514501-219514523 AGCAGAGGCAGCAGCGGCAGAGG 0: 1
1: 1
2: 42
3: 286
4: 1396
946410839_946410845 23 Left 946410839 2:219514466-219514488 CCACAAGGAGACGATCGAGGAGA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 946410845 2:219514512-219514534 CAGCGGCAGAGGCAGCACCAGGG 0: 1
1: 0
2: 5
3: 61
4: 638
946410839_946410842 6 Left 946410839 2:219514466-219514488 CCACAAGGAGACGATCGAGGAGA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 946410842 2:219514495-219514517 AGCGGCAGCAGAGGCAGCAGCGG 0: 1
1: 4
2: 40
3: 273
4: 1319
946410839_946410844 22 Left 946410839 2:219514466-219514488 CCACAAGGAGACGATCGAGGAGA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 946410844 2:219514511-219514533 GCAGCGGCAGAGGCAGCACCAGG 0: 1
1: 0
2: 14
3: 133
4: 1119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946410839 Original CRISPR TCTCCTCGATCGTCTCCTTG TGG (reversed) Exonic
901928259 1:12580615-12580637 TCTCCTCCGTCGTCTCCTTCAGG + Exonic
907868750 1:58423935-58423957 TCTCTTAGATCCTTTCCTTGGGG - Intronic
911010797 1:93278979-93279001 TCTTCTCCATTGTCTCCTTTTGG + Intergenic
923384719 1:233454745-233454767 TCTCCAGGCTGGTCTCCTTGAGG + Intergenic
1064323595 10:14328807-14328829 TATCCTCCATCGTCTACCTGTGG - Intronic
1081201136 11:40216628-40216650 TCTCCTGGATCTTTTTCTTGCGG - Intronic
1083911310 11:65711914-65711936 AGTCCTCGGGCGTCTCCTTGTGG - Intergenic
1086349940 11:85935153-85935175 TCACCTTGATGGTCTCCATGGGG - Intergenic
1090586812 11:128222014-128222036 TCTCCTGTATTGTCTCCTTGAGG + Intergenic
1093974768 12:25409308-25409330 TCTTCTCCATTGTCTCCTTTTGG + Intronic
1096616889 12:52838320-52838342 TCTCCTCCTTCCTCTCCTTCAGG - Intronic
1102657823 12:114497780-114497802 TCTCCTCAATAGTCCCATTGTGG + Intergenic
1103901503 12:124305965-124305987 AGTCCTCGATCCTCTCCCTGTGG + Intronic
1103913881 12:124366196-124366218 TCTCCTCATTCGTCTCTTGGTGG - Intronic
1110240993 13:73266618-73266640 TCTCCACGAGCTTCTACTTGTGG - Intergenic
1116675349 14:47899481-47899503 TTCCCTCGATTGTTTCCTTGAGG - Intergenic
1118234832 14:63992821-63992843 TCTCCTCCAAGGCCTCCTTGAGG - Intronic
1118837110 14:69485132-69485154 TCTCCCCGGCGGTCTCCTTGGGG - Intronic
1118845408 14:69544260-69544282 TCTCCTAAGTGGTCTCCTTGTGG + Intergenic
1120130955 14:80807435-80807457 TCTCCTCGATGTTCTATTTGAGG - Intronic
1122206757 14:100151518-100151540 TCTGCTCGTTCAGCTCCTTGGGG - Intronic
1125429373 15:39580543-39580565 TCTCCTCCACCGTCCCCGTGGGG - Intergenic
1127357184 15:58211590-58211612 TCTCCACGTTCTTCTCCATGTGG + Intronic
1133879688 16:9769024-9769046 TCACCTCGTTCTTCTCGTTGTGG + Exonic
1134205513 16:12234523-12234545 TTTTCTCGATGGTGTCCTTGAGG + Intronic
1137395150 16:48111826-48111848 TCTCCTCCATTAACTCCTTGTGG + Exonic
1139635472 16:68255791-68255813 TCTCCTCGATCATCTCGCGGAGG - Exonic
1140261285 16:73382735-73382757 ACTCCTTGATCCTTTCCTTGAGG + Intergenic
1143417084 17:6758179-6758201 GCTCCTCCATGGTTTCCTTGGGG - Exonic
1149145546 17:53487942-53487964 TCTCCTGGCTCATCTCCTTCAGG + Intergenic
1150283202 17:63941172-63941194 TCTCCTCCATGGTCTGCTTGAGG + Exonic
