ID: 946410843

View in Genome Browser
Species Human (GRCh38)
Location 2:219514501-219514523
Sequence AGCAGAGGCAGCAGCGGCAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1726
Summary {0: 1, 1: 1, 2: 42, 3: 286, 4: 1396}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946410839_946410843 12 Left 946410839 2:219514466-219514488 CCACAAGGAGACGATCGAGGAGA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 946410843 2:219514501-219514523 AGCAGAGGCAGCAGCGGCAGAGG 0: 1
1: 1
2: 42
3: 286
4: 1396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946410843 Original CRISPR AGCAGAGGCAGCAGCGGCAG AGG Exonic
900139288 1:1132765-1132787 AGAGAAGGCAGCAGCGGGAGAGG - Intergenic
900651365 1:3731581-3731603 TGCAGAGGCAGTAGCTGGAGGGG + Intronic
900661072 1:3784019-3784041 AGCAGAGGAAGCAGAAGAAGCGG - Exonic
900675104 1:3880547-3880569 GGCAGACCCAGCAGCGGCAGAGG - Intronic
900895299 1:5479114-5479136 AGCAGCAGCAGCAGCAGCACAGG - Intergenic
900987025 1:6079026-6079048 TGCAGGGGAAGCCGCGGCAGGGG + Intronic
901026226 1:6280044-6280066 AGCAGACGCCGCGGGGGCAGGGG + Intronic
901060675 1:6470575-6470597 GGCAGCGGCAGGAGCGGCAGCGG - Exonic
901238723 1:7680869-7680891 AGCAGCAGCAGCAGCTGCTGCGG + Intronic
901246113 1:7732555-7732577 AGTGGAGGCGGCAGCGGGAGCGG + Exonic
901429145 1:9201843-9201865 GGCAGAGGCAGCAGCGGCAGAGG - Intergenic
901429146 1:9201849-9201871 AGCAGCGGCAGAGGCAGCAGCGG - Intergenic
901509599 1:9710204-9710226 AGAAGAGGCAGCTGAGGCCGTGG + Intronic
901736440 1:11315347-11315369 AGCAGCAGCAGCAGCAGCACAGG + Intergenic
901837675 1:11934786-11934808 AGCAGGGCCAGTAGCAGCAGGGG - Exonic
901878124 1:12178704-12178726 GGCAGAGGCAGCAGCAGTACGGG + Intronic
902044380 1:13513878-13513900 GGGAGAGGCGGGAGCGGCAGGGG + Exonic
902200708 1:14831337-14831359 AGCAGCAGCAGCAGCAGCAGAGG - Intronic
902429546 1:16352435-16352457 AGCAGCAGCAGCTGCGGCGGCGG - Exonic
902504443 1:16930185-16930207 AGCTGGAGCAGCAGCGGCTGAGG + Exonic
902585851 1:17438360-17438382 AGCAGCGGCGGCGGCAGCAGCGG - Exonic
902585852 1:17438369-17438391 TGCAGTAGCAGCAGCGGCGGCGG - Exonic
902594906 1:17502718-17502740 AGCACAGGCAGCTGGGGCACAGG - Intergenic
902711819 1:18245733-18245755 AGCAGCAGCAACAGCAGCAGAGG - Intronic
902791273 1:18769853-18769875 AGCAGATGCAGAATCGGGAGTGG - Intergenic
902795227 1:18796416-18796438 AGATGAGGCAGCAGAGACAGAGG - Intergenic
903115517 1:21176248-21176270 AGCAGCGGCGGCGGCGGCGGCGG - Exonic
903115520 1:21176257-21176279 GGCGGCGGCAGCAGCGGCGGCGG - Exonic
903523796 1:23976747-23976769 AGAAGAGACAGCAGCAGCAGAGG + Intronic
903813359 1:26046824-26046846 AGGGGTGGCAGCAGTGGCAGTGG - Intergenic
903846764 1:26283552-26283574 AGCAGGGGCAGGAGTGGCAGTGG + Intronic
903875142 1:26468923-26468945 GGAAGAGGCAGCAGCTGGAGAGG + Exonic
903917291 1:26773696-26773718 AGCAGCAGCAGCAGCAGCAACGG + Exonic
903925242 1:26826943-26826965 CGCTGGAGCAGCAGCGGCAGCGG + Exonic
903925243 1:26826949-26826971 AGCAGCAGCGGCAGCGGCAGCGG + Exonic
903925244 1:26826955-26826977 AGCGGCAGCGGCAGCGGCAGCGG + Exonic
904028861 1:27521552-27521574 ATCAGCAGCAGCAGCAGCAGGGG - Intergenic
904045138 1:27604125-27604147 CGCAGAGGCAGCGGCGGCGGCGG - Intronic
904093093 1:27958791-27958813 AGCAGGGCCATCAGCAGCAGCGG - Exonic
904360566 1:29968715-29968737 AGCAGAGGCAGCAGGAGGTGGGG + Intergenic
904500101 1:30908468-30908490 AGCAGCAGCAGCAGCAGCGGTGG + Exonic
904642024 1:31938225-31938247 AGCGGCGGCAGCGGAGGCAGCGG - Exonic
904712972 1:32444898-32444920 AGCAGAGTCAGGAGGGACAGAGG + Intergenic
904720089 1:32500930-32500952 CGCAGAGACAGCAGCCGCCGGGG + Intronic
904802313 1:33102374-33102396 AGCTGAGTGAGCAGGGGCAGTGG - Intronic
904807198 1:33140477-33140499 AGCAGAGGAAGCAGGCACAGGGG + Intergenic
905104902 1:35558428-35558450 AGCAGCAGCAGCAGCGGCGGCGG - Intronic
905210977 1:36374034-36374056 AGGAAAGGCAGCGGTGGCAGAGG - Intronic
905280029 1:36843127-36843149 AGAAGAGGCAGAAGAGCCAGTGG + Intronic
905352215 1:37355869-37355891 AGCATGGGCAGCAGAGGCTGTGG - Intergenic
905732175 1:40304737-40304759 AGCAGTGCCAGCTGCCGCAGAGG + Intronic
905794378 1:40807406-40807428 CAGAGAAGCAGCAGCGGCAGTGG + Intronic
906036261 1:42751887-42751909 AGCAGAGGCTGCAGCTTCAGTGG - Intronic
906262529 1:44405408-44405430 GGCGGAGGCAGCGGCGGCGGCGG - Exonic
906365332 1:45205696-45205718 AGAAGAGGCACCCGCGGAAGAGG + Intronic
906775592 1:48526638-48526660 AGTAGGAGCAGCAGCAGCAGTGG + Intergenic
907275976 1:53316839-53316861 AGGAGAGGCTGCTGTGGCAGGGG + Intronic
907523432 1:55039871-55039893 AGCAGCAGCAGCAGTGGCAGCGG - Exonic
907523433 1:55039877-55039899 AGCAGCAGCAGCAGCAGCAGTGG - Exonic
907575851 1:55524957-55524979 AGGAGAGGCAGCACTGGAAGGGG - Intergenic
907850512 1:58250438-58250460 GGCGGTGGCAGCAGAGGCAGCGG + Intronic
907884061 1:58577104-58577126 AGCAGCAGCGGCAGCCGCAGCGG + Exonic
907884062 1:58577107-58577129 AGCAGCGGCAGCCGCAGCGGTGG + Exonic
908703346 1:66925071-66925093 GGCGGCGGCAGCAGCGGCAGCGG + Exonic
908930983 1:69315676-69315698 AGCAGAGGCAGCAGTAGGTGAGG + Intergenic
908951581 1:69568280-69568302 AGCAGCGGCGGCGGCGGCGGCGG - Intergenic
909335234 1:74465397-74465419 ACCTGAGCCAGCAGCTGCAGAGG + Intronic
909526245 1:76626095-76626117 AGCAGCAGCAGCAGCAGCAAAGG + Intronic
909622501 1:77683503-77683525 AGCAGCAACAGCAGCAGCAGCGG - Intergenic
909664688 1:78120249-78120271 AGCAGAGGAAGCCACGGCAAAGG - Intronic
909692245 1:78421650-78421672 AGCAGTGGCAGGATCAGCAGTGG + Intronic
910145729 1:84078104-84078126 AGCAGCGGCGGCGGCGGCGGCGG - Intronic
910145734 1:84078116-84078138 AGCACCGGCAGCAGCAGCGGCGG - Intronic
910676411 1:89821067-89821089 GGCAGCGGCAGCAGCGGCGACGG - Exonic
910676412 1:89821073-89821095 GGCAGCGGCAGCGGCAGCAGCGG - Exonic
911017220 1:93346089-93346111 AGCGGCAGCGGCAGCGGCAGCGG + Exonic
911017240 1:93346182-93346204 GGCGGCGGCGGCAGCGGCAGCGG + Exonic
911301638 1:96181864-96181886 AGATGATGCAGCAGCGGCAATGG - Intergenic
911375207 1:97043772-97043794 AGCTGCAGCAGCAGTGGCAGAGG + Intergenic
911449587 1:98046178-98046200 GGCAGCGGTAGCAGCGGCAGCGG - Intergenic
911449588 1:98046184-98046206 AGCAGCGGCAGCGGTAGCAGCGG - Intergenic
911449589 1:98046193-98046215 GGCAGCGGTAGCAGCGGCAGCGG - Intergenic
911449590 1:98046199-98046221 AGCAGCGGCAGCGGTAGCAGCGG - Intergenic
912228684 1:107766734-107766756 AGGGGAGGAAGCAGCGGGAGAGG + Intronic
912256564 1:108065351-108065373 ACCAGAGGCAGCAGAAGTAGAGG + Intergenic
912381481 1:109250116-109250138 AGCAGCAGCAGCGGCGGCGGCGG - Exonic
912381482 1:109250119-109250141 AACAGCAGCAGCAGCGGCGGCGG - Exonic
912381484 1:109250125-109250147 AGCAGCAACAGCAGCAGCAGCGG - Exonic
912515028 1:110211746-110211768 AGCAGCGGCAGCAGCGGCGGCGG + Exonic
912716932 1:111989754-111989776 GGCAGCGGCGGCGGCGGCAGTGG - Intergenic
912887372 1:113489039-113489061 AGCAGTGGTAGCAGCAGCTGTGG - Intronic
913100898 1:115564399-115564421 AGCGGCGGCGGCAGCGGCGGCGG - Intergenic
913538730 1:119798585-119798607 TGCAGAGGCAGCAGTGGCAGTGG - Exonic
913578010 1:120196940-120196962 GGCAGAGGCAGCCGCGGAGGAGG + Intergenic
913630162 1:120701412-120701434 GGCAGAGGCAGCCGCGGAGGAGG - Intergenic
914559926 1:148808360-148808382 GGCAGAGGCAGCCGCGGAGGAGG + Intronic
914612907 1:149321855-149321877 GGCAGAGGCAGCCGCGGAGGAGG - Intergenic
914817081 1:151071069-151071091 AGCGGGGGCAGCGGCGGGAGGGG + Intronic
914913693 1:151805373-151805395 AGCAACAGCAGCAGCAGCAGCGG - Exonic
914915633 1:151817538-151817560 GGCAGAGAAAGCAGCTGCAGAGG + Intronic
915034644 1:152911515-152911537 AGCAGAAGCAGGAGGTGCAGTGG + Exonic
915068401 1:153245107-153245129 AGCAGAGGCAACAGTGTTAGTGG + Intergenic
915134183 1:153718270-153718292 AGCAGAGTCTGCAGTGGAAGAGG - Intergenic
915246313 1:154558515-154558537 CGCAGGGGCAGCAGCAGCCGGGG - Exonic
915325329 1:155078954-155078976 AGCAGCAGCAGCAGCAGCAGCGG - Exonic
915325330 1:155078981-155079003 AGCAGCGGCAGCAGCGGCACGGG - Exonic
915458437 1:156055058-156055080 GGCAGAGGGGGCAGCGGCTGGGG + Intronic
915556743 1:156665023-156665045 AGGAGCGGCAGCAGCAGCAACGG + Intergenic
915737627 1:158094846-158094868 AGCTGGGGCAGCAGGGCCAGGGG - Exonic
915787317 1:158628329-158628351 AGTAGTGGGAGCAGTGGCAGTGG - Intronic
915937589 1:160098411-160098433 AGCATTAGCAGCAGCAGCAGCGG + Exonic
916391626 1:164337332-164337354 AGGAGAGCCAGCAATGGCAGTGG + Intergenic
916437763 1:164792609-164792631 GGCAGCGGCGGCAGCGGCGGCGG + Exonic
916588355 1:166166809-166166831 GGCGGAGGCAGCAGCGGCGGCGG + Intronic
917343854 1:174008426-174008448 AGCAGAGGAAGAAGCAGAAGAGG + Intronic
917353703 1:174104765-174104787 AGCAGAGGCAGCCGCCATAGTGG - Intergenic
917476940 1:175377019-175377041 AGCAGAAGCAGCTGTGGAAGGGG + Intronic
917496307 1:175543279-175543301 AGCAGAGAATGCAGCTGCAGAGG + Intronic
917845757 1:179018962-179018984 AGCAGGGGTAGCAACGGCAGGGG + Intergenic
917944437 1:179954777-179954799 AGGAGCGGCGCCAGCGGCAGCGG - Exonic
917962339 1:180154938-180154960 AGCAGCAGCAGCAGCGACGGCGG - Exonic
917967522 1:180187817-180187839 AGCAGAGGCATCGGGGGCATGGG + Intronic
918070792 1:181132063-181132085 TCCAGAGGCAGCAGGGGAAGGGG + Intergenic
918262952 1:182812808-182812830 AGCAGAGGCAAGAGAGGAAGGGG + Intronic
918316774 1:183328975-183328997 AGCAGAGGTAGCAGAGGTAGAGG + Intronic
918423579 1:184387083-184387105 AGCAGCGGCCGCGGCGGCCGCGG - Exonic
918423813 1:184388054-184388076 ACCAAAGGCAGCCGCGGCGGCGG - Intronic
918912603 1:190592846-190592868 AGCAGAGGTAGAAGCAGGAGGGG - Intergenic
919920626 1:202164595-202164617 AGTATAGGCAGCAGGGGGAGTGG + Intergenic
920342416 1:205284017-205284039 AGCAACGGAGGCAGCGGCAGGGG + Intergenic
920681617 1:208077393-208077415 AGCAGGGGCGGCTGAGGCAGAGG + Intronic
920856957 1:209670682-209670704 AGCAGAGCCACCAGCTGCTGGGG - Intergenic
921030239 1:211329861-211329883 GGCAGCGGCAGCAGCAGCAGAGG - Intronic
921180158 1:212625702-212625724 TAAAGAGGCAGCAGCAGCAGGGG + Exonic
921379394 1:214508519-214508541 AGCAGAGGAAGTAACTGCAGAGG - Intronic
921486679 1:215723287-215723309 AGCAGCGGCAGCAGCAGCAGAGG - Intronic
921968520 1:221119298-221119320 AGCAGAGGGTGCAAAGGCAGAGG - Intergenic
922200247 1:223394650-223394672 AGCACAGCCTGCAGCTGCAGAGG + Exonic
922288700 1:224192170-224192192 AGCAGCAGCAGCAGCAGCTGTGG - Intronic
922344725 1:224686992-224687014 AGAAGCTGCAGCAGAGGCAGTGG - Intronic
922505990 1:226125967-226125989 AGCAGCGGCGGCGGCGGCGGCGG + Intergenic
922520093 1:226242746-226242768 GGCAGAGGCAGAAGAGGTAGAGG - Intronic
922586307 1:226737178-226737200 GGCAGTGGCAGCGGCAGCAGCGG - Exonic
922597065 1:226822258-226822280 CTCAGGGGCAGCAGGGGCAGAGG - Intergenic
922648636 1:227318186-227318208 AGCAGCAGCAGCTGCGGCGGCGG + Exonic
923056005 1:230426255-230426277 AGGAGACGCAGCGGCGGCGGTGG - Intergenic
923171527 1:231421765-231421787 AGTAGAAGGAGCTGCGGCAGCGG + Exonic
923513739 1:234675787-234675809 AGCTGTGGCAGCTGCAGCAGTGG + Intergenic
923810522 1:237309849-237309871 ACCTGCGGCAGCAGCTGCAGAGG - Intronic
924138578 1:240998524-240998546 AGCTGGAGCAGCAGCAGCAGAGG + Intronic
924448349 1:244155357-244155379 AACAGCAGCAGCGGCGGCAGCGG + Intergenic
924563884 1:245179953-245179975 AGCAGAGGAGGCAGCGCCTGGGG + Intronic
1063149312 10:3322206-3322228 GGCAGAGGCAGGAGCAGCACTGG + Intergenic
1063250784 10:4271726-4271748 AGCAGAGGCAGAGGCCCCAGGGG - Intergenic
1063639860 10:7818669-7818691 AGCAGTGGCAGCAAGGGCTGCGG + Exonic
1063716750 10:8535047-8535069 AGCAGAAGGAGCAGTGACAGTGG + Intergenic
1064133235 10:12728846-12728868 TGAAGAGGGAGCAACGGCAGAGG - Intronic
1064185469 10:13158436-13158458 GGCAGCAGCAGCAGCGGCGGCGG - Intergenic
1064230818 10:13528566-13528588 GGCGGCGGCAGCGGCGGCAGCGG + Intronic
1064230819 10:13528572-13528594 GGCAGCGGCGGCAGCGGCAGCGG + Intronic
1064230821 10:13528581-13528603 GGCAGCGGCAGCGGCGGCAGCGG + Intronic
1064230822 10:13528587-13528609 GGCAGCGGCGGCAGCGGCAGCGG + Intronic
1064379293 10:14826303-14826325 AGCAGAAGAAGCAGCAGAAGTGG + Intronic
1064919874 10:20504769-20504791 AGCAGAGGAGGCAGAGGTAGAGG - Intergenic
1065023152 10:21517112-21517134 GGCGGCGGCAGCAGCGGCGGCGG + Exonic
1065023155 10:21517121-21517143 AGCAGCGGCGGCGGCGGCGGCGG + Exonic
1065043145 10:21717760-21717782 AGCAGCAGCAGCAGCGGAGGAGG - Intronic
1065043147 10:21717766-21717788 AGAAGAAGCAGCAGCAGCAGCGG - Intronic
1065101621 10:22336665-22336687 GGCAGAGGTACCAGCGGCTGCGG - Intergenic
1065712730 10:28533148-28533170 AGCGGCGGCACCAGCGGCGGCGG + Intronic
1065712747 10:28533206-28533228 GGCGGCGGCAGCAGCGGCGGCGG + Intronic
1065815265 10:29477505-29477527 AGCAAAAGCAGCAGCTGCACAGG - Intronic
1065881325 10:30039846-30039868 AGATGAGGCATCAGAGGCAGGGG - Intronic
1065957602 10:30706840-30706862 AGCAAAAGCAGCAGCTGCACAGG + Intergenic
1066129745 10:32381338-32381360 AGGAGTGGCAGGGGCGGCAGAGG + Intergenic
1066303395 10:34116829-34116851 AGCGGAGGCACTAGCGGTAGCGG + Intronic
1066435430 10:35393042-35393064 CGCAGAGGGAGCAGGGTCAGTGG - Intronic
1066659824 10:37728309-37728331 GGCAGAGGTGGCAGCGACAGCGG + Intergenic
1067348858 10:45457724-45457746 GGAGGAGGCAGCATCGGCAGAGG + Exonic
1067560355 10:47300691-47300713 AGCAGCAGCAGCAGCAGCTGGGG - Exonic
1068942590 10:62694100-62694122 AGGTGAGGCAGCAGCAACAGAGG + Intergenic
1069632890 10:69908151-69908173 AGGAAAGGCAGCAGCAGGAGAGG + Intronic
1069906315 10:71734628-71734650 GGCAGAGGCAGCAGCAGGAGGGG - Intronic
1070135276 10:73688926-73688948 GGCAGAGGAGGCAGAGGCAGAGG - Intronic
1070135281 10:73688950-73688972 AGCAGAGGCAGAGGAGACAGAGG - Intronic
1070135282 10:73688959-73688981 GGCAGAGGCAGCAGAGGCAGAGG - Intronic
1070135283 10:73688965-73688987 GGCAGAGGCAGAGGCAGCAGAGG - Intronic
1070135284 10:73688974-73688996 GGCGGAGGCGGCAGAGGCAGAGG - Intronic
1070184874 10:74051897-74051919 AGCAGCAGCAGCAGCAGCAGAGG + Intronic
1070533652 10:77359337-77359359 AGCACATGCAGCAGCAGCGGTGG - Intronic
1070570606 10:77637590-77637612 AGCAGCGGCGGCGGCGGCGGCGG - Exonic
1070570609 10:77637599-77637621 GGCGGCGGCAGCAGCGGCGGCGG - Exonic
1070759655 10:79016172-79016194 AGCAGAAGGAGAAGCAGCAGTGG + Intergenic
1070809860 10:79292242-79292264 AGCCGCTGCAGCAGCGGCAGTGG + Exonic
1070954511 10:80455093-80455115 AGGAGAAGCAGCAGCGGCCCGGG - Intronic
1071061205 10:81571656-81571678 AGCGGCAGCAGGAGCGGCAGTGG - Intergenic
1071086737 10:81874973-81874995 AGCAGCAGCAGCAGCGGGCGCGG + Intergenic
1071191799 10:83109444-83109466 AGCAGCAGCAGCAGCAGCAGTGG - Intergenic
1071397455 10:85237968-85237990 AGCAGCAGCAGCAGCAGCAGGGG - Intergenic
1071676423 10:87659880-87659902 AGCAGCAGCAGCAGCAGCAGCGG - Exonic
1071882105 10:89910886-89910908 AGCAGCAGCAGCAGCAGCAGTGG + Intergenic
1071997522 10:91162885-91162907 AGCAGAGCCCGCGGCGGCGGCGG - Intergenic
1072047589 10:91672225-91672247 AGCAGCAGCAGCAGCAGCAGGGG - Intergenic
1072264294 10:93712779-93712801 AGCATTGGCAGCAGCAGCAGAGG - Intergenic
1072270956 10:93775885-93775907 AGTATAGGCAGCATCAGCAGTGG - Intronic
1072276485 10:93828380-93828402 AGCTGAGGCAGGAGCTGAAGGGG - Intergenic
1072340688 10:94445458-94445480 AGAAGGGGCCGCAGAGGCAGAGG - Intronic
1072530649 10:96315614-96315636 AGAAGAGGCAGTAGGGGGAGTGG + Intronic
1072733741 10:97865620-97865642 AGCAGTGGCAGCTCCAGCAGCGG + Exonic
1072733744 10:97865638-97865660 AGCGGCAGCAGCAGCGGCAGTGG + Exonic
1072733746 10:97865653-97865675 GGCAGTGGCAGCAGCAGCGGTGG + Exonic
1072757190 10:98029479-98029501 ACCAGCAGCAGCAGCGGCGGCGG + Intronic
1072757192 10:98029482-98029504 AGCAGCAGCAGCGGCGGCGGCGG + Intronic
1072757194 10:98029488-98029510 AGCAGCGGCGGCGGCGGCGGCGG + Intronic
1073076340 10:100827582-100827604 GGCAGCGGCAGCAGCGGCAGGGG - Exonic
1073212700 10:101818031-101818053 CGCAGAGGTGGCAGCGGCCGGGG - Exonic
1073314472 10:102569253-102569275 CACAGTGGCAGCCGCGGCAGGGG - Intronic
1073340899 10:102743922-102743944 AGCAGAGCCGGAAGCGGGAGGGG + Intergenic
1073583108 10:104685466-104685488 GGAAGAGGCAGCAGCTGCAAAGG + Intronic
1074064924 10:110006006-110006028 AGCAGCAGCAGCGGCGGCGGCGG - Intronic
1074064925 10:110006009-110006031 AGCAGCAGCAGCAGCGGCGGCGG - Intronic
1074088362 10:110225923-110225945 GGCAGAGGCAGGGGCGGGAGGGG + Intronic
1074249933 10:111734850-111734872 AGCAGAAGCAGCAGTGGCCTTGG - Intergenic
1074503107 10:114043918-114043940 AGCAGCGGCGGCGGCGGCGGCGG + Intergenic
1074821707 10:117184441-117184463 AGCGGTAGCGGCAGCGGCAGCGG - Intergenic
1074823310 10:117197551-117197573 AGCAGAGGAAGCAGAGGCCAGGG - Exonic
1074887327 10:117704530-117704552 GGCAGATGAAGCAGGGGCAGAGG - Intergenic
1075316191 10:121455476-121455498 AGCAGAGGCAGAAACGGCTCAGG - Intergenic
1075388571 10:122075663-122075685 AACAGAGGCAGCAGCTGTGGTGG - Intronic
1075403856 10:122180854-122180876 AGCTGAGGCAGGAGAGGCTGAGG - Intronic
1075519697 10:123136238-123136260 GGCAGCGGCAGCGGCGGCGGCGG - Exonic
1075588678 10:123676061-123676083 AGAACTGGGAGCAGCGGCAGAGG - Intronic
1075654726 10:124153308-124153330 AGCAGAGGAAGGAGAGGCTGGGG + Intergenic
1075801887 10:125159489-125159511 GGCAGTGGCGGCGGCGGCAGCGG + Intronic
1075857020 10:125638215-125638237 AGCAGGGGCAGCACGGGGAGGGG - Intronic
1076105986 10:127824118-127824140 AGCAGAGGGAGAAGCAGCATGGG + Intergenic
1076372155 10:129962894-129962916 AGGAGAGCCAGCCGCTGCAGGGG + Intronic
1076657767 10:132036241-132036263 AGCAGATGAAGCAGCTGCTGCGG - Intergenic
1076795097 10:132794513-132794535 AGCAGCGCCAGCAGGGACAGTGG + Intergenic
1076830564 10:132992326-132992348 AGAGGAGGCAGCAGCGGGGGCGG + Intergenic
1076852714 10:133100910-133100932 AGCGGAGGCAGGGGCCGCAGTGG + Intronic
1076934030 10:133555596-133555618 AACAGCAGCAGAAGCGGCAGAGG - Exonic
1077063348 11:627109-627131 AGCAGCAGCAGCAGCAGGAGGGG + Exonic
1077253562 11:1571265-1571287 TGCAGAGGCAGCCGCGGCGCTGG - Intronic
1077309327 11:1881506-1881528 AGCAGCGGCAGCAGCACGAGGGG + Exonic
1077439378 11:2560854-2560876 AGCAGAGGCAGCAGTGGATGGGG + Intronic
1077479195 11:2805264-2805286 AGCAAAGGCTGCAGCTGCACAGG + Intronic
1077509307 11:2947914-2947936 TGAAGAGGCAGCAGCCTCAGTGG + Intronic
1077716713 11:4588492-4588514 ACCAGAGGCAGTAGAGTCAGGGG - Intergenic
1077920978 11:6641522-6641544 AGCAGCAGCAGCAGCAGCAATGG + Exonic
1078006516 11:7536422-7536444 AGCAGAGGAAGGAGCAGAAGAGG + Intronic
1078172771 11:8941518-8941540 AGCAAGGGCAGCAGGGGCAGGGG + Intergenic
1078316074 11:10294159-10294181 TGCAGCGGCAGTAGCGGCAGCGG + Exonic
1078396948 11:10989547-10989569 CTCAGAGGCAGAAGCTGCAGGGG - Intergenic
1078559347 11:12357036-12357058 AAGAGAGGCAGGAGGGGCAGAGG - Intronic
1078741680 11:14072516-14072538 AGAGGAGGCAGCACAGGCAGAGG + Intronic
1078758409 11:14232919-14232941 AACAGAGGCCGCAGAGGTAGTGG + Intronic
1079060994 11:17248696-17248718 AGCAGTGGCAGCAGGTTCAGAGG + Intronic
1079076729 11:17389156-17389178 AGCAGGTGCAGCGGCGGCGGCGG - Intronic
1079164727 11:18028994-18029016 GGCAGAGGCTGCAGTGACAGAGG + Intronic
1079308526 11:19345209-19345231 AGGAGCGGCTGCAGCGGCAGCGG + Intergenic
1080503813 11:32893288-32893310 AGCAGTGGCAGCTGCAGTAGCGG + Exonic
1080540199 11:33257667-33257689 AGCAGCAGCAGCAGCAGCAGCGG + Exonic
1080540202 11:33257673-33257695 AGCAGCAGCAGCAGCGGTCGGGG + Exonic
1080551341 11:33376227-33376249 CGCCGAGGCTGCAGCGGCGGCGG + Intergenic
1081634579 11:44712288-44712310 AGTAGTGGCTGCAGCAGCAGTGG + Intergenic
1081727225 11:45338882-45338904 TGCAGAGGCAGGAGAGGCTGAGG + Intergenic
1081910380 11:46696350-46696372 AGAAAAGGCAGCTGGGGCAGAGG + Intronic
1082076762 11:47980976-47980998 CGCAGCAGCAGCAGCAGCAGCGG - Exonic
1082816873 11:57514966-57514988 CGCCGAGGCTGCAGCGGCCGCGG - Intronic
1082834079 11:57639461-57639483 AGCTGGAGCAGCAGGGGCAGGGG - Intergenic
1082862738 11:57871352-57871374 AGGAGAGGCAGCAAGGGCGGAGG - Intergenic
1083258219 11:61509383-61509405 ACCAGGCGCAGCAGCGGCCGCGG - Exonic
1083342431 11:61967437-61967459 AGGAGAGGCGGCGGCGGCGGCGG + Exonic
1083367197 11:62148508-62148530 TGCAGAAGGAGCAGCTGCAGAGG + Exonic
1083393283 11:62371269-62371291 AGTGGTGGCAGCAGCAGCAGCGG + Intronic
1083431508 11:62615737-62615759 AGCAGGAGGAGCAGCTGCAGCGG - Exonic
1083572631 11:63768576-63768598 AGCCGGAGCAGCGGCGGCAGGGG - Exonic
1083620837 11:64048587-64048609 AGCAGGGGCTGCAGCCCCAGCGG + Intronic
1083635741 11:64120077-64120099 AGCAAAGGCAGAAGCAGCAGCGG + Intronic
1083719910 11:64598992-64599014 AGCGGAGCCAGCAGAGGCCGGGG - Intronic
1083728864 11:64642703-64642725 AGCAGAGGTGGCGGCGGCGGCGG + Intronic
1083741449 11:64713641-64713663 AGCAGCAGCAGCAACAGCAGCGG + Exonic
1083741451 11:64713647-64713669 AGCAGCAACAGCAGCGGCGGCGG + Exonic
1084001988 11:66300903-66300925 AGCAGAGGCAGAGGCCGCTGGGG - Intergenic
1084060352 11:66668992-66669014 GGCAGTAGCAGCGGCGGCAGCGG - Exonic
1084071027 11:66734908-66734930 AGCAGCAGCAGCAGCAGCAACGG + Intergenic
1084102410 11:66958351-66958373 AGTGGAGGCAGCAGCGGTAGAGG - Exonic
1084155044 11:67308555-67308577 AGCAGAGCTAGCAGCTGCTGAGG - Intronic
1084284172 11:68120972-68120994 AGCGGCAGCGGCAGCGGCAGCGG + Exonic
1084284175 11:68120981-68121003 GGCAGCGGCAGCGGCGGCGGAGG + Exonic
1084310291 11:68312739-68312761 AGCAGCAGCAGCAGCGGCCACGG - Exonic
1084310292 11:68312745-68312767 AGCAGCAGCAGCAGCAGCAGCGG - Exonic
1084347665 11:68566233-68566255 AGCAGCAGCAGCAGCAGCCGTGG - Intronic
1084385752 11:68841801-68841823 GGCAGCGGCAGCGGCGGCGGCGG + Exonic
1084439827 11:69166478-69166500 AGAAGAGGTGGCTGCGGCAGAGG - Intergenic
1084546640 11:69818154-69818176 CGCAGAGGCAGCAGCGGGGGCGG + Intronic
1084945519 11:72636214-72636236 ATCAGAGGCAGCAGCTTCAAGGG + Intronic
1084954855 11:72685739-72685761 AGCAGCTGCAGCAGCTTCAGCGG - Intronic
1085239769 11:75043617-75043639 AGCAGAGTCAGGAGGGACAGAGG - Intergenic
1085299761 11:75451046-75451068 CCCAGAGGCAGCAGCGGCCAGGG + Intronic
1085333117 11:75669013-75669035 GGCAGAGGCGGCGGCGGCAGCGG - Exonic
1085333118 11:75669019-75669041 AGCAGAGGCAGAGGCGGCGGCGG - Exonic
1085353392 11:75815233-75815255 AGCGGCGGCAACGGCGGCAGCGG + Exonic
1085353394 11:75815242-75815264 AACGGCGGCAGCGGCGGCAGCGG + Exonic
1085353396 11:75815248-75815270 GGCAGCGGCGGCAGCGGCGGCGG + Exonic
1085407192 11:76270267-76270289 AGGAGAGGCCGGAGCAGCAGGGG - Intergenic
1086079592 11:82889503-82889525 GGCAGAGGCAGAAGCAGCAGAGG + Intronic
1086293343 11:85336410-85336432 AGTTGAGGCAGCAGCAGCTGAGG + Intronic
1086455366 11:86955093-86955115 ATCGGGGGTAGCAGCGGCAGCGG + Exonic
1087144650 11:94799804-94799826 AGCAGCAGCAACAGCAGCAGGGG + Exonic
1088105700 11:106204469-106204491 AGTTGAGGCAGCAGTGTCAGTGG + Intergenic
1088172835 11:107017834-107017856 GGCAGTGGCAGCGGCGGCGGCGG + Exonic
1088263211 11:107964605-107964627 AGCAGAGGAAGCGGGCGCAGGGG - Intergenic
1088771060 11:113036519-113036541 AGTAGAGGCGGCAGGGGCAACGG - Intronic
1089175879 11:116548511-116548533 AGCTCTGGCAGCAGTGGCAGTGG + Intergenic
1089538530 11:119175236-119175258 AGCAGAGGCAGAGCCCGCAGAGG - Exonic
1089638540 11:119832166-119832188 AGCAAAGGCATCAGGGGCTGTGG - Intergenic
1089741894 11:120590246-120590268 ATGAGAGGAAGCAGAGGCAGGGG - Intronic
1090077993 11:123591444-123591466 AGGAGAGCCAGCTGCTGCAGTGG + Intronic
1090832339 11:130428231-130428253 AGCAGCAGCAGCAGCAGGAGCGG + Exonic
1091271179 11:134312977-134312999 AGCAGCAGCACCAGCAGCAGGGG - Intronic
1091391959 12:131208-131230 GCCAGAAGAAGCAGCGGCAGGGG - Intronic
1091594336 12:1865656-1865678 AGCAGCAGCAGCAGCACCAGGGG + Intronic
1092214058 12:6668022-6668044 AGCAGCGGCAGCAGTGGCCCAGG - Exonic
1092214059 12:6668028-6668050 AGCAGCAGCAGCGGCAGCAGTGG - Exonic
1092239511 12:6828459-6828481 AGCAGCAGCAGTAGCAGCAGCGG - Exonic
1092261545 12:6955794-6955816 AGGGGAGGCAGCTGGGGCAGGGG - Intronic
1092335425 12:7628750-7628772 GGCAGGGGCGGCGGCGGCAGGGG - Intergenic
1092788196 12:12048908-12048930 GGCAGAGGCAGAAGAGGCGGAGG + Intergenic
1093019907 12:14193801-14193823 AGGAGAGGAAGCAACTGCAGTGG - Intergenic
1093057230 12:14567626-14567648 AGCAGCAGCAGCAGCAGAAGCGG + Exonic
1093156945 12:15697390-15697412 AACAGCAGCAGCAGCGGCAATGG + Intronic
1093825393 12:23679379-23679401 AGCAGCAGCAGCAGCGTCAGTGG - Intronic
1093958788 12:25250889-25250911 GGCGGAGGCAGCAGCGGCGGCGG - Intronic
1094017865 12:25884147-25884169 TGCAGGAGCAGCAGTGGCAGAGG + Intergenic
1095225435 12:39672339-39672361 AGCAGTGGCAGCAGAGGCAGTGG + Intronic
1095391240 12:41709140-41709162 AGCAGAGGCAGCATCTGAAAAGG - Intergenic
1095635001 12:44422674-44422696 AGCAGAGACAGCCAGGGCAGAGG - Intergenic
1095768708 12:45926459-45926481 GGCAGAGGCAACCGTGGCAGAGG - Exonic
1096098955 12:48957331-48957353 GGCAGAGGCGGCGGCCGCAGCGG - Exonic
1096112543 12:49038032-49038054 TTCAGAGGCATCAGCAGCAGGGG + Exonic
1096598699 12:52714476-52714498 AGCCGGGGCCGCAGCGGCTGGGG - Intergenic
1096606324 12:52768957-52768979 GTCAGTGGCGGCAGCGGCAGTGG - Exonic
1096606329 12:52768987-52769009 AGCAGCAGCAGCAGCAGCAGTGG - Exonic
1096706278 12:53424397-53424419 AGCAGCGGCTGTAGAGGCAGCGG - Exonic
1097141697 12:56908124-56908146 AGCAGCTGTAGCAGCAGCAGTGG + Intergenic