1155603158 18:27572632-27572654 CCTCCTATATCATCTCCTTGGGG + Intergenic
1158219424 18:55134933-55134955 TCTCCTCTGTTCTCTCCTTGAGG + Intergenic
1163516026 19:17764369-17764391 TCTCCTCGATGGTGGCCCTGGGG - Exonic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
929133617 2:38602584-38602606 CCTCCTCGTACGTCTCCCTGGGG + Exonic
930156937 2:48115369-48115391 TCTACACCTTCGTCTCCTTGAGG + Intergenic
932943452 2:76197536-76197558 TCTCTTGGATCGTTTGCTTGAGG + Intergenic
933686538 2:85146213-85146235 TCACCTCGATTTTATCCTTGAGG + Intronic
946410839 2:219514466-219514488 TCTCCTCGATCGTCTCCTTGTGG - Exonic
1169285793 20:4306098-4306120 TCTCATTGCTGGTCTCCTTGAGG - Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1185195753 22:49468336-49468358 TCTCCTCGTGCTTCTCCGTGGGG + Intronic
949873569 3:8609144-8609166 TCTCCTGTATCCTCTCCTGGTGG + Intergenic
950649719 3:14399711-14399733 TCTCCTCCTTTCTCTCCTTGGGG + Intergenic
952848828 3:37711323-37711345 TCTCCTGGATGGTTTCATTGGGG - Intronic
954342607 3:49967666-49967688 CCTCCTCGATAGTCACCATGCGG - Exonic
956446840 3:69334120-69334142 TCTTCTGGAGCCTCTCCTTGAGG - Intronic
961862490 3:129927743-129927765 TCTCCTCTGTCGTGTCCTGGCGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969267482 4:6074031-6074053 TCTCCTCCAACCTCTCCTTTGGG + Intronic
969523982 4:7694932-7694954 TCTCCTTGAGGCTCTCCTTGAGG + Intronic
970624097 4:17858394-17858416 TCTCCTCTCTCCTCTCCTTCTGG - Intronic
974036461 4:56821974-56821996 TCTTCCCCTTCGTCTCCTTGGGG - Intergenic
977511263 4:97965555-97965577 TCTCCTAGTTCGTCTACGTGGGG - Intronic
992105467 5:73447031-73447053 TCTCCTCGTCCGCCGCCTTGGGG - Exonic
1000379781 5:160618426-160618448 TCTTCTCTATCTTCTACTTGAGG + Intronic
1002711384 5:181197262-181197284 TATCCTCAATCCTCTCCCTGTGG - Intronic
1003201964 6:3969664-3969686 TCTCCCTGATCCTTTCCTTGGGG + Intergenic
1003586063 6:7390113-7390135 TCTCCTTGACCGCCCCCTTGGGG + Intronic
1008007319 6:46424642-46424664 TCTGCTCCATTGGCTCCTTGAGG - Intronic
1010957971 6:82113156-82113178 TATTCTGAATCGTCTCCTTGGGG - Intergenic
1010998090 6:82556490-82556512 TGGCCACGATGGTCTCCTTGTGG + Intergenic
1020255890 7:6503085-6503107 TCTCCTCTGTCTTCTCCTGGAGG + Exonic
1024133867 7:46386928-46386950 ATTCCTCGATCTTCTCCTGGTGG + Intergenic
1024204148 7:47140961-47140983 TCCCCTCTGTCCTCTCCTTGAGG + Intergenic
1029443483 7:100600758-100600780 TCTCCTTCATCTTCTCCGTGCGG - Exonic
1034405961 7:150902591-150902613 TCTCCTGGAGCCTCTCCTTCAGG + Intergenic
1040547264 8:48408358-48408380 TTTCCTAGATCATTTCCTTGGGG - Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1061393579 9:130331307-130331329 TCTCCTGGGTCGGTTCCTTGCGG + Intronic
1185618032 X:1435206-1435228 TCTCCCCGATCGTCCCGCTGTGG + Intronic
1186405843 X:9301589-9301611 TCTCCTCGAACGTCTTCCTGAGG - Intergenic
1192200640 X:69064500-69064522 TCTCCCCGATAGTCTGCTTTTGG - Intergenic
1198833213 X:140773313-140773335 TGTCCTCAATCGTCTTCTTCAGG - Intergenic
1200977111 Y:9224827-9224849 TCTCCTTGATCGTGTCCTACTGG - Intergenic
1202071098 Y:20992282-20992304 TCTCCTGGTTGGTCTCCTAGAGG - Intergenic