1097189311 12:57211947-57211969 AGCAGCAGCAGCAACAGCAGAGG - Exonic
1097548016 12:61029086-61029108 AGCAGAGGCAACAGCAGAATTGG - Intergenic
1097552855 12:61098229-61098251 GACAGAGGCAGCAGTGGCAGCGG - Intergenic
1097712985 12:62935110-62935132 AGCCGTGGCAGCAGCCGCGGCGG - Intergenic
1098123826 12:67269650-67269672 GGCGGCGGCGGCAGCGGCAGCGG + Exonic
1098450090 12:70609973-70609995 GGCAGGAGCAGCAGCAGCAGCGG - Intronic
1098541558 12:71663468-71663490 AGCAGCAGCAGCAGCGGCGGCGG - Exonic
1098541559 12:71663471-71663493 AGCAGCAGCAGCAGCAGCGGCGG - Exonic
1098879337 12:75901089-75901111 AGGAGAGGAAGCAGGGGCCGGGG + Intergenic
1099202066 12:79689888-79689910 AGCCGAGGCAGAGGCGGCTGGGG + Exonic
1099758868 12:86892933-86892955 ACTAGAAGCAGCAGGGGCAGGGG - Intergenic
1099826666 12:87784499-87784521 GGCAGTGGCGGCAGCGGCGGCGG - Intergenic
1099989766 12:89709327-89709349 AGCCAAGGCGGCAGCGGCGGCGG - Intergenic
1100415544 12:94369885-94369907 AGCAGCAGCAGCAGCAGCAAGGG + Intronic
1100823892 12:98457042-98457064 AGCAGCAGCAGCAGCCGCCGCGG + Intergenic
1101716948 12:107319844-107319866 AGCGCAGCCAGCAGCGCCAGCGG + Exonic
1102025881 12:109714197-109714219 AGCGGCGGCGGCGGCGGCAGCGG - Intergenic
1102025884 12:109714209-109714231 AGCGGCGGCGGCAGCGGCGGCGG - Exonic
1102031152 12:109740947-109740969 AGGAGAACCAGCAGGGGCAGAGG + Intronic
1102042612 12:109810374-109810396 ACAAGAGGCAGCAGGGCCAGAGG + Intronic
1102089144 12:110172297-110172319 GGCAGAGGAGGCAGAGGCAGAGG - Intronic
1102089149 12:110172321-110172343 GGCAGAGGCAGAGGAGGCAGAGG - Intronic
1102346361 12:112163606-112163628 AGCATGGTCAGCAGCTGCAGGGG + Exonic
1102385492 12:112505571-112505593 GGCTGAGGCAGGAGAGGCAGCGG + Intronic
1102513191 12:113429253-113429275 TGCAGAGGCTGCAGGGGGAGGGG + Exonic
1102571344 12:113828768-113828790 TGCAGAGGCACCAGCAGCTGAGG - Intronic
1102796853 12:115696343-115696365 AGCAGAGGCTGCAGGGGTGGAGG + Intergenic
1102853926 12:116277405-116277427 GGCAGCGGCAGCAGCGGCGGCGG - Intergenic
1102946880 12:116997631-116997653 AGCAGAGGCAGCAGGGCCTGTGG + Intronic
1103308949 12:119989465-119989487 AGCAGCAGCAGCAGCGGCAGCGG + Intergenic
1103359911 12:120347458-120347480 GGCAGCGGCGGCAGCGGCTGTGG - Exonic
1103359912 12:120347464-120347486 GGCGGCGGCAGCGGCGGCAGCGG - Exonic
1103563397 12:121804068-121804090 AGCAGCAGCAGCAGCGGCGGCGG + Intergenic
1103563398 12:121804074-121804096 AGCAGCAGCGGCGGCGGCAGCGG + Intergenic
1103720384 12:122971520-122971542 AGCAGAGGTTGCATGGGCAGAGG - Intronic
1103908677 12:124340171-124340193 AGCAGCGGCAGCAGCGGCGGGGG - Exonic
1104009111 12:124916594-124916616 TGCAGAGGCAGGGGCGGGAGAGG + Intronic
1104021197 12:124993653-124993675 AGCAGCGGCGGCGGCGGCTGTGG + Intergenic
1104049542 12:125186426-125186448 GGCAGAGGCGGCGGCGGCGGCGG + Intergenic
1104581452 12:130014075-130014097 GGAGGAGGCTGCAGCGGCAGCGG + Intergenic
1104841619 12:131828558-131828580 AGCAGCAGCAGCAGCGGCAGCGG - Exonic
1104895014 12:132159746-132159768 AGCAGTGGCCGCAGCAGCAGAGG - Intergenic
1104910602 12:132238427-132238449 GGCCGGGGCAGCAGCCGCAGGGG + Intronic
1104925396 12:132311401-132311423 GGCAGGGGCAGCAGGGGCAGGGG + Intronic
1105024059 12:132837039-132837061 AGGAGAGGCTGCAGAGGGAGGGG + Intronic
1105217478 13:18297595-18297617 AGCAGCAGCAGCAGCGGCAGCGG + Intergenic
1105217479 13:18297601-18297623 AGCAGCAGCGGCAGCGGCAGCGG + Intergenic
1105217480 13:18297604-18297626 AGCAGCGGCAGCGGCAGCGGTGG + Intergenic
1105306439 13:19172382-19172404 AGCAGTGGCAGCAGCAGCAGGGG - Intergenic
1105328928 13:19396298-19396320 AGCAGAGCCAGGAGTGGCCGTGG - Intergenic
1105678066 13:22696586-22696608 AGCAGAGGCGGCGGTGGCGGCGG + Intergenic
1105777636 13:23678035-23678057 ACCAGGGCCAGCAGCTGCAGAGG - Intergenic
1105863018 13:24433542-24433564 AGCAGAGCCAGGAGTGGCCGTGG + Intronic
1106057631 13:26253852-26253874 AGAAGGGGCGGCAGCGGCGGCGG + Intergenic
1106466239 13:30016826-30016848 GGCAGAGGCAGAAGAGGCAAAGG - Intergenic
1106517335 13:30466134-30466156 GGCAGAGGCAGCAGCTGCTACGG + Intronic
1106720152 13:32428011-32428033 AGCAGCAGCAGCAGCGGCAGCGG - Exonic
1106956288 13:34942520-34942542 AGCGGCGGCGGCAGCGGCAGCGG + Exonic
1107133473 13:36920175-36920197 AGCGGCTGCAGCAGCGGCGGCGG + Exonic
1107133476 13:36920184-36920206 AGCAGCGGCGGCGGCGGCGGCGG + Exonic
1107276711 13:38687426-38687448 AGCAGCAGCAGCAGCAGCCGGGG - Exonic
1107413170 13:40176429-40176451 AGCAGCAGCAGCGGCGGCGGCGG - Intergenic
1107413171 13:40176432-40176454 AACAGCAGCAGCAGCGGCGGCGG - Intergenic
1107508717 13:41060928-41060950 AGCAGCGGCGGCGGCGGCGGCGG - Intronic
1107851786 13:44577904-44577926 GGCAGCGGCAGCAGCCGCGGCGG - Intergenic
1107975461 13:45683967-45683989 AGCAGAGGGAGCAGCAGCAGGGG - Intergenic
1108345240 13:49539380-49539402 GGCACAGGAAGCAGCAGCAGAGG + Intronic
1108689270 13:52847303-52847325 TGCAGCGGCGGCGGCGGCAGCGG + Exonic
1109061971 13:57631821-57631843 GGCTGAGGCAGCGGCGGCGGCGG - Exonic
1109630178 13:65034623-65034645 TGCAGAGGCAGGAGCGGGTGTGG - Intergenic
1110102758 13:71630683-71630705 AGCAGCAGCAGCTGCTGCAGCGG + Exonic
1110119715 13:71866276-71866298 AGCAGTAGCAGCAGCAGCTGCGG - Exonic
1110119729 13:71866414-71866436 AGCAACGGCAGCGGCGGCGGCGG - Exonic
1110119750 13:71866495-71866517 GGCGGCGGCAGCAGCGGCAACGG - Exonic
1110122631 13:71902551-71902573 AGCAGTGGCAGCAGCTCAAGTGG - Intergenic
1110122632 13:71902566-71902588 AGTAGCAGCAGCAGCAGCAGTGG - Intergenic
1110246386 13:73329367-73329389 AGGAGAAGCAGCAGCAGCATCGG + Intergenic
1110614330 13:77524242-77524264 AGCAGAAGCACCAGCAGCAGTGG + Intergenic
1110705868 13:78601969-78601991 GGCAGCGGCAGCGGCGGCGGCGG - Exonic
1111680159 13:91432182-91432204 AGCAGCAGCAGCAGCAGCAGTGG - Intronic
1112246331 13:97737340-97737362 AGGAGAGGCAGAAGCAGCACTGG - Intergenic
1112339095 13:98537837-98537859 AGAAGAGGCAGCTGAGGCACAGG - Intronic
1112344255 13:98577029-98577051 AGTAGCGGCAGCAGCGGCGGCGG - Intronic
1112400298 13:99071614-99071636 AGCAGAGGCAGTAGAGGTGGAGG + Intronic
1112504958 13:99970048-99970070 AGGAGAAGCAGCGGCGGAAGCGG + Intronic
1112504960 13:99970054-99970076 AGCAGCGGCGGAAGCGGCGGCGG + Intronic
1112505229 13:99971101-99971123 GGCGGCGGCAGCAGCGGCAAAGG - Exonic
1112507814 13:99985448-99985470 AGCGGCGGCGGCAGCGGCGGCGG + Exonic
1112742640 13:102492611-102492633 AGTACAGGCAGCAGCAGCATTGG + Intergenic
1113200783 13:107866306-107866328 AGCAGCAGCAGCAGCAGCGGCGG - Exonic
1113200784 13:107866309-107866331 GGCAGCAGCAGCAGCAGCAGCGG - Exonic
1113200785 13:107866330-107866352 AGCAGCAGCAGCAGAGGCAGCGG - Exonic
1113200786 13:107866336-107866358 AGCAGCAGCAGCAGCAGCAGAGG - Exonic
1113477776 13:110597299-110597321 AGCAGCGGCAGCACCCTCAGGGG - Intergenic
1113656164 13:112068726-112068748 GGCGGCGGCAGCAGCGGCCGCGG + Exonic
1113721175 13:112558247-112558269 AGCAGTGGCATCAGCAGCATTGG - Exonic
1113823438 13:113231930-113231952 AGTGGTGGCAGCAGCCGCAGTGG - Intronic
1113851954 13:113422986-113423008 CGCAAAGGCAGCAGTTGCAGTGG + Intronic
1113914800 13:113863853-113863875 AGCAGCAGCAGCAGCAGCTGCGG + Exonic
1114263629 14:21057920-21057942 CCCAGAAGCAGCAGCAGCAGGGG - Exonic
1114317677 14:21523300-21523322 AGAAGAGGCATCTGGGGCAGAGG - Exonic
1114868168 14:26623291-26623313 AACAGAGGAAGTAGCTGCAGCGG - Intergenic
1115398535 14:32934730-32934752 AGCAGCGGCGGCGGCAGCAGCGG - Intergenic
1115398536 14:32934739-32934761 AGCAGCGCGAGCAGCGGCGGCGG - Intergenic
1116346613 14:43802764-43802786 AGTAGAGGAAGCAGCGGAAAAGG + Intergenic
1116436176 14:44897462-44897484 AGATGAGGCAGCGGCGGCGGCGG + Exonic
1116835745 14:49767998-49768020 GGCAGAGGCGGCGGCGGCGGCGG + Exonic
1116887055 14:50231676-50231698 AGCAGCGGCGGCGGCGGCGGCGG + Intergenic
1116996773 14:51332988-51333010 AGAGGAGGCAGCAGGGCCAGGGG - Intergenic
1117263522 14:54061723-54061745 GGCAGAGGCAGAAGAGGTAGAGG - Intergenic
1117472384 14:56059083-56059105 AGCATTGGCAGCAACAGCAGTGG - Intergenic
1117484494 14:56180794-56180816 AGCAGACCCAGCAGCAGCAGTGG - Intronic
1117602579 14:57390670-57390692 AGGAGTGGCGGCAGCGGCGGCGG + Exonic
1117907319 14:60604101-60604123 AGCAAAGGCAGCAAGGGCAGAGG - Intergenic
1118012363 14:61622854-61622876 TGCAGCAGCAGCAGCAGCAGTGG + Intronic
1118258445 14:64225380-64225402 AGCAGGAGGAGCAGCTGCAGGGG - Exonic
1118654554 14:67932921-67932943 AGCAGTGGCAGCGGCTGTAGTGG + Intronic
1118853658 14:69604361-69604383 AGCAGAGCCAGCAGGGTTAGTGG - Intergenic
1118882629 14:69842333-69842355 AACAGAGGCAGCAAAGGGAGAGG - Intergenic
1119377616 14:74207176-74207198 GGCAGAGGCAGCAGCAGCAGAGG - Intergenic
1119390247 14:74286857-74286879 AGGAGAAGCAGCGGCGGCAGAGG - Intronic
1119391572 14:74294654-74294676 AGCAGCAGGAGCAGCAGCAGCGG - Intronic
1119395169 14:74320925-74320947 AGCAGCAGCAGCAGCAGCAAGGG + Intronic
1119685408 14:76627172-76627194 GGCTGAGGCAGGAGAGGCAGAGG - Intergenic
1120993276 14:90397124-90397146 AGCAGCAGCAGCAGCAGCAGCGG + Exonic
1120993277 14:90397130-90397152 AGCAGCAGCAGCAGCGGCATCGG + Exonic
1121012019 14:90525439-90525461 GGGACACGCAGCAGCGGCAGTGG - Exonic
1121144013 14:91567873-91567895 ACTTGAGCCAGCAGCGGCAGTGG - Intergenic
1121173096 14:91870638-91870660 AGTAAAGGCTGCAGCGTCAGAGG - Intronic
1121178219 14:91906805-91906827 AGCAGAGGCATTGGGGGCAGTGG - Intronic
1121195846 14:92071008-92071030 AGCAGCAGCAGCAGCAGCAGGGG - Exonic
1121309689 14:92929108-92929130 AGAGGAGGCAGCGGCGGCGGGGG + Intronic
1121630429 14:95417947-95417969 AGCAGCAGAAGCAGCTGCAGTGG + Exonic
1121742506 14:96264116-96264138 GCCGGAGGCAGCAGCGGCGGAGG + Exonic
1121809996 14:96876889-96876911 AGCAAAGGCAGCATCTGCAAAGG + Intronic
1121998257 14:98623756-98623778 AGCGGTGGCAGCAGCAGCAGCGG + Intergenic
1122081693 14:99271301-99271323 GGCGGCGGCAGCGGCGGCAGCGG - Intronic
1122221032 14:100239205-100239227 AGCCGAGGCCGCCGCGGCCGTGG + Exonic
1122246145 14:100404826-100404848 AGCAGAGGCCAGAGCTGCAGGGG - Intronic
1122314932 14:100820349-100820371 AGTGGTGGCAGCAGTGGCAGTGG + Intergenic
1122389241 14:101369019-101369041 GGCAGAGGCAGCATCTGGAGGGG + Intergenic
1122630558 14:103105772-103105794 AGCAGATGCGGCAGCGCCAGAGG + Intronic
1122645672 14:103192042-103192064 AGCAGCTGCATCAGCGTCAGTGG + Intergenic
1122652171 14:103231986-103232008 AGCCCAGGGAGCAGTGGCAGGGG - Intergenic
1122789768 14:104179273-104179295 AGCGCAGGCAGCAGCGGCTGCGG + Exonic
1122813626 14:104301414-104301436 AGCAGTGGCAGCAGTGATAGTGG - Intergenic
1122858491 14:104571615-104571637 AGCAGAGGCTGCAGCAGCCCCGG + Intronic
1122969729 14:105147659-105147681 GGCAGGGGCAGCAGGGGGAGGGG + Intronic
1122975270 14:105168371-105168393 AGCAGCAGCAGCAGCCGCCGGGG + Exonic
1122975331 14:105168538-105168560 GGCAGAGGCGGCGGCGGCGGCGG + Exonic
1202891537 14_KI270722v1_random:163757-163779 AGCAGGGGCAACAGAGGGAGGGG - Intergenic
1123684345 15:22786668-22786690 AGCTGCGGCAGCGGCGGCGGCGG + Exonic
1124029702 15:25999313-25999335 AGAAGAGGCGGCGGCGGCGGCGG - Intergenic
1124244426 15:28057497-28057519 AGCTGATGCAGCAGTGACAGTGG - Intronic
1124380626 15:29162131-29162153 AGTAGAGGAAGCAGCGGGAAAGG + Intronic
1124971182 15:34490686-34490708 AGCAGCGGGAGGAGCAGCAGAGG - Intergenic
1125068288 15:35518921-35518943 AGAAGAGAAAGCAGCTGCAGGGG + Intronic
1125115945 15:36091717-36091739 AGGGGTGGCAGCAGAGGCAGAGG + Intergenic
1125348110 15:38740279-38740301 AGCAGAGGCTGGAGCGGCAAAGG + Intergenic
1125522959 15:40358337-40358359 AGCAGCAGCAGCGGCGGCAGCGG + Exonic
1125545075 15:40497500-40497522 GGCAGAGGCAGGAGCAGCAAGGG - Intergenic
1125664164 15:41417145-41417167 AGCGGCGGCGGCGGCGGCAGTGG + Exonic
1125933959 15:43618682-43618704 AGCAGCAGCAGCAGCAGCAGGGG + Exonic
1125947056 15:43718144-43718166 AGCAGCAGCAGCAGCAGCAGGGG + Intergenic
1126348080 15:47717508-47717530 TGCAGCAGCAGCAGCAGCAGCGG - Intronic
1126851670 15:52801020-52801042 AGCAGCAGCAGCAGCAGCAGCGG - Intergenic
1126894893 15:53247612-53247634 ATCAAAGGCAGCAGTGGCAGAGG - Intergenic
1126915559 15:53462237-53462259 GGCTGAGGCAGCAACAGCAGTGG - Intergenic
1127415027 15:58749538-58749560 GGCGGCGGCGGCAGCGGCAGCGG - Exonic
1127573531 15:60267284-60267306 AGAAGAAGCAGCAGCAGAAGCGG + Intergenic
1127789919 15:62390567-62390589 AGCGGCGGCGGCAGCGGCTGAGG + Intronic
1127933347 15:63612498-63612520 AGGAGGGACAGCAGCGGCACAGG + Exonic
1128153506 15:65377715-65377737 AGCAGCGGCAGCAGGAGCCGGGG + Exonic
1128171523 15:65517639-65517661 AGCAGCGGCGGCAGTAGCAGCGG + Intronic
1128455000 15:67827232-67827254 AGCCAAGGACGCAGCGGCAGTGG + Intronic
1128626388 15:69209910-69209932 AGCTGTGGCAGCAGTGGCAATGG - Intronic
1128669641 15:69565575-69565597 AGCAGAGGGAGCAGAACCAGCGG - Intergenic
1128732552 15:70030998-70031020 AGCAGAAGCACCAGAGGCTGGGG + Intergenic
1128736660 15:70057495-70057517 AGCGGCTGCAGCAGCGGCGGCGG + Exonic
1128762005 15:70223496-70223518 AGGGGAGGCAGGAGGGGCAGGGG - Intergenic
1128815812 15:70607263-70607285 AGCAGAGGCAGTAGCGCCTGAGG + Intergenic
1128970793 15:72103507-72103529 AGCAGAAGCAGCAGAAGCAGTGG + Intronic
1128970794 15:72103531-72103553 AGCAGAAGCAGCAGAAGCAGTGG + Intronic
1128970795 15:72103555-72103577 AGCAGAAGCAGCAGAAGCAGTGG + Intronic
1128970796 15:72103579-72103601 AGCAGAAGCAGCAGAAGCAGTGG + Intronic
1129070456 15:72946296-72946318 GGTAGTGGCAGCAGCAGCAGTGG - Intergenic
1129099200 15:73242817-73242839 AGCAGAGGCAGAAGAGGTGGAGG + Intronic
1129129764 15:73483268-73483290 AGCAGCAGCAGCAGCAGCAGCGG - Intronic
1129274036 15:74433815-74433837 AGCAGCAGCCGCAGCCGCAGCGG + Exonic
1129716262 15:77852848-77852870 AGGAGAGGCAGGAGCGGGAGTGG + Intergenic
1129744200 15:78006997-78007019 AGCAGCGGGAACAGCAGCAGGGG + Intronic
1129823681 15:78620730-78620752 AGCAGCAGCAGCAGCAGCCGCGG + Exonic
1129823682 15:78620733-78620755 AGCAGCAGCAGCAGCCGCGGCGG + Exonic
1129851555 15:78796728-78796750 AGCAGCGGCAGCAGTGGCGGCGG - Exonic
1130151509 15:81315137-81315159 AGCAGAGGCGGGATGGGCAGGGG - Intronic
1130221341 15:82022180-82022202 AGCAGAGACAGCAGCTGCTCAGG - Intergenic
1130261134 15:82355264-82355286 GGCGGCGGCAGCAGCGGCTGCGG - Intergenic
1130280101 15:82513754-82513776 GGCGGCGGCAGCAGCGGCTGCGG + Intergenic
1130471476 15:84229940-84229962 GGCGGCGGCAGCAGCGGCTGCGG + Intergenic
1130478970 15:84344511-84344533 GGCGGCGGCAGCAGCGGCTGCGG + Intergenic
1130492800 15:84443620-84443642 GGCGGCGGCAGCAGCGGCTGCGG - Intergenic
1130593770 15:85234567-85234589 GGCGGCGGCAGCAGCGGCTGCGG + Intergenic
1130769172 15:86907082-86907104 GGCAGGTGCAGCAGCAGCAGTGG + Intronic
1130908407 15:88255487-88255509 GGCAGAGGCGGCAGCGGCGGTGG - Intronic
1131032728 15:89199960-89199982 TTCCGAGGCAGCAGCAGCAGAGG - Exonic
1131174556 15:90201645-90201667 AGCAGGAGCAGCAGCAGCGGTGG - Exonic
1131174557 15:90201648-90201670 AGCAGCAGGAGCAGCAGCAGCGG - Exonic
1131302461 15:91211473-91211495 AGCAGCAGCAGCAGCAGCGGAGG - Intronic
1131302462 15:91211476-91211498 AGAAGCAGCAGCAGCAGCAGCGG - Intronic
1131367625 15:91853595-91853617 AGGCGAGGCAGCGGCGGCGGCGG + Intergenic
1131827144 15:96331055-96331077 AGCAGCAGCAGCAGCGGCTCCGG + Exonic
1132030987 15:98438405-98438427 AGCAGAGGCAGCAGGGCCCCTGG + Exonic
1132149083 15:99447165-99447187 AGCAGACGCAGCCTCGCCAGCGG + Intergenic
1132170668 15:99650801-99650823 AGCAGCAGCAGCAGCCCCAGAGG + Intronic
1132210398 15:100017533-100017555 AGTAGAGGAAGCAGCGGGAAAGG - Intronic
1132302962 15:100787815-100787837 TGCAGAGGCGGCAGCTGCTGTGG + Intergenic
1132376267 15:101330171-101330193 AGAAAGGGCAGCAGCTGCAGTGG - Intronic
1132466238 16:78499-78521 AGCAGTGGCCGCAGCGCCCGGGG + Intronic
1132519800 16:381892-381914 GGCAGAGGCGGAGGCGGCAGAGG - Exonic
1132519804 16:381907-381929 GGCAGAGGCGGAGGCGGCAGAGG - Exonic
1132839709 16:1973017-1973039 AGCAGAGGCAAGGGTGGCAGAGG + Intronic
1132843548 16:1990002-1990024 AGCATCAGCATCAGCGGCAGCGG + Exonic
1132843549 16:1990008-1990030 AGCATCAGCGGCAGCGGCAGCGG + Exonic
1132873052 16:2124127-2124149 AGCAGGAGCAGCAACAGCAGAGG + Intronic
1133058511 16:3159284-3159306 CGCAGAGGCAGACGCGGCGGTGG - Intergenic
1133268708 16:4600180-4600202 AGCGGTGGCAGCAGCAGCAGAGG - Exonic
1133343450 16:5054370-5054392 AGCAGAGGGTGGAGAGGCAGAGG - Intronic
1133743000 16:8665443-8665465 TTCAGAGGCAGCAGAGGGAGGGG - Intergenic
1133801925 16:9091700-9091722 ATCAGCGGCGGCGGCGGCAGTGG + Exonic
1133845492 16:9449668-9449690 AGTAGCTGCAGCAGCAGCAGGGG + Intergenic
1134172076 16:11976745-11976767 GGCAGCCGCAGAAGCGGCAGCGG + Exonic
1134172079 16:11976751-11976773 CGCAGAAGCGGCAGCGGCGGCGG + Exonic
1134235598 16:12463073-12463095 AGCATGGGCAGCAGCAGCAGGGG - Intronic
1134516947 16:14895046-14895068 AGCAGAACCAGCAGCGTCAATGG - Exonic
1134552140 16:15143306-15143328 AGCAGGAGCAGCAACAGCAGAGG + Intergenic
1134588657 16:15434525-15434547 AGGAGAGGGAGCAGCGTCACGGG + Exonic
1134704617 16:16293700-16293722 AGCAGAACCAGCAGCGTCAATGG - Exonic
1134962925 16:18418414-18418436 AGCAGAACCAGCAGCGTCAATGG + Exonic
1134967220 16:18501013-18501035 AGCAGAACCAGCAGCGTCAATGG + Intronic
1135016042 16:18925989-18926011 AGCAGCGGCGGCGGCGGCGGCGG - Exonic
1135087516 16:19487140-19487162 TGCAGCCGGAGCAGCGGCAGAGG - Intronic
1135250865 16:20900306-20900328 AGAAGAGGCGGCGGCGGCGGGGG - Exonic
1135382971 16:22008934-22008956 ACCAGAGGAAGCTGCGGCCGGGG + Intronic
1135748658 16:25038679-25038701 AGCAAAGACAGCAGGTGCAGGGG - Intergenic
1136086782 16:27890893-27890915 AGGGGAGGGAGCAGTGGCAGGGG + Intronic
1136296899 16:29308995-29309017 GGCAGAGGGAGCACGGGCAGAGG - Intergenic
1136366146 16:29810105-29810127 GGCAGCGGCAGCGGCGGCAGCGG + Exonic
1136366147 16:29810114-29810136 AGCGGCGGCAGCGGCAGCAGCGG + Exonic
1136394823 16:29987171-29987193 AGCAGCAGCAGCAGCAGGAGGGG - Exonic
1136398816 16:30006922-30006944 AGCAGGCGGAGCAGGGGCAGGGG - Exonic
1136455707 16:30378647-30378669 GCCAGAGGCAGCATGGGCAGCGG + Exonic
1136500870 16:30669197-30669219 AGCAGCAGCGGCAGCGGCGGCGG - Exonic
1136500872 16:30669203-30669225 GGCGGCAGCAGCAGCGGCAGCGG - Exonic
1136500873 16:30669209-30669231 AGCGGCGGCGGCAGCAGCAGCGG - Exonic
1136561546 16:31042143-31042165 GGCAGCGGCAGCAACAGCAGGGG - Intronic
1136768474 16:32811550-32811572 AGCGGCGGCAACAGCGGCGGCGG + Intergenic
1136776865 16:32876612-32876634 AGCAGCAGCAGCAGCAGCACTGG + Intergenic
1136893752 16:33984901-33984923 AGCAGCAGCAGCAGCAGCACTGG - Intergenic
1137531577 16:49281772-49281794 AGCGGCGGCGGCGGCGGCAGCGG - Exonic
1137548856 16:49423138-49423160 AGCAGAGGGAGCAGAGGCTCAGG - Intergenic
1137602157 16:49763653-49763675 AGCAAAGGAAGCAGAGGCAGCGG - Intronic
1137606920 16:49793216-49793238 AGCAGGGGCAGCAGGCACAGAGG + Intronic
1137655245 16:50153489-50153511 AGCAGCAGCAGCAGCAGCAGCGG + Intronic
1137655246 16:50153498-50153520 AGCAGCAGCAGCGGCAGCAGCGG + Intronic
1137668619 16:50266495-50266517 GGCAGCGGCAGCAGCGGCGGCGG - Exonic
1137786514 16:51141734-51141756 AGCAGCAGCAGCGGCGGCGGCGG - Exonic
1137786515 16:51141737-51141759 AGCAGCAGCAGCAGCGGCGGCGG - Exonic
1137786516 16:51141740-51141762 AGCAGCAGCAGCAGCAGCGGCGG - Exonic
1137786517 16:51141743-51141765 AGCAGCAGCAGCAGCAGCAGCGG - Exonic
1137791615 16:51179768-51179790 AGAAGAGGCAGCAGAGGAAAGGG + Intergenic
1137988576 16:53130806-53130828 AGCCGCGGCAGGAGCGGCGGCGG + Intronic
1137988714 16:53131316-53131338 AGCAGCGGCGGCGGCGGCGGCGG - Intronic
1138096851 16:54218706-54218728 ATCAGAGACAGCAGGTGCAGTGG + Intergenic
1138185346 16:54972544-54972566 AGCAAAAGCAGCACAGGCAGGGG - Intergenic
1138360744 16:56425426-56425448 GGCGGCGGCGGCAGCGGCAGCGG - Exonic
1138379428 16:56589956-56589978 AGCAGAGGGGGCGGCGGCAGAGG - Intronic
1138534221 16:57651393-57651415 AGTAGAGGCAGAAGTGGTAGAGG - Exonic
1139364878 16:66427168-66427190 GGCCGAGGCAGCGGCGGCGGCGG - Intergenic
1139956352 16:70694917-70694939 AGCAGAGGCAGCAGACCCGGAGG + Intronic
1139972161 16:70782991-70783013 AGCAGTGGCAGCCGTGGCTGTGG + Intronic
1140223302 16:73058868-73058890 AGCGGCGGCGGCGGCGGCAGCGG + Intronic
1140476950 16:75243877-75243899 CGATGGGGCAGCAGCGGCAGGGG - Intronic
1141054708 16:80804390-80804412 AGCAGCGGCGGCGGCGGCGGCGG + Intergenic
1141182403 16:81763205-81763227 AGCAGAATCATCTGCGGCAGTGG - Intronic
1141570742 16:84932186-84932208 GCCTGAGGCAGCAGAGGCAGTGG + Intergenic
1141589387 16:85057736-85057758 AGCAGAGGCAGCCTCTCCAGTGG - Intronic
1141809522 16:86365694-86365716 AGCTGTGGCAGCAGCTGCTGTGG + Intergenic
1141831145 16:86510531-86510553 AGCAGCGGCGGCAGCGGCGGCGG + Exonic
1141831146 16:86510534-86510556 AGCGGCGGCAGCGGCGGCGGCGG + Exonic
1141967778 16:87458547-87458569 AACAGAGGCTGCAGCTGCTGGGG + Intronic
1142034635 16:87855590-87855612 AGCAGAGCCGGCTGCCGCAGAGG - Intronic
1142067273 16:88069898-88069920 AGCAGAGGCAGAAGAGACAGAGG - Intronic
1142188306 16:88705366-88705388 AGCAAAATCAGCAGTGGCAGGGG - Intronic
1142263949 16:89055015-89055037 AGAACAGGCAGCAGCTGCAGAGG - Intergenic
1142362024 16:89631877-89631899 AGCAGAGGCAGCTGCAGAAAGGG + Intronic
1203070871 16_KI270728v1_random:1073604-1073626 AGCGGCGGCAACAGCGGCGGCGG + Intergenic
1203079281 16_KI270728v1_random:1138721-1138743 AGCAGCAGCAGCAGCAGCACTGG + Intergenic
1142764074 17:2056101-2056123 AGCGGAGGCAGCGGCTGCCGTGG - Intronic
1142764291 17:2056960-2056982 CGCAGAGGCGGCTGCGGCCGCGG + Exonic
1142840391 17:2623925-2623947 AGCAGAGCAACCAGGGGCAGTGG - Intronic
1143020839 17:3916545-3916567 CGCAGAGCCAGGAGGGGCAGTGG - Intergenic
1143063345 17:4222172-4222194 AGCAGGGGTAGCAGCAGCGGCGG - Intronic
1143120851 17:4605840-4605862 AGCAGAGTCAGAGGAGGCAGGGG + Intronic
1143130730 17:4675322-4675344 GGCAGCAGCAGCAGCCGCAGGGG + Exonic
1143494972 17:7307646-7307668 AGCAGCGGCGGCGGCGGTAGAGG + Intronic
1143514189 17:7411253-7411275 AGCAGGGGCAGGGGAGGCAGCGG + Intronic
1143519698 17:7438284-7438306 AGCTGAGGCGGCGGCGGCGGCGG - Intronic
1143576904 17:7799038-7799060 AGCAGAATCAGCGGGGGCAGCGG - Intronic
1143866312 17:9926384-9926406 AGGAGAGGCTGCAGCTGCAGTGG - Intronic
1144021037 17:11240647-11240669 TGCAGAGGCGGCGGCGGCGGCGG - Intergenic
1144328949 17:14207139-14207161 AGCATGAGCAGCAGCAGCAGCGG - Exonic
1144339673 17:14301368-14301390 AGCAGCAGCAGCGGCGGCCGCGG + Exonic
1144508099 17:15850643-15850665 AGGAGAGACAGCAGCTGCTGGGG - Intergenic
1144570724 17:16396803-16396825 AGCAGAAGCATCAGCAGCACAGG - Intergenic
1144591594 17:16528658-16528680 AGTGGAGGCAGCAGTGTCAGGGG + Intergenic
1144624680 17:16838708-16838730 AGCTGAGCCAGTAGAGGCAGTGG - Intergenic
1144778535 17:17796684-17796706 AGCAGCAGCAGCAACGCCAGTGG + Exonic
1144783143 17:17817739-17817761 GGCAGTGGCAGCGGTGGCAGTGG - Exonic
1144881750 17:18434013-18434035 AGCTGAGCCAGTAGAGGCAGTGG + Intergenic
1144958195 17:19030248-19030270 AGCAGCAGCAGCAGCAGCAAAGG + Intronic
1144976963 17:19144276-19144298 AGCAGCAGCAGCAGCAGCAAAGG - Intronic
1145150483 17:20510373-20510395 AGCTGAGCCAGTAGAGGCAGTGG - Intergenic
1145172219 17:20668281-20668303 AGGAGAGACAGCAGCTGCTGGGG - Intergenic
1145173952 17:20684335-20684357 AGCGGCAGCGGCAGCGGCAGAGG - Intergenic
1145173953 17:20684341-20684363 AGCGGCAGCGGCAGCGGCAGCGG - Intergenic
1145173954 17:20684347-20684369 AGCGGCAGCGGCAGCGGCAGCGG - Intergenic
1145217344 17:21061854-21061876 TGCAGGAGCAGCAGTGGCAGTGG - Intergenic
1145248463 17:21284789-21284811 AGCAGCGGCGGCGGCGGCGGCGG - Exonic
1145314831 17:21723406-21723428 GGCAGAGGCGGCAGCAGGAGTGG - Intergenic
1145368415 17:22286371-22286393 AGCAGCAGCAGGAGCAGCAGTGG + Intergenic
1145368417 17:22286377-22286399 AGCAGGAGCAGCAGTGGCGGTGG + Intergenic
1145713272 17:26995343-26995365 GGCAGAGGCGGCAGCAGGAGCGG - Intergenic
1145846568 17:28043086-28043108 AGCTGCGGCAGCCGCAGCAGCGG + Exonic
1145883567 17:28368289-28368311 AGCACAGCCAGCAGAGGGAGGGG - Intronic
1145916205 17:28575575-28575597 AGGAGAGGCAGCAGAGGGTGAGG - Intronic
1146492368 17:33292186-33292208 AGCAGTGGAAGCAGCAGCAGCGG + Exonic
1146502554 17:33376761-33376783 AGAAGTGGCAGCAATGGCAGAGG - Intronic
1146557582 17:33839797-33839819 AGCAGCAGCAGCAGCAGCAATGG + Intronic
1146896588 17:36545650-36545672 GGCAGAAACAGCAGCGGCGGCGG + Exonic
1146918000 17:36690443-36690465 AGCAGAGGCAGCGGCTGGAGAGG + Intergenic
1147047305 17:37762802-37762824 AGGAGCAGCAGCGGCGGCAGCGG + Intergenic
1147438356 17:40431644-40431666 AGCAGGGAAAGCAGGGGCAGAGG - Intergenic
1147512642 17:41084539-41084561 AGCAGGGGCGGCAGCAGCTGGGG - Exonic
1147517944 17:41139983-41140005 AGCAGGGGCGGCAGCAGCACGGG + Exonic
1147674213 17:42193547-42193569 AGCAGCAGCAGCAGCAGCAGTGG + Exonic
1147915296 17:43882102-43882124 TGCAGGTGCAGCAGCGGCAGAGG + Intronic
1147948435 17:44093399-44093421 AGCTGGAGCAGCAGCGGCAGCGG - Exonic
1147954261 17:44123535-44123557 GGCGGCGGCAGCAGCGGCGGCGG + Exonic
1148021691 17:44557710-44557732 AGCAGCGGCAGCAGCAGGCGGGG - Exonic
1148028000 17:44601559-44601581 GGCAGAGGAAGCACCTGCAGGGG + Intergenic
1148054825 17:44787701-44787723 GGCAGTGGGAGCGGCGGCAGTGG - Intergenic
1148189591 17:45669247-45669269 AGCAGCAGCAGCAGCAGCAGTGG - Intergenic
1148496968 17:48058830-48058852 AGCAGAGGAAGAAGAGGAAGAGG - Exonic
1148664150 17:49362076-49362098 CGCTGCGGCGGCAGCGGCAGCGG - Intronic
1148711429 17:49684193-49684215 AGCAGCAGCAGCAGCAGCAGTGG - Intergenic
1148714720 17:49707874-49707896 GGCACCGGCAGCAGCGGCGGCGG + Exonic
1148878538 17:50707616-50707638 AGCAGAAGGAGCAGCAGGAGAGG - Exonic
1148994821 17:51700507-51700529 AGCAGAGGAAGCAGGTGCCGTGG - Intronic
1149038174 17:52158098-52158120 AGCAGCGGCGGCGGCGGCGGCGG + Exonic
1149232647 17:54553658-54553680 GGCAGTGGCAGCAGCAGCAGTGG + Intergenic
1149446389 17:56716586-56716608 AGCAGTGGCCCCAGAGGCAGAGG - Intergenic
1149468900 17:56900526-56900548 AGGAGTGGGAGCAGTGGCAGGGG + Intronic
1149491929 17:57091372-57091394 AGCAGAGACAGCAGCAGCTTTGG - Intronic
1149567784 17:57652121-57652143 ACCAGTGGCAGCAGCGGCGGTGG + Exonic
1149599705 17:57885518-57885540 AGCAGCGGCAGCGGCGGGGGTGG - Exonic
1149599706 17:57885521-57885543 AGCAGCAGCGGCAGCGGCGGGGG - Exonic
1149599711 17:57885527-57885549 CGCCGGAGCAGCAGCGGCAGCGG - Exonic
1149963267 17:61135975-61135997 AGCAGCAGCAGCAGCAGCAGCGG - Intronic
1149994709 17:61400371-61400393 GGCGGCGGCAGCAGCGGCCGAGG + Exonic
1150217155 17:63477137-63477159 AGCAGCAACAGCAGCGGCAGCGG - Intergenic
1150599692 17:66640030-66640052 AGCAGAGGCCCCAGAAGCAGAGG + Intronic
1151229901 17:72677099-72677121 TGCACAAGCAGCAGCCGCAGTGG + Intronic
1151328998 17:73395712-73395734 AGCAGAGACAGCAGAGCCAAAGG - Intronic
1151382848 17:73737428-73737450 AGCAGGGCCCGCAGAGGCAGAGG - Intergenic
1151977002 17:77488820-77488842 AGTAGAGGCAGCAGTGGACGCGG - Exonic
1152070022 17:78129755-78129777 AGCAGTGGGAGGAGAGGCAGGGG - Intronic
1152075521 17:78157326-78157348 AGCAGCGGCGGCGGCGGCGGCGG + Intronic
1152164050 17:78689948-78689970 AGCGGAAGCAGCGGTGGCAGGGG - Intronic
1152228295 17:79102670-79102692 AGCAGAGGCAGCAGTGGCAATGG - Intronic
1152415829 17:80161168-80161190 AGGAGCAGCAGCAGCAGCAGGGG + Intergenic
1152533529 17:80936987-80937009 AGCAGAGGAAGAGGCGGAAGAGG - Intronic
1152533531 17:80936996-80937018 GACAGAGGCAGCAGAGGAAGAGG - Intronic
1152608854 17:81305978-81306000 AGCAGAGGAGGCACCTGCAGAGG + Intergenic
1152629346 17:81403111-81403133 AGCAGAGGCGCCAGCCCCAGTGG - Intronic
1152698803 17:81809043-81809065 AGCAGCAGCAACAGCAGCAGGGG - Exonic
1152735943 17:81996794-81996816 AGCAGGAGCAGGAGCGGGAGCGG + Exonic
1152735952 17:81996824-81996846 AGCAGGAGCAGGAGCGGGAGCGG + Exonic
1152896060 17:82912063-82912085 AGCAGAGGCAGCTGGGGCAGTGG + Intronic
1152924157 17:83079888-83079910 AGCAGCGGGAGCGGCGGCGGGGG - Exonic
1152924162 17:83079897-83079919 AGCAGGAGCAGCAGCGGGAGCGG - Exonic
1153013794 18:565281-565303 AGCAGCAGCAGCAGCAGCAGTGG - Intergenic
1153051122 18:904551-904573 AGCAGAAGCCGCAGCTTCAGAGG + Intergenic
1153187696 18:2503025-2503047 AGAAGAAGCAGCGGTGGCAGAGG + Intergenic
1154026866 18:10716199-10716221 GGCAGAGGCAGCAGAGGTGGAGG - Intronic
1154268537 18:12899486-12899508 AGAGGAGGCAGCAGCAGAAGGGG + Intronic
1155191938 18:23437921-23437943 CGCAGCAGCAGCAGCGGCAGCGG + Intronic
1155392632 18:25351889-25351911 AGCAGCGGCGGCAGCGGCGGCGG + Intronic
1155517516 18:26638457-26638479 AGCTGTAGCAGCAGCCGCAGTGG + Intronic
1156294069 18:35774108-35774130 ATCAGAAGCTGCAGCAGCAGAGG - Intergenic
1156756877 18:40538382-40538404 TGCAGCAGCAGCAGCAGCAGTGG - Intergenic
1157095015 18:44679679-44679701 AGCAGCGGCGGCGGCGGCGGCGG + Intergenic
1157593699 18:48851174-48851196 AGTAGGGGGAGCAGGGGCAGTGG + Intronic
1157965731 18:52206171-52206193 AGCAGAGGGAGCAAGGGCAGTGG + Intergenic
1158517091 18:58139707-58139729 AGCAGAGGCAGCTGTGCCTGAGG + Intronic
1158597337 18:58827915-58827937 ACCAGGGCCAGCAGCTGCAGAGG - Intergenic
1158632950 18:59132112-59132134 AGCAGAGCCAGCACAGGGAGTGG - Intergenic
1158643142 18:59220158-59220180 AGCAGTAGCACCAGCGGCTGCGG + Exonic
1158878314 18:61753135-61753157 AGCTCAGGCAGGAGCAGCAGTGG + Intergenic
1158976510 18:62715776-62715798 AGCAGCAGCAGCGGCGGCCGCGG + Exonic
1159102217 18:63970127-63970149 AGCAGCGGCGGCGGCGGCGGCGG + Exonic
1159131886 18:64288971-64288993 AGCAGAGCCAGCATGTGCAGAGG + Intergenic
1159300972 18:66567245-66567267 AGAAGAAGAAGCAGTGGCAGAGG + Intronic
1159462067 18:68734326-68734348 ACCAGAGGCTGCAGCGTTAGGGG + Intronic
1159874953 18:73800627-73800649 AGCAGAGGCAGCAGCTGGACGGG + Intergenic
1160024960 18:75209299-75209321 AGCAGCGGCCGGGGCGGCAGCGG - Exonic
1160050477 18:75428762-75428784 TGCAGAGGGAGCAGAGACAGAGG + Intergenic
1160058545 18:75509154-75509176 AGTAGCAGCAGCAGCAGCAGCGG + Intergenic
1160072449 18:75640500-75640522 ATCAGAGGCAGCAGTGGTTGTGG - Intergenic
1160191187 18:76715115-76715137 AGCAGAGGAAGCAGGCTCAGAGG - Intergenic
1160240635 18:77119946-77119968 CGCAGTGGGAGCAGCTGCAGTGG + Intronic
1160443817 18:78912462-78912484 GGCAGAGGCAGCCGTGGGAGTGG - Intergenic
1160805005 19:988764-988786 AGTGGTGGCAGCAGAGGCAGGGG - Intronic
1160829835 19:1098590-1098612 AGGGGAGGCAGCAGCAGGAGGGG + Intergenic
1160865513 19:1254291-1254313 AGCAGCGGCGGCGGCCGCAGCGG - Exonic
1160870481 19:1275571-1275593 AGCAGGAGCAGCAGCAGCGGCGG - Exonic
1160935496 19:1592693-1592715 AGCGGAGGCAGCTGAGGCGGCGG - Exonic
1160935500 19:1592711-1592733 GGCGGCGGCGGCAGCGGCAGCGG - Intronic
1161296503 19:3523093-3523115 GGCAGAGGCAGCTGGGGGAGGGG - Intronic
1161378385 19:3951473-3951495 AGCAGAGCCCGCAGCTGCCGTGG - Intergenic
1161568532 19:5017010-5017032 GGCAGAGGTGGCAGTGGCAGCGG + Intronic
1161751716 19:6102576-6102598 AGGAGAGGCAGAAGAGGCAGGGG - Intronic
1161973305 19:7595874-7595896 AGCAGCGGCGGCGGCGGCGGCGG + Intergenic
1162195049 19:8978157-8978179 AGCAGAGAGAGAAGTGGCAGAGG + Exonic
1162315558 19:9936326-9936348 AGCAGCAGCAGCAGCGGCGGCGG + Exonic
1162385724 19:10359482-10359504 AGCAGAGGCAGCGGTGGATGAGG + Intronic
1162581620 19:11534760-11534782 AGAAGGAGCAGCAGCAGCAGCGG + Intergenic
1162581621 19:11534766-11534788 AGCAGCAGCAGCAGCGGAAGAGG + Intergenic
1162664954 19:12202525-12202547 AGCAGCAGCAGCAGCAGCAGAGG - Intergenic
1162752689 19:12838525-12838547 AGGTGCGGCAGCAGCGGCGGAGG - Exonic
1163023480 19:14496063-14496085 GGCGGAGGCAGCGGCGGCGGCGG - Exonic
1163152400 19:15423084-15423106 GGCACAGACAGCGGCGGCAGAGG - Exonic
1163220047 19:15912094-15912116 AGGAGCAGCAGCAGCAGCAGCGG + Intergenic
1163294959 19:16405988-16406010 GGGAGAGGCAGCAGCAGCTGGGG + Intronic
1163666597 19:18606589-18606611 AGCAGGGGCAGCAACGGCGGCGG + Exonic
1163668235 19:18612980-18613002 AGCAGCAGCAGCAGCGGCGGTGG - Exonic
1163668236 19:18612983-18613005 AGCAGCAGCAGCAGCAGCGGCGG - Exonic
1163668237 19:18612986-18613008 AACAGCAGCAGCAGCAGCAGCGG - Exonic
1163856164 19:19703955-19703977 AGCAGCAACAGCAGCAGCAGAGG + Intergenic
1164825137 19:31279305-31279327 AGCAGCAGCAGCTGTGGCAGCGG - Exonic
1164834533 19:31349239-31349261 AGCGGCGGCGGCGGCGGCAGTGG - Exonic
1165218792 19:34297503-34297525 GCCAGAGGCAGCCGCGGTAGAGG + Intronic
1165293305 19:34906186-34906208 AGCAGCGGCAGTGGCAGCAGCGG - Intergenic
1165310302 19:35025857-35025879 CTCAGAGGCAGCAGAGGAAGGGG - Intronic
1165332931 19:35151354-35151376 AGCAGAGGAAGCGGAGGCTGAGG - Intronic
1165362742 19:35346713-35346735 AGCAGAGGCACTGGGGGCAGCGG + Exonic
1165386096 19:35511490-35511512 AGCAGTGGCAGCAGCAGTGGCGG - Exonic
1165386098 19:35511505-35511527 AGCAGTGGTGGCAGCAGCAGTGG - Exonic
1165448291 19:35868691-35868713 AGTGGCAGCAGCAGCGGCAGCGG - Exonic
1165460404 19:35940651-35940673 AGCAGAGGCAGCGGAGGGTGGGG - Exonic
1165489580 19:36115479-36115501 AGCAGCAGCAGCGGCGGCGGCGG + Exonic
1165489581 19:36115485-36115507 AGCAGCGGCGGCGGCGGCTGCGG + Exonic
1165541810 19:36498101-36498123 AGCGGCGCCAGCAGCGGGAGGGG + Intergenic
1165776173 19:38405560-38405582 GGAGGAGGCAGCGGCGGCAGCGG - Exonic
1165830596 19:38728533-38728555 GGCAGATGCAGCAGAGGAAGAGG - Intronic
1166042583 19:40212831-40212853 AGCAGTGGCAGCAGCAGTGGAGG + Exonic
1166140154 19:40801026-40801048 TGCAGCTGCAGCAGTGGCAGTGG + Exonic
1166163783 19:40971852-40971874 GGCATGGGCAGCAGTGGCAGAGG + Intergenic
1166529343 19:43533441-43533463 AGCAGCGGCGACAGCGGCTGCGG + Exonic
1166551746 19:43670086-43670108 AGCAGCAGCAGCGGCAGCAGCGG + Exonic
1166694847 19:44846583-44846605 AGGAGCAGCAGCAGCAGCAGCGG - Exonic
1166731908 19:45064125-45064147 TGCTGCGGCAGCAGCGGCTGCGG - Exonic
1166748338 19:45152508-45152530 TGCAGCAGCAGCAGCAGCAGGGG - Exonic
1166792943 19:45408637-45408659 ACCAGAGGCAGCAGGGCCTGTGG + Exonic
1166856679 19:45785817-45785839 GGCAGTGGCGGCAGTGGCAGTGG - Exonic
1167052249 19:47086448-47086470 GGCAGGGGCAGCCGAGGCAGGGG - Exonic
1167147825 19:47693751-47693773 AGCAGAGGCAGTGGTGGCGGTGG - Intronic
1167147828 19:47693760-47693782 AGCAGAGGAAGCAGAGGCAGTGG - Intronic
1167249991 19:48394538-48394560 AGCCGGGGCTGAAGCGGCAGAGG + Intergenic
1167338469 19:48900836-48900858 AGCAGGAGCAGCAGCAGCAGCGG - Exonic
1167439670 19:49500877-49500899 CCCCGAGGCAGCAGCGGCAGCGG - Intergenic
1167454569 19:49591563-49591585 AGCGGAGGGAGCGGCGGCGGAGG + Intergenic
1167455422 19:49595084-49595106 AGCGGCGGCGGCAGCGGAAGAGG - Exonic
1167461440 19:49626483-49626505 GGCAGTGGTAGCAGGGGCAGAGG + Intergenic
1167463875 19:49640103-49640125 AGCGAAGGCAGCAGCAGCGGTGG - Exonic
1167503922 19:49861643-49861665 TGAAGAGGAAGCAGCGGCAGGGG + Exonic
1167529043 19:50003397-50003419 TGCAAAGGCAGAAGCTGCAGAGG + Intronic
1167581313 19:50344724-50344746 AGCAAGGGTAGCAGCAGCAGTGG + Intronic
1167610553 19:50506017-50506039 TATTGAGGCAGCAGCGGCAGTGG + Exonic
1167633485 19:50639799-50639821 GGCGGCGGCAGCGGCGGCAGCGG - Intronic
1167659895 19:50790451-50790473 AGCAGCAGCAGCAGCAGGAGAGG - Exonic
1167726310 19:51215501-51215523 GGCAAAGGCAGCAGCAGCTGTGG + Intergenic
1167785217 19:51630307-51630329 AGCAGGGGCAGCAGCAGCAGGGG + Intronic
1167787316 19:51646731-51646753 AGCAGGGGCAGCAGCAGCAGGGG + Exonic
1168073405 19:53964957-53964979 AACAGAGGAAGAAGGGGCAGAGG - Intronic
1168468972 19:56625638-56625660 AGCAGAGTGAGCAGGGGGAGCGG - Exonic
925098476 2:1226391-1226413 AGCATAGGCAGCAGTGGGTGGGG + Intronic
925378038 2:3402553-3402575 AGCCGAGGCTGGAGTGGCAGTGG - Intronic
925609912 2:5693754-5693776 AGCAGCAGCGGCAGCAGCAGCGG + Exonic
926054550 2:9766783-9766805 GGCAGAGGCAGAAGAGGTAGAGG - Intergenic
926123577 2:10257725-10257747 AGCAGGGGCAGCTGCAGCAGGGG - Intergenic
926128497 2:10286140-10286162 CCCAGGGGCAGCAGCGGGAGGGG + Intergenic
926163374 2:10503383-10503405 GACAGAGGCAGCTGAGGCAGAGG - Intergenic
926173693 2:10570200-10570222 AGCACAGAGAGCAGAGGCAGGGG + Intergenic
926873174 2:17445897-17445919 ACCACAGGCAGCCGCAGCAGTGG - Intergenic
927055380 2:19361514-19361536 AGCAGAAGCTGCAGCCGCGGTGG - Intergenic
927195024 2:20541025-20541047 GGCAGATGGAGCAGCTGCAGAGG + Intergenic
927400344 2:22703699-22703721 AGCAGCAGCAGCAGTGGCAGTGG - Intergenic
927432888 2:23041850-23041872 AGCAGAGGCCACAGGGGCAGAGG - Intergenic
927506995 2:23621181-23621203 AGCAGCAGCAGCAGCAGCTGAGG + Intronic
927645097 2:24872564-24872586 AGCAGAGCCAGCAGCAGGTGAGG - Exonic
927684577 2:25161583-25161605 AGCAGCGGCAGCAGCGGCGCAGG - Exonic
927684578 2:25161589-25161611 AGCAGCAGCAGCGGCAGCAGCGG - Exonic
927772810 2:25878359-25878381 AGCAGAGGAAGCGGCGGGGGTGG + Intronic
927936419 2:27079080-27079102 AGCAGAGGTAGCAGCTCCAGAGG - Exonic
927983811 2:27393382-27393404 AGAGGCGGCGGCAGCGGCAGTGG + Intronic
928205117 2:29278428-29278450 AGGAGAGGAGGCAGAGGCAGGGG + Intronic
928392994 2:30923555-30923577 AGGAGAGGCAGGAGATGCAGAGG + Intronic
928393614 2:30927787-30927809 AGGAGAGGCAGCAGGGCCAGTGG + Intronic
928408199 2:31031541-31031563 AGCAGAGGTACCAGTGGCATTGG - Intronic
928466455 2:31527394-31527416 ATCAGAGGCAGCACGGGCGGAGG - Intronic
928606407 2:32947797-32947819 ACCAGAAGCAGCAGCTGCAGGGG + Exonic
928610338 2:32986279-32986301 TGCAGAGGCAGCCGGGGCTGAGG + Intronic
928823622 2:35392165-35392187 AACAGAGACTGCAGGGGCAGGGG + Intergenic
929347143 2:40898201-40898223 AATAGAGGCACCAGAGGCAGGGG + Intergenic
929655734 2:43729958-43729980 AGCAGTGGAAGCAAAGGCAGAGG - Intronic
930011481 2:46941220-46941242 GGCTGTGGCAGCAGCTGCAGCGG + Exonic
930011484 2:46941229-46941251 AGCAGCTGCAGCGGCGGCGGCGG + Exonic
930092581 2:47541979-47542001 AGCAGCAGCAGCAGCAGCAGCGG + Intronic
930096429 2:47570253-47570275 AGCAGCAGCAGCAGCAGGAGGGG + Exonic
930234237 2:48873670-48873692 AGCAGAGGGAGCAGGGGAACAGG + Intergenic
931257437 2:60585550-60585572 AGGAGAGGCGGCAGCGGCGGAGG - Intergenic
931356032 2:61538224-61538246 AGAAGCGGCTGCAGCGGCCGCGG - Exonic
931429224 2:62196129-62196151 CGCAGCGGCAGCGGCAGCAGCGG + Exonic
931535545 2:63271682-63271704 GGCAGTGGAAGCAGTGGCAGTGG - Intronic
931602597 2:64019231-64019253 GGCGGTGGCAGCAGCGGCGGAGG - Intergenic
932082396 2:68726850-68726872 AGCAGAGGCAGACCTGGCAGAGG - Intronic
932208182 2:69902811-69902833 GGCAGCGGCAGCAGCGGAAGGGG - Intronic
932208185 2:69902817-69902839 AGAAGCGGCAGCGGCAGCAGCGG - Intronic
932208186 2:69902826-69902848 AGCAGCAGAAGAAGCGGCAGCGG - Intronic
932253067 2:70260797-70260819 AGCAGAGGCAGCATCTACAGAGG - Intronic
932593712 2:73081504-73081526 AGCAGTGGCAGCAGCGGGGGAGG + Intronic
932699807 2:73984948-73984970 GGAAGAGGCAGCGGCGGCCGCGG - Intergenic
932749234 2:74360891-74360913 AGCAGAGGCAGGGTTGGCAGAGG + Intronic
932773957 2:74516052-74516074 AGCGGCGGCCGCAGCGGCCGTGG - Exonic
933092969 2:78145421-78145443 AGCAGCTGCAGGAGCGGCAGTGG + Intergenic
934296825 2:91749047-91749069 AGCAGCGGCAGCGGCAGCGGTGG - Intergenic
934296826 2:91749050-91749072 AGCAGCAGCGGCAGCGGCAGCGG - Intergenic
934296827 2:91749056-91749078 AGCAGCAGCAGCAGCGGCAGCGG - Intergenic
934525328 2:95048281-95048303 AGCAGAATCAGGAGAGGCAGGGG + Intronic
934613028 2:95754849-95754871 ACCAGTAGCAGCAGCGGGAGAGG + Intergenic
934647876 2:96069573-96069595 ACCAGTAGCAGCAGCGGGAGAGG - Intergenic
934771080 2:96907930-96907952 AGCTCAGGAAGCAACGGCAGTGG + Intronic
934841248 2:97625394-97625416 ACCAGTAGCAGCAGCGGGAGAGG - Intergenic
934853819 2:97717095-97717117 AACAGAGGCAGCATAGGCACTGG - Intronic
934949156 2:98564534-98564556 AGCAGTGGCAGCAGAGGAAGGGG + Intronic
934966851 2:98731101-98731123 AGCGGCGGCGGCAGCGGCGGCGG - Intronic
935060319 2:99601547-99601569 AGCAGCAGCAGCAGCAGCAGCGG - Exonic
935196525 2:100819871-100819893 AGCAGAGGCTGCGGCGGCCTGGG + Intergenic
935818436 2:106869569-106869591 AGCAAAAGCAGCAGCAGGAGGGG - Intronic
936068340 2:109348798-109348820 AGCAGGTGCAGCAGTGGCAGGGG - Intronic
936221928 2:110610788-110610810 GGCAGCGGCGGCAGCGGCGGCGG - Intergenic
936221930 2:110610794-110610816 GGCGGCGGCAGCGGCGGCAGCGG - Intergenic
936254998 2:110903920-110903942 AGCAGAGGTAGCAGAGACCGAGG - Intronic
936278770 2:111120969-111120991 GGCGGCGGCGGCAGCGGCAGCGG - Exonic
936781626 2:116039856-116039878 AGCGGCAGCGGCAGCGGCAGCGG - Intergenic
936781627 2:116039862-116039884 AGCGGCAGCGGCAGCGGCAGCGG - Intergenic
936781628 2:116039868-116039890 AGCAGCAGCGGCAGCGGCAGCGG - Intergenic
936781629 2:116039874-116039896 AGGAGCAGCAGCAGCGGCAGCGG - Intergenic
936939611 2:117870987-117871009 GGAGGAGGCAGCGGCGGCAGTGG - Intergenic
937045118 2:118847043-118847065 GCCAGCGGCAGCAGCGGCAGCGG - Exonic
937091206 2:119207569-119207591 AGCAAAGTCAGCAGGGCCAGTGG + Intergenic
937098259 2:119249552-119249574 AGCAGGAGCAGGAGCTGCAGGGG - Intronic
937205918 2:120237097-120237119 GGCAGAGGCTGGAGGGGCAGAGG + Intergenic
937438586 2:121898429-121898451 GGCAGAGGGCGCAGTGGCAGAGG + Intergenic
937533980 2:122863635-122863657 AACAGAGGATGCACCGGCAGAGG + Intergenic
937789435 2:125943147-125943169 ACCTGAGCCAGCAGCTGCAGAGG - Intergenic
937884199 2:126889119-126889141 AGTGGAGGCAGCTGCTGCAGAGG - Intergenic
937884463 2:126890375-126890397 AGCAGAGACAGAAACAGCAGGGG - Intergenic
937906202 2:127054016-127054038 GGCAGCAGCAGCAGCAGCAGAGG + Intronic
938115421 2:128599957-128599979 AGCAGTGCCAGCAGAGGCCGAGG + Intergenic
938318014 2:130343159-130343181 AGGAGAGGAAGGAGCGGCTGCGG + Exonic
938385989 2:130867819-130867841 TGCAGAGGAAACAGCAGCAGTGG - Intronic
938768902 2:134483054-134483076 AGGTAAGGCAGCAGCGGCCGAGG + Intronic
938820613 2:134954735-134954757 AGCAGTGGCAGCAACAGCAGGGG - Exonic
939668197 2:144976797-144976819 AGCAGCAGCAGCAGTGGGAGGGG - Intergenic
939853355 2:147326591-147326613 AGCAGAGGCAGAAGAGGTGGAGG - Intergenic
939900546 2:147844763-147844785 CGAAGAGGCGGCGGCGGCAGCGG - Exonic
940684301 2:156827248-156827270 GGTAGAGGCAGCAGTGGCGGTGG - Intergenic
940775002 2:157876060-157876082 GGCAGCGGCAGCGGCGGCAGCGG + Intergenic
941102181 2:161308517-161308539 GACAGAGGCAACAGCAGCAGCGG - Exonic
941686849 2:168456332-168456354 AGCAGCGGCGGCGGCGGCACAGG + Exonic
941703062 2:168626356-168626378 TACAGAGGCAGCAGAAGCAGGGG - Intronic
941933240 2:170963424-170963446 AGCAGCAGCAGCAGTAGCAGCGG - Intronic
942053703 2:172163258-172163280 AGCGGGAGCAGCAGTGGCAGTGG - Intergenic
942278197 2:174337453-174337475 GGCAGCGGCGGCGGCGGCAGCGG + Exonic
942997125 2:182276301-182276323 AGCAGCTGGAGCCGCGGCAGAGG + Intronic
943093743 2:183404470-183404492 AGCAGCAGCAGCAGCAGCAGTGG + Intergenic
943093745 2:183404485-183404507 AGCAGTGGCAGCAGCAGCGGCGG + Intergenic
943103509 2:183514232-183514254 AGCAGAGGCAGAAGAGGTGGAGG - Intergenic
944154135 2:196593220-196593242 TGTCGAGTCAGCAGCGGCAGCGG + Intronic
944395388 2:199260676-199260698 TTCAGAGGCAGCAGGGGCAGAGG + Intergenic
944743728 2:202635605-202635627 AGCAGCGGCGGCGGCGGCGGCGG - Exonic
944801295 2:203239723-203239745 CGCAGAGGCGTCAGCGGCAGAGG - Intronic
944817778 2:203396779-203396801 AGCAGAGCCAGCAGGGGCTGAGG - Exonic
945080063 2:206079558-206079580 AGAGGAGGTAGCAGTGGCAGAGG - Intronic
945239032 2:207659771-207659793 AGCAGGGTCAGCCGGGGCAGGGG + Intergenic
945377625 2:209097371-209097393 AGCAGCAGCAGCAGCAGCAGTGG + Intergenic
946019843 2:216633554-216633576 AGCAGCGGCGGCGGCGGCAGCGG - Exonic
946019845 2:216633563-216633585 AGCAGCGGCAGCAGCGGCGGCGG - Exonic
946019847 2:216633569-216633591 AGCAGCAGCAGCGGCAGCAGCGG - Exonic
946038491 2:216763875-216763897 AGCACAGGCAGCAGGTCCAGTGG + Intergenic
946181767 2:217953237-217953259 AGCAGAGGCTGGGGCGGAAGGGG + Intronic
946182965 2:217960011-217960033 AGGAGGAGCAGCAGCTGCAGAGG + Intronic
946239353 2:218344530-218344552 TGCAGTGGGTGCAGCGGCAGCGG + Exonic
946280904 2:218664793-218664815 ACCAGAGGCAGCAGGAGCGGGGG - Exonic
946395430 2:219441864-219441886 GGCGGCGGCAGCAGCGGCGGCGG - Intronic
946410843 2:219514501-219514523 AGCAGAGGCAGCAGCGGCAGAGG + Exonic
946433776 2:219639066-219639088 AGCAGTGGCATCCGGGGCAGGGG + Intronic
946977059 2:225164718-225164740 AGCAGCAGCAGCAGCAGCAAGGG - Intergenic
947763774 2:232622708-232622730 AGGAGAGGCAGCAGCTGCTCCGG + Intronic
947831525 2:233144866-233144888 TGCAGAGGCAGCAGTGGTAATGG + Intronic
947896472 2:233678425-233678447 GGCAGAGGCAGAAGAGGTAGAGG + Intronic
947901571 2:233725207-233725229 GGCAGAGGCAGAGGAGGCAGAGG + Intronic
947901572 2:233725213-233725235 GGCAGAGGAGGCAGAGGCAGAGG + Intronic
947901574 2:233725222-233725244 GGCAGAGGCAGAGGAGGCAGAGG + Intronic
947901575 2:233725228-233725250 GGCAGAGGAGGCAGAGGCAGAGG + Intronic
947901577 2:233725237-233725259 GGCAGAGGCAGAGGAGGCAGAGG + Intronic
947901578 2:233725243-233725265 GGCAGAGGAGGCAGAGGCAGAGG + Intronic
947901580 2:233725252-233725274 GGCAGAGGCAGAGGAGGCAGAGG + Intronic
947901581 2:233725258-233725280 GGCAGAGGAGGCAGAGGCAGAGG + Intronic
948044811 2:234935512-234935534 AGCAGAGGCAGCCGAGGGAAAGG + Intergenic
948119163 2:235516053-235516075 AGCAGCAGCAGCAGCAGCAGAGG - Intronic
948120981 2:235530189-235530211 ACCAGAGCCAGCTGCTGCAGAGG + Intronic
948614483 2:239189914-239189936 AGCAGAAGCAGCAGATCCAGAGG - Exonic
948668508 2:239551593-239551615 TGCAGAGGCTGAAGAGGCAGTGG + Intergenic
949066303 2:241992913-241992935 AGCTGGGGCAGCAGGGGCGGAGG - Intergenic
1168951195 20:1803360-1803382 AGCGGAGGGAGCGGCGGGAGCGG - Intergenic
1169037212 20:2463171-2463193 GGCTGTGGCAGCAGCTGCAGCGG + Exonic
1169131100 20:3166787-3166809 AGCGGAGGCAGCAGCAGCAGTGG - Exonic
1169171817 20:3471315-3471337 AGCAGCAGCAGCAGCAGCGGCGG - Exonic
1169171818 20:3471318-3471340 GGCAGCAGCAGCAGCAGCAGCGG - Exonic
1169197477 20:3691362-3691384 AGCAGAGGCAGCAGCCCCAGTGG + Exonic
1169488493 20:6052762-6052784 AGCACCGTCAGCAGCAGCAGCGG + Exonic
1170138481 20:13101825-13101847 AGCAGCAGCAGTAGCAGCAGCGG - Intronic
1170629730 20:18056805-18056827 GGCGGCAGCAGCAGCGGCAGCGG - Exonic
1170651321 20:18245271-18245293 AGGAGAGCCAGCAGGAGCAGGGG + Intergenic
1170924751 20:20712614-20712636 AGCTGAGGCGGCGGCGGCGGCGG - Intergenic
1171089230 20:22268255-22268277 AGAAGAAGCAGCAGCAGCAGTGG - Intergenic
1171266798 20:23777564-23777586 AGGAGAGGGAGCAGCAGCCGCGG + Intergenic
1172029046 20:31968682-31968704 AGAGGCGGCAGCAGCGGCGGCGG - Exonic
1172029047 20:31968685-31968707 TGCAGAGGCGGCAGCAGCGGCGG - Exonic
1172100890 20:32483556-32483578 AGCAGCGGCGGCAGCGGCGGCGG + Intronic
1172143964 20:32743451-32743473 GGCAGCGGTGGCAGCGGCAGCGG - Exonic
1172357085 20:34287782-34287804 AGCAGAAGTAGGAGCTGCAGTGG + Intronic
1172596593 20:36154715-36154737 AGCAGCGGCGGCGGCGGCGGCGG - Intronic
1172684895 20:36746076-36746098 AGCAGCGGCGGCGGCGGCGGCGG + Exonic
1172779382 20:37426795-37426817 GGCAGAGGCATCAGGGGAAGGGG - Intergenic
1172863482 20:38076560-38076582 AGCAGAGGCAGCAAGGGAAGTGG - Intronic
1173197351 20:40926604-40926626 TGAGGAGGCAGCAGTGGCAGCGG - Intergenic
1173353442 20:42265571-42265593 AAGACAGGCAGCAGAGGCAGGGG - Intronic
1173681548 20:44885763-44885785 TGCAGTGGCTGCAGCGGCGGCGG - Exonic
1174053917 20:47785441-47785463 GGCGGCGGCGGCAGCGGCAGCGG - Intronic
1174053921 20:47785459-47785481 AGCAGCGGCAGCGGCGGCGGCGG - Intronic
1174053924 20:47785468-47785490 GGGGGATGCAGCAGCGGCAGCGG - Intronic
1174078763 20:47956483-47956505 AGCGGAGTCAGCAGGGGGAGGGG + Intergenic
1175599325 20:60260083-60260105 TTCAGAGACAGCAGGGGCAGTGG - Intergenic
1175625580 20:60486064-60486086 AGCAGAGGCAGCTGGGGGTGGGG + Intergenic
1175915981 20:62426081-62426103 AGTGGAAGTAGCAGCGGCAGCGG + Intronic
1175915982 20:62426087-62426109 AGTAGCAGCGGCAGCGGCAGTGG + Intronic
1175915992 20:62426168-62426190 GGCAGTGGAAGCAGCGGCAGCGG + Intronic
1176091833 20:63321696-63321718 AGCAGAGGCAGCTGCAGCCATGG - Intronic
1176100162 20:63361119-63361141 AGCAGCGGCGGCAGCAGCCGCGG + Exonic
1176120824 20:63453779-63453801 AGCAGAGGGAGGAGCCGCTGGGG + Intronic
1176120918 20:63454266-63454288 AGGAGGGGCAGCGGCGGGAGGGG - Intronic
1176153330 20:63604782-63604804 TGCAGCGGCAGCAGCTGCCGCGG - Exonic
1176155627 20:63618740-63618762 AGCAGAGGCAGGAGTGACACCGG + Intronic
1176207096 20:63895148-63895170 AGCGGCAGCGGCAGCGGCAGCGG - Intergenic
1176227333 20:64008464-64008486 AGCAGCGTCAGGAGCTGCAGAGG + Intronic
1176240782 20:64074968-64074990 AGCAGAGGCAGAAGGGGAGGTGG - Intronic
1176241154 20:64076550-64076572 AGCACAGGCAGCAGGGGTTGCGG + Exonic
1176274420 20:64255718-64255740 CGCAGAGGCGGCGGCGGCGGCGG + Intronic
1176369226 21:6052457-6052479 AGAAGAGGCAGCTGCGGGGGTGG + Intergenic
1176377998 21:6096215-6096237 AGCAGAGGAAGCACAGGGAGAGG - Intergenic
1176380773 21:6111257-6111279 GGCGGCGGCAGCGGCGGCAGCGG + Intronic
1176380775 21:6111266-6111288 AGCGGCGGCAGCGGCGGCAGCGG + Intronic
1176906019 21:14502578-14502600 ACCTCAGGCAGCAGCAGCAGTGG + Intronic
1177431715 21:20998331-20998353 GGCAGAAGCAGCAGCAGCAGCGG - Exonic
1178487362 21:33027539-33027561 AGCGGCGGCAGCAGCCGCTGCGG - Exonic
1178640801 21:34343553-34343575 AGCAGGAGCAGCAGTGGCCGTGG + Intergenic
1178992442 21:37366990-37367012 AGCAGCAGCAGAAGCGGCGGCGG - Intronic
1179742697 21:43426974-43426996 AGCGGCGGCAGCGGCGGCAGCGG - Intronic
1179742699 21:43426983-43427005 GGCGGCGGCAGCGGCGGCAGCGG - Intronic
1179745475 21:43442033-43442055 AGCAGAGGAAGCACAGGGAGAGG + Intergenic
1179754293 21:43486084-43486106 AGAAGAGGCAGCTGCGGGGGTGG - Intergenic
1179775253 21:43658093-43658115 AGCGGAGGCGGCAGCGGCCATGG - Exonic
1180163277 21:46007371-46007393 AGCAGGGGCCGCAGGGGCTGAGG - Intergenic
1180220130 21:46353272-46353294 AGCAGAGGCTGCAGGGGGCGAGG + Exonic
1180559229 22:16601985-16602007 AGCAGCGGCGGCGGCGGCCGCGG + Intergenic
1180740850 22:18052392-18052414 AAAAAAGGCAGCAGCAGCAGAGG + Intergenic
1180855905 22:19044587-19044609 AGCAGAGCAAGCAGGGGCAGAGG + Intronic
1180962113 22:19766773-19766795 AGCTGCGGCAGCGGCGGCGGCGG - Exonic
1180962117 22:19766782-19766804 GGCCGCGGCAGCTGCGGCAGCGG - Exonic
1181169429 22:21000003-21000025 AGCGGCGGGAGCAGCGGCTGCGG - Exonic
1181493944 22:23277509-23277531 AGCAGCAGCAGCAGCAGCAGGGG - Intronic
1181560175 22:23695436-23695458 AGCAGCAGCAGCAGCAGCAGAGG - Intronic
1181594712 22:23906803-23906825 TGCAGAGGCCCCAGCAGCAGGGG - Intergenic
1181638196 22:24183964-24183986 CGCTGAGGCCGCAGAGGCAGGGG - Intronic
1182237019 22:28883863-28883885 AGCAGCGGCAGCGGCGGCGGCGG - Exonic
1182237020 22:28883866-28883888 AGCAGCAGCGGCAGCGGCGGCGG - Exonic
1182237024 22:28883872-28883894 AGCCCGAGCAGCAGCGGCAGCGG - Exonic
1182445114 22:30385494-30385516 AGCAGCAGCAGCAGTGGCAACGG + Intronic
1182532125 22:30968852-30968874 GGCGGAGGCAGCGGCGGCGGCGG - Intergenic
1182552435 22:31107465-31107487 AGAAGCAGCAGCAGCGCCAGCGG + Exonic
1182619511 22:31611197-31611219 AGCAGAGACTGCAGCTGGAGAGG + Exonic
1182794787 22:32984044-32984066 AGCTGAGGCAGGAGAGGCTGAGG + Intronic
1182910620 22:33981230-33981252 AGGAGAGGCAGATGGGGCAGGGG - Intergenic
1182944678 22:34310777-34310799 GGCAGAAGCAGCAGCTGCAGGGG - Intergenic
1183151052 22:36037669-36037691 GGCAAAGGCAGCAGGGGCTGAGG - Intergenic
1183547089 22:38460181-38460203 AGCAGGAGCAGCAGCGGGAAAGG - Intergenic
1183583717 22:38740163-38740185 AACAGAGGCTGCAGGGGCAAGGG + Intronic
1183601734 22:38844004-38844026 AGCGGCGGCAGCAGCGGCCGCGG - Intergenic
1183702324 22:39457513-39457535 AACGGCGGCAGCAGCGGCGGCGG - Exonic
1183816015 22:40301178-40301200 AGCAGCAGCAGCAGCAGCAGAGG + Exonic
1183951967 22:41357392-41357414 GGCGGTGGCAGCAGCAGCAGGGG - Exonic
1183988537 22:41582955-41582977 AGCAGGGGCAGTACAGGCAGAGG + Intronic
1184027245 22:41866947-41866969 AGCAGCAGCAGCAGCAGCAATGG + Exonic
1184027248 22:41866953-41866975 AGCAGCAGCAGCAATGGCAGGGG + Exonic
1184034495 22:41912063-41912085 AGCAGAAGCCGCGGCTGCAGGGG - Intronic
1184075360 22:42173829-42173851 AGCAGAGGCAGCAAAGCCAGAGG + Intronic
1184080386 22:42215145-42215167 AGTAGTGGCAGCAGTGGCAGTGG - Exonic
1184102398 22:42347711-42347733 AGCCGAGGCAGCGCCAGCAGGGG + Intergenic
1184102400 22:42347717-42347739 GGCAGCGCCAGCAGGGGCAGAGG + Intergenic
1184250315 22:43256486-43256508 AGTAGAAGTAGCAGCAGCAGGGG + Intronic
1184314189 22:43670865-43670887 AGCAGCAGCAGCAGCAGCAGCGG + Intronic
1184510510 22:44930574-44930596 GGCAGAGGCACCAGCAGCAGGGG + Intronic
1184519158 22:44982195-44982217 AGCAGAGGCGGCAGGGACACCGG - Intronic
1184554896 22:45227819-45227841 AGCAGAAGCAGCTCCGGCTGGGG + Intronic
1184591020 22:45483372-45483394 ACCAGATGTAGCAGCAGCAGTGG - Intergenic
1184608188 22:45586303-45586325 TGCAGAGGCGGCCACGGCAGGGG - Intronic
1184709105 22:46237652-46237674 AGCAATGGCAGCAGCAGCGGCGG + Exonic
1184726143 22:46347798-46347820 AGCAGAAGCAGCAGGGGCTGGGG - Intronic
1184866159 22:47202779-47202801 TGCAGGAGCAGCAGTGGCAGCGG - Intergenic
1184933730 22:47702257-47702279 AGCAGCAGCAGCAGCAGCAGCGG - Intergenic
1184991218 22:48171306-48171328 TGCAGAGGCAGCAGCCAGAGGGG - Intergenic
1185266604 22:49907248-49907270 CACATAGGTAGCAGCGGCAGAGG - Intronic
1185340701 22:50289671-50289693 AGCAGAGACAGCCGGAGCAGTGG - Exonic
949433878 3:4007296-4007318 AGCAGAGGCAGCATCTACAGGGG + Intronic
949474150 3:4426682-4426704 AGCAGAAGCAGCAGCATGAGTGG + Intronic
949595890 3:5547238-5547260 GGCAGCGGCAGCAGCAGAAGAGG + Intergenic
950000033 3:9649600-9649622 CGCCGAGGCAGCGGCGGCGGCGG - Exonic
950153812 3:10707943-10707965 AGCGGCGGCGGCAGCGGCGGCGG - Intronic
950452221 3:13071911-13071933 TGCTGACGCAGCAGAGGCAGAGG + Intronic
950488411 3:13286266-13286288 AGAAGAGGCAGGATTGGCAGAGG - Intergenic
950677588 3:14564021-14564043 AGCAGAGGAAGCAGCCCCAAGGG + Intergenic
950886341 3:16366171-16366193 GGCAGCGGCAGCAGCCTCAGTGG + Intronic
951080465 3:18445290-18445312 AGCAGCGGCGGCGGCGGCGGCGG - Intronic
951217622 3:20040191-20040213 GGCGGCGGCGGCAGCGGCAGCGG + Exonic
951702372 3:25509384-25509406 AGCTGTGGCAGCAGCAACAGCGG - Intronic
951718668 3:25674798-25674820 TGCAGGAGCAGCAGTGGCAGTGG - Intergenic
952098981 3:29989448-29989470 AGCAAAGACATCAGCTGCAGGGG - Intronic
952483638 3:33787607-33787629 GGCAGAGGTAGCAGAGGCTGGGG + Intergenic
952533448 3:34286132-34286154 AGCAGCAGCAGCAGCAGGAGTGG - Intergenic
952644645 3:35640085-35640107 ACCAGCAGCAGCAGGGGCAGCGG + Intronic
952929241 3:38346883-38346905 AGCCCAGGCAGCAGCGGCGAGGG - Exonic
953801815 3:46030714-46030736 AGCAGCTGCAGGAGCAGCAGTGG + Intergenic
954210410 3:49093927-49093949 AGCGGAGGCGGCGGCGGCGGCGG - Exonic
954388183 3:50255278-50255300 AGCAGAGGCAGGCCCTGCAGGGG + Intronic
954408427 3:50358534-50358556 AGCAGCGCCAGCAGCAGCATGGG + Exonic
954417450 3:50400283-50400305 GGCCGAAGCAGCAGCAGCAGAGG - Intronic
954884507 3:53860156-53860178 AGCAGAGACAGCAGGAGGAGAGG - Exonic
955536991 3:59934364-59934386 AGCAGGGGGTGCAGGGGCAGTGG - Intronic
956587985 3:70884330-70884352 AGCAGAGGCAGCACGGGTAACGG - Intergenic
956678020 3:71753662-71753684 GGCGGCGGCAGCGGCGGCAGCGG + Intronic
956678022 3:71753668-71753690 GGCAGCGGCGGCAGCGGCGGCGG + Intronic
956678023 3:71753671-71753693 AGCGGCGGCAGCGGCGGCGGCGG + Intronic
957088923 3:75708946-75708968 AGCAGGGGCAACAGAGGGAGGGG + Intergenic
957296894 3:78344170-78344192 AGCAGAATCAGGAGCGGCAATGG + Intergenic
957329506 3:78743449-78743471 AGAAGAGGCAGAAAGGGCAGTGG - Intronic
957426793 3:80050837-80050859 AGCAGTGGCAGGAGCAGCCGTGG + Intergenic
957792475 3:84959007-84959029 GGCTGTGGCGGCAGCGGCAGCGG - Intronic
957792490 3:84959071-84959093 AGTGGCGGTAGCAGCGGCAGCGG - Intronic
957792493 3:84959089-84959111 AGCAGTGGAAGCAGCGCTAGTGG - Intronic
957820066 3:85361229-85361251 GGCAGAGGCAGCAGCGAGAGAGG + Intronic
957939811 3:86990835-86990857 AGCAGCTGGAGCAGCGACAGAGG - Exonic
958675714 3:97265740-97265762 TGCAGGAGCAGCAGTGGCAGCGG - Intronic
958728268 3:97932560-97932582 AGCACTAGCAGCAGGGGCAGTGG - Intronic
959147946 3:102572174-102572196 AGCACAGGCAACATCAGCAGAGG + Intergenic
959358997 3:105366924-105366946 AGCAGCGGCAGCGGCGGCAGCGG - Exonic
959358999 3:105366933-105366955 AGCGGTGGTAGCAGCGGCAGCGG - Exonic
959539395 3:107523215-107523237 AGCAGCGGCGGCGGCGGCGGCGG + Intronic
959601353 3:108190020-108190042 GGCAGAGGCAGAAGGGGAAGAGG + Intronic
959849762 3:111072123-111072145 AGCAGCAGCAGCAGCGGAGGTGG - Exonic
960198911 3:114807435-114807457 AGAAGCAGCAGCAGCTGCAGGGG - Intronic
960925970 3:122795218-122795240 AGGAGAGGCAGCCGCTGCTGGGG + Exonic
961259970 3:125594661-125594683 AGCAGCAGCAGCAGCCGCGGTGG - Exonic
961346039 3:126263963-126263985 AGGAGAGGCAGCTGGGGAAGCGG + Intergenic
961827457 3:129606530-129606552 AGCAGCAACAGCAGCGGCACCGG + Exonic
961874921 3:130014953-130014975 AGCAGAGTGAGCAGGGGCATCGG + Intergenic
962280479 3:134048462-134048484 AGCAGAGGGGGCAGAGGCTGAGG - Intronic
962301859 3:134250557-134250579 AGCAGAAGCAGCAGCGGCGGCGG + Exonic
962394345 3:135001687-135001709 AGCAGCAGCAGCAGCAGCAAAGG - Intronic
962737437 3:138338513-138338535 TGGAGAGGCAGGAGCTGCAGTGG - Intergenic
963561890 3:146876095-146876117 GGAAGAAGCAGCAGGGGCAGGGG + Intergenic
963637395 3:147816246-147816268 GGCAGAGGCTGCAGCGGCCAAGG - Intergenic
963809992 3:149766863-149766885 AGCAGCAGCAGCAGCAGCAAGGG + Intronic
963827492 3:149970896-149970918 AGCAGGCGCAGCGGCGGCGGCGG + Exonic
963862660 3:150327142-150327164 AGGAGAAGCAGAAGAGGCAGTGG - Intergenic
963913920 3:150840810-150840832 AGCAGTGGTAGCAGCAGCTGTGG + Intergenic
964297303 3:155247761-155247783 GGCAGAGGCAGAAGAGGGAGAGG + Intergenic
964771189 3:160225684-160225706 AGCAGCGGCAGCAGAGGCGGCGG - Exonic
964791055 3:160453347-160453369 AGCAGAAGGAGCAGCTGCAGCGG + Intronic
965090443 3:164155600-164155622 AGCAGAAGCAGCAGGGTAAGGGG + Intergenic
965244664 3:166251424-166251446 AGCAGCAGCAGCAGCAGCAGCGG + Intergenic
965672061 3:171157547-171157569 AGCAGCTGGAGCAGCAGCAGCGG - Exonic
965777827 3:172251451-172251473 GGCGGAGGCGGCAGCGGTAGTGG + Exonic
965881758 3:173396055-173396077 AGCAGTGGCGGCGGCGGCGGCGG + Intergenic
966911432 3:184562299-184562321 AGCAGCGGCAGCAGCAGCAGCGG - Exonic
967272902 3:187745344-187745366 ACCAGCGGCAACAGCGGCGGCGG + Intronic
967493708 3:190120685-190120707 AGCGGCAGCAGCAGCAGCAGCGG + Exonic
968516815 4:1018954-1018976 GGCAGAGGCAGCTGGGCCAGAGG - Intronic
968550712 4:1222291-1222313 GGTAGAGGCTGCAGCGTCAGGGG + Intronic
968698099 4:2042391-2042413 AGCAGCAGCAGCGGCGGCGGCGG - Exonic
968698100 4:2042394-2042416 AGCAGCAGCAGCAGCGGCGGCGG - Exonic
968698101 4:2042397-2042419 AGCAGCAGCAGCAGCAGCGGCGG - Exonic
968910777 4:3476055-3476077 GGAGGAGGCAGCAGGGGCAGGGG - Intronic
968952605 4:3702617-3702639 AGCAGAGGCAGATGCAGGAGCGG - Intergenic
969073267 4:4556954-4556976 AACAGAGGGAGGAGAGGCAGAGG + Intergenic
969134478 4:5019408-5019430 AGCAGCAGCAGCACGGGCAGAGG + Exonic
969436639 4:7192749-7192771 AGCAGCAGCAGCAGCAGGAGCGG - Exonic
969481913 4:7451280-7451302 AGCAGCAGCAGCAGCGGCAGTGG + Intronic
969656023 4:8499053-8499075 AGCAGGGGCAGCTGCAGCAGTGG + Intergenic
970637114 4:18021698-18021720 GGCGGCGGCAGCAGCGGCGGCGG + Exonic
971792355 4:31185188-31185210 ACCTGGGCCAGCAGCGGCAGAGG - Intergenic
972355258 4:38274541-38274563 AGCAGAGGCAGCAGTGCCCTGGG + Intergenic
972572981 4:40327574-40327596 AGAAGAGGAAGCAGAGCCAGTGG + Intergenic
972725828 4:41745980-41746002 GGCGGCGGCGGCAGCGGCAGCGG - Exonic
972725829 4:41745986-41746008 GGCAGCGGCGGCGGCGGCAGCGG - Exonic
972725834 4:41746001-41746023 AGCGGCGGCGGCCGCGGCAGCGG - Exonic
972809017 4:42562401-42562423 AGCAGCAGCAGCAGCAGCAGTGG - Intronic
973306212 4:48653835-48653857 AGCAGAAGCAGCAGCAGCAGCGG + Intronic
973759120 4:54100788-54100810 GGCGGCGGCAGCAGCAGCAGCGG + Exonic
973759122 4:54100794-54100816 GGCAGCAGCAGCAGCGGCGGCGG + Exonic
973759123 4:54100797-54100819 AGCAGCAGCAGCGGCGGCGGCGG + Exonic
973759124 4:54100803-54100825 AGCAGCGGCGGCGGCGGCCGCGG + Exonic
973916076 4:55636110-55636132 AGCAGCAGCAGCAGCAGGAGCGG + Exonic
973933716 4:55819799-55819821 CCCAGTGGCAGCAGCGGCGGCGG - Intergenic
973980415 4:56304085-56304107 GGCAGAGGGAGAAGAGGCAGAGG - Intronic
974191868 4:58515424-58515446 AGCATAGGCAGCTGGGGCACTGG - Intergenic
974302091 4:60081760-60081782 AGAAAAGGCAGCAGCCTCAGGGG + Intergenic
974385650 4:61200507-61200529 AGCAGCGGCGGCGGCGGCGGCGG - Intergenic
974442518 4:61938631-61938653 AGCAATAGCAGCAGCAGCAGCGG - Intronic
974568213 4:63607088-63607110 AGCAGGGGAAACAGTGGCAGAGG - Intergenic
975118595 4:70705264-70705286 GGCGGCGGCAGCAGCGGCAGCGG + Intronic
975394103 4:73854925-73854947 AGAAGAGTCAGCAGAGACAGAGG - Intergenic
975811207 4:78171726-78171748 AGCACAGCCAGCAGCAGGAGAGG - Intronic
975986251 4:80203219-80203241 AGCCGCGGCTGCAGCGGCAGCGG - Exonic
976140995 4:81991489-81991511 GGTAGAGGCAGCAGCAGCAGTGG + Intronic
976212159 4:82682097-82682119 TGGAGAGGCAGCAGTGGCTGAGG + Intronic
976281977 4:83334733-83334755 AGCAGCAGCATCAGCGGCGGCGG + Exonic
976390041 4:84497800-84497822 AGCAGCCGCGGCGGCGGCAGAGG + Exonic
976569919 4:86595282-86595304 AGCAGAGGAAGAGGGGGCAGAGG + Intronic
976774903 4:88697682-88697704 AGCGGCGGAGGCAGCGGCAGAGG - Exonic
976776225 4:88709070-88709092 AGCTGAGACAGCAGTGACAGTGG + Intergenic
976781640 4:88765857-88765879 AGCAGTGCCAGCAGTGGCACTGG + Intronic
976912849 4:90328715-90328737 AGCAGAGACAACAGTAGCAGAGG - Intronic
977696579 4:99972239-99972261 AGCAGAGGCAGCAGCAGCACAGG - Intergenic
977810025 4:101347341-101347363 GGCAGCAGCAACAGCGGCAGCGG - Exonic
977810026 4:101347347-101347369 GGCAGCGGCAGCAGCAACAGCGG - Exonic
977996825 4:103504825-103504847 AGCAGAAGCAGCAGCAGCGGAGG - Intergenic
978321373 4:107499672-107499694 AGCAGAGGTAGTGGCGGTAGTGG - Intergenic
978581652 4:110237628-110237650 GGCAGAGGCACCAGCAGTAGTGG + Intergenic
979349562 4:119628597-119628619 AGCAGCAGAAGCAGCAGCAGAGG - Exonic
979442853 4:120772512-120772534 TGCAGCGGCGGCAGCAGCAGTGG + Intronic
980416809 4:132499519-132499541 GGAAGAGTCAGCAGAGGCAGGGG - Intergenic
980698750 4:136395484-136395506 ACCCGAGCCAGCAGCTGCAGAGG + Intergenic
980839674 4:138242306-138242328 AGCAGCAGCAGCAGCAGCAGTGG - Exonic
980865909 4:138553282-138553304 ACCCGAGGCAGCAGCTGCCGAGG + Intergenic
980920900 4:139084412-139084434 GGCAGGGGCAGGGGCGGCAGGGG + Intronic
980920903 4:139084418-139084440 GGCAGGGGCGGCAGGGGCAGGGG + Intronic
981034367 4:140154063-140154085 GGCAGGAGCAGCGGCGGCAGCGG - Exonic
981042652 4:140237714-140237736 ACCAGTGGCAGCAGGGGAAGGGG - Intergenic
981470776 4:145132106-145132128 AGCTGAGGCAGGAGAGGCTGAGG - Intronic
981615454 4:146639363-146639385 AGCAGTGGCAGCAGCGGCGGCGG + Exonic
981782590 4:148444581-148444603 GGCGGCGGCAGCAGCGGCGGCGG - Intronic
982157456 4:152535998-152536020 AGCGGCGGCGGCGGCGGCAGCGG + Exonic
982157457 4:152536004-152536026 GGCGGCGGCGGCAGCGGCAGCGG + Exonic
982157525 4:152536319-152536341 CGTAGAGGCGGCAGCGGCGGTGG - Intergenic
982257624 4:153466232-153466254 AGCTGCAGCAGCTGCGGCAGCGG + Intergenic
982257628 4:153466238-153466260 AGCAGCTGCGGCAGCGGCGGGGG + Intergenic
982584820 4:157222625-157222647 AGCAGAGGCAGCCGGGGAAAAGG + Intronic
982745821 4:159103430-159103452 AGCAGAGGCGGCGGCGGCGGCGG + Intergenic
982746012 4:159104084-159104106 GGCGGAGGCAGCAGCGGCGCTGG + Intergenic
983077372 4:163343361-163343383 AGGAGAGGCAACAGCGTCTGCGG - Intronic
983238641 4:165207461-165207483 TCCAGAAGCAGAAGCGGCAGCGG + Intronic
983238643 4:165207467-165207489 AGCAGAAGCGGCAGCGGCAGCGG + Intronic
983563198 4:169122174-169122196 AGCAGCAGCAGCAGCGGCGGTGG + Exonic
983725187 4:170913553-170913575 AGCAGCAGCAGCAGCAGCAGCGG + Intergenic
983726207 4:170929827-170929849 AACAGTGGCAGCAGAGGCAGTGG + Intergenic
984074807 4:175163156-175163178 GGCAGAGGCAGAAGAGGCAGAGG + Intergenic
984424872 4:179570664-179570686 GGCAGAGGCAGAAGAGGTAGGGG + Intergenic
984463109 4:180059736-180059758 AGCAGCGGCGGCGGCGGCAGCGG + Intergenic
984772115 4:183444940-183444962 AGCGGAGGCAGCGCCGCCAGCGG - Exonic
984820519 4:183877668-183877690 AGCAGCAGCAGCAGCAGCAGCGG - Intronic
984973431 4:185209946-185209968 CGCGGAGGCAGCAGCAGCGGCGG + Intronic
985106015 4:186500928-186500950 AGCAGAGTCCGCAGCGGAAAAGG + Intronic
985129679 4:186726815-186726837 GACAGTGGCAGCAGCGGCCGTGG + Intergenic
985850855 5:2388217-2388239 GGCAGAGGCAGCAGCTGGCGTGG + Intergenic
986061745 5:4198267-4198289 AGCAAGGGCAGAAGCAGCAGAGG - Intergenic
986703888 5:10439637-10439659 AGGAGAGAGAGCAGGGGCAGAGG - Exonic
987258154 5:16179118-16179140 AGCAGCCGCAGCAGCAGCAGTGG - Exonic
987373960 5:17217601-17217623 TGCAGAGGCTGCAGCGGCGGCGG + Exonic
987373964 5:17217622-17217644 GGCGGCGGCAGTAGCGGCAGCGG + Exonic
987632092 5:20487064-20487086 AGCTGTGGCAGCAGCAGCACTGG + Intronic
987831868 5:23105233-23105255 TGTGGAGTCAGCAGCGGCAGTGG - Intergenic
987969288 5:24921324-24921346 AGCAGCAGGAGCAGCAGCAGCGG + Intergenic
989081974 5:37631918-37631940 AGGAGAGCCAGGAGAGGCAGAGG + Intronic
989523089 5:42423773-42423795 AGCGGCGGCGGCGGCGGCAGCGG + Intronic
990016030 5:51063747-51063769 AACACAGGCAGCCGCAGCAGTGG - Intergenic
990165539 5:52989496-52989518 AACACCAGCAGCAGCGGCAGCGG - Exonic
990513568 5:56511505-56511527 CCCAGAGGCAGCAGGGCCAGTGG - Intergenic
990825593 5:59894011-59894033 AGCAACGGCGGCGGCGGCAGTGG + Intronic
990955032 5:61332342-61332364 GGCGGGGGCAGCAGCGGCGGCGG + Exonic
990981595 5:61606922-61606944 AGCTGAGGCAGAAGAGGCAAGGG + Intergenic
991065890 5:62424514-62424536 AGCTGAGGTGGCAGAGGCAGAGG - Intronic
992014363 5:72560613-72560635 GTCAGATGCAGCAGTGGCAGTGG + Intergenic
992442414 5:76808502-76808524 AGGAGAGGAAGCAGAGGCAGAGG - Intergenic
992868635 5:80983204-80983226 AGCAGAGGAAACAGGGGCAAAGG - Intronic
993486231 5:88489615-88489637 AGCAGCAGCAGCAGCAGCAGCGG - Intergenic
993654636 5:90562462-90562484 AGCTGAGGCACAAGCGGCTGTGG + Intronic
993901114 5:93584818-93584840 AGTAGCGGCGGCAGCGGCGGCGG + Exonic
993901115 5:93584821-93584843 AGCGGCGGCAGCGGCGGCGGCGG + Exonic
994083262 5:95731312-95731334 AGGAGGAGGAGCAGCGGCAGCGG + Exonic
994150561 5:96442788-96442810 AGCAGCAACAGCAGCAGCAGTGG - Intergenic
994353910 5:98774155-98774177 AGCAGCAGCAGCAGCTCCAGCGG - Exonic
994869654 5:105331459-105331481 AGCAGAAGCAGAAGAAGCAGAGG + Intergenic
994869655 5:105331465-105331487 AGCAGAAGAAGCAGAGGCAGAGG + Intergenic
995106326 5:108381290-108381312 AGCCGAGGCGGCAGCGGCGGCGG + Exonic
995248921 5:109967006-109967028 AGCAGTGGCAGCAGAGGGGGTGG - Intergenic
995571696 5:113488353-113488375 AGCAGCGGCGGCGGCGGCGGCGG - Exonic
995650533 5:114362930-114362952 AACAGCGGCGGCGGCGGCAGCGG - Exonic
996969204 5:129343064-129343086 AACAGAGGCAGCAGCAGCAGAGG - Intergenic
997609043 5:135198795-135198817 AGCAGCAGCAGCAGCAGAAGAGG - Intronic
997706293 5:135956539-135956561 AGATGAGGCAGAAGTGGCAGTGG + Intergenic
997951055 5:138242780-138242802 AGCAGAGAAAGCAGAGGCAGTGG + Intergenic
997980705 5:138465942-138465964 AACAGCAGCAGCAGCAGCAGCGG + Exonic
997980708 5:138465945-138465967 AGCAGCAGCAGCAGCAGCGGGGG + Exonic
997980709 5:138465948-138465970 AGCAGCAGCAGCAGCGGGGGCGG + Exonic
998137293 5:139680837-139680859 GGCAGCGGCTGCAGCCGCAGTGG - Exonic
998182502 5:139955337-139955359 AGGAGGAGCAGCAGCGGCAGAGG + Intronic
998193023 5:140042939-140042961 AGCAGCAGCAGCAGCGAGAGCGG - Exonic
998207289 5:140167032-140167054 AGCAGCAGCAGCAGCAGCAGTGG + Intergenic
998236428 5:140402139-140402161 AGCAGCGGCGGCGGCGGCAGCGG + Exonic
998236429 5:140402145-140402167 GGCGGCGGCGGCAGCGGCAGCGG + Exonic
998362792 5:141604378-141604400 AGCTTAGGCAGCAGAGGGAGAGG - Intronic
998369083 5:141649748-141649770 AGCTGACACAGCAGCAGCAGAGG - Intronic
998399969 5:141843528-141843550 CCCAGAGGCACCAGAGGCAGGGG - Intergenic
998820605 5:146054356-146054378 AGCAGTAGCAGCAGCAGCAAGGG - Intronic
999702921 5:154244709-154244731 AGCAAAGGCAGCAGCCAGAGAGG + Intronic
1000209894 5:159099267-159099289 GGCGGAGGCGGCAGCGGCAGCGG - Intronic
1000420744 5:161035358-161035380 AGCAGAGGCAGCAGCAACAATGG - Intergenic
1000847034 5:166294413-166294435 AGTAGCAGCAGCAGCAGCAGTGG + Intergenic
1000891858 5:166810556-166810578 GGGAGAGGCACCAGCGGCAACGG - Intergenic
1000907406 5:166979223-166979245 AGCAGCAGCAGCAGCCGCCGCGG + Intergenic
1001396032 5:171420086-171420108 AGCAGCAGCAGCGGCGGCGGCGG + Exonic
1001396034 5:171420092-171420114 AGCAGCGGCGGCGGCGGCGGCGG + Exonic
1001399201 5:171436841-171436863 TGCAGAGGCAGCATAGGCAGGGG - Intronic
1001705043 5:173735459-173735481 TGCAGAGGCAGAAGAGCCAGGGG - Intergenic
1001885688 5:175288204-175288226 CACAGAGGCAGCAGCAGAAGGGG + Intergenic
1002026312 5:176398093-176398115 AGCAGGGGCAGCAGAGACAGCGG - Intronic
1002075413 5:176705523-176705545 GGCAGGGGCAGCAGGGGCTGGGG + Intergenic
1002134208 5:177098008-177098030 CGCTGGGGCAGCAGCAGCAGGGG - Exonic
1002290019 5:178194158-178194180 AGAGGAGGCAGCAGCGGGTGGGG - Intergenic
1002589843 5:180282904-180282926 AGGAGAAGCAGCAGAGGCGGAGG + Intronic
1003188111 6:3850098-3850120 AGCAGCGGCTGCAGCAGGAGCGG + Exonic
1003256912 6:4482871-4482893 AGCAGAGGAAACAGCTGCTGGGG + Intergenic
1003331474 6:5132864-5132886 TGCAGAGCCAGCAGCAGCTGTGG + Intronic
1003363086 6:5447217-5447239 AGCTGAAGCAGCAGTAGCAGTGG + Intronic
1003564755 6:7213706-7213728 AGCAGAGGCAGAAACAGCACAGG + Intronic
1003827031 6:9964496-9964518 AGCATAGGAAGCATCTGCAGGGG + Intronic
1004077925 6:12362264-12362286 AGCAGAGGGAGCTGGGGCATGGG + Intergenic
1004174559 6:13328510-13328532 GGCGGCGGCGGCAGCGGCAGCGG - Intronic
1004294247 6:14395590-14395612 AGCAGAAGAGGCAGAGGCAGGGG + Intergenic
1004355298 6:14924945-14924967 AGCAGTGGCAGCAGCTGGGGTGG - Intergenic
1004486996 6:16075956-16075978 AGCAGAGGCAGAAGGGGTGGAGG - Intergenic
1004616190 6:17291908-17291930 GTCATAGGCAGCAGCGGCGGCGG - Exonic
1004616213 6:17292037-17292059 AGCAGCTGCTGCAGCGGCGGCGG - Exonic
1005325206 6:24693373-24693395 AGCAGAGGCAGTGGAGGCAGTGG + Intronic
1005885012 6:30091071-30091093 AGCAGAGGGAGCAGCGGGTGTGG + Intergenic
1006011784 6:31048378-31048400 AGCAGAGGGAGCTGGGGCTGGGG + Intergenic
1006091100 6:31629561-31629583 AGCAGCAGCAGCAGCACCAGTGG + Exonic
1006091835 6:31632892-31632914 AGCAGTGGCAGCAGCAGTGGAGG + Exonic
1006333987 6:33411026-33411048 AGCAGCCAAAGCAGCGGCAGCGG - Exonic
1006566253 6:34960265-34960287 AGCAGAGGCAGCAAAGGAAGGGG - Intronic
1006614664 6:35318248-35318270 AGCAGCGGGAGCAGCGGGAGCGG + Exonic
1006624570 6:35388313-35388335 ATGAGAGGCAGCATCTGCAGAGG + Intronic
1006651742 6:35557344-35557366 AGCAGAGGCAGTAGTATCAGAGG - Intergenic
1006897970 6:37482858-37482880 GGAAGAGGCAGCAGCAGCAGAGG - Intergenic
1007358209 6:41335898-41335920 AGCAGCAGCAGCAGTAGCAGTGG - Exonic
1007380641 6:41488270-41488292 TGGAGAGGCTGCAGGGGCAGGGG - Intergenic
1007468061 6:42069038-42069060 AGCAGGGGCAGCAGATGCAAAGG + Intronic
1007576680 6:42929616-42929638 AGCAGCAGCAGCAGCAGCAAGGG - Exonic
1007591580 6:43024275-43024297 AGCAGAGGCAACATGTGCAGAGG + Intronic
1007609068 6:43137288-43137310 AACAGAGGCAGTAGCGGTGGGGG + Intronic
1008387740 6:50913271-50913293 AGGAGAGGCTGCGGCGGCGGTGG + Intergenic
1008660493 6:53662587-53662609 AGCAGATACAGCAGAGGGAGAGG - Intronic
1008700764 6:54096674-54096696 AGAAGAGGCAGGATTGGCAGAGG - Intronic
1008716394 6:54295095-54295117 AGCAGCAGCAGCAGCAGCAGCGG + Intergenic
1008888611 6:56459192-56459214 AGCAGGGCCAGCAGCCGCCGAGG - Exonic
1009905653 6:69867440-69867462 AGCGGAGGCGGCAGAGGCTGGGG - Intronic
1010198469 6:73263061-73263083 GGCGGCGGCAGCGGCGGCAGCGG + Exonic
1011362284 6:86540243-86540265 AGCAGAGAAAGCAGGGGGAGGGG + Intergenic
1011470332 6:87701843-87701865 CGCGGAGGCAGCGGCGGCAGCGG - Exonic
1011734384 6:90296783-90296805 AGCAGCAGCAGCGGCAGCAGCGG - Intronic
1011734385 6:90296792-90296814 AGCAGCAGCAGCAGCAGCAGCGG - Intronic
1011995334 6:93579817-93579839 AGGAGAAGCAGCAGTGGCAGAGG + Intergenic
1012247166 6:96938633-96938655 AGCAGCAGCAGCAGCAGCAGGGG + Intronic
1012400054 6:98835301-98835323 AGCAGCAGCAGCAGCAACAGCGG + Exonic
1013155813 6:107490295-107490317 GGCAGGGGCAGCGGCAGCAGCGG + Exonic
1013479673 6:110543135-110543157 AGCAGAGGTTGAAGCTGCAGGGG - Intergenic
1013575797 6:111482929-111482951 GGCAGCGGCAGCAGCAGCGGCGG + Exonic
1013575798 6:111482932-111482954 AGCGGCAGCAGCAGCGGCGGCGG + Exonic
1013793032 6:113857630-113857652 GGCGGCGGCAACAGCGGCAGCGG - Exonic
1013793034 6:113857645-113857667 AGCAGCAGCAGCAGCGGCGGCGG - Exonic
1013833712 6:114306954-114306976 AGTATAGGCAGTAGCAGCAGCGG + Intronic
1014543244 6:122701133-122701155 AGCTCAGGAAGCAGCAGCAGAGG + Intronic
1014802219 6:125790514-125790536 AGCGGAGGCTGCAGCAGCCGCGG + Intronic
1015054505 6:128883310-128883332 CGCAGCGGCCGCAGCAGCAGCGG + Exonic
1015220636 6:130801492-130801514 GGCGGCGGCAGCGGCGGCAGCGG + Intergenic
1015220640 6:130801498-130801520 GGCAGCGGCGGCAGCGGCGGGGG + Intergenic
1015251825 6:131135521-131135543 GGCAGCGGCAGCAGCGGCGGCGG - Intergenic
1015366353 6:132401480-132401502 AGCAGAACGAGGAGCGGCAGCGG + Exonic
1015376167 6:132512930-132512952 AGAAGGCGCAGCAGCCGCAGGGG + Intronic
1015715904 6:136191754-136191776 AGCAGGGGCAGCAGTGGCAGCGG + Exonic
1015734971 6:136389405-136389427 AGCAGAGGCAGAAGGAGGAGCGG - Exonic
1015799333 6:137044670-137044692 AACAGCAGCAGCGGCGGCAGCGG + Exonic
1015799334 6:137044676-137044698 AGCAGCGGCGGCAGCGGCAGCGG + Exonic
1015911116 6:138168551-138168573 AGCAGAGACTGCAGCTTCAGGGG + Intronic
1016034541 6:139373349-139373371 AGCGGCGGCGGCAGCGGCAGCGG - Exonic
1016648301 6:146434916-146434938 AGTAGCGGCAGCAGCAGCAGCGG - Exonic
1016714130 6:147204206-147204228 AGCAGCAGCAGCAGTGGCGGCGG - Intergenic
1016714132 6:147204212-147204234 GGCAGCAGCAGCAGCAGCAGTGG - Intergenic
1016792369 6:148079220-148079242 GGCAGTGGAAGCAGCGACAGAGG - Intergenic
1016840836 6:148523557-148523579 AGCAGCAGCAGCAGCAGCATCGG + Intronic
1016855437 6:148665736-148665758 ACCAGATGGAGCCGCGGCAGAGG + Intergenic
1017054527 6:150425168-150425190 AGCAGAGGCAGCACTGGATGGGG - Intergenic
1017470443 6:154733426-154733448 AGCGCTGGCAGCAGCGGCTGCGG - Exonic
1017638317 6:156465447-156465469 AGCAGAGTCAGCAGCGGGGTGGG + Intergenic
1017671966 6:156777695-156777717 AGCAGCGGCGGCGGCGGCGGCGG + Intergenic
1017718699 6:157229871-157229893 AGCTGGGGCAGCAGGTGCAGAGG + Intergenic
1018400329 6:163414605-163414627 GGCGGCGGCAGCAGCGGCGGCGG - Intronic
1018516377 6:164584262-164584284 GGCAGAGGCAGCATCGGCAGGGG + Intergenic
1019170141 6:170129221-170129243 AGCCGAAGCAGCAGCAGCCGGGG + Intergenic
1019450637 7:1095938-1095960 AGGGACGGCAGCAGCGGCAGCGG + Intronic
1019527351 7:1486757-1486779 TGCAGAGGCAACAGAAGCAGCGG - Exonic
1019535917 7:1529942-1529964 AGCAGAGGCAGCTCCCTCAGGGG + Intergenic
1019618720 7:1979155-1979177 AGCAGAGGCTGCTGCCGCGGGGG + Intronic
1019915619 7:4130351-4130373 GGGAGAGGCAGCAGAGGCTGGGG + Intronic
1020049473 7:5072389-5072411 AGCAGCAGCAGCAGCAACAGCGG - Exonic
1020086437 7:5313158-5313180 AGCAGCAGCAGCAGCAGCAGCGG - Exonic
1020086438 7:5313194-5313216 AGCAGCAGCAGCAGCAGTAGTGG - Exonic
1020664939 7:11028797-11028819 TTCAGAGGCAGCGGCGGAAGAGG + Exonic
1020727282 7:11831828-11831850 AGCAGCAGCAGCAGGAGCAGCGG + Exonic
1020727283 7:11831834-11831856 AGCAGCAGGAGCAGCGGCAGCGG + Exonic
1020727284 7:11831840-11831862 AGGAGCAGCGGCAGCGGCAGCGG + Exonic
1020727285 7:11831846-11831868 AGCGGCAGCGGCAGCGGCAGCGG + Exonic
1020812664 7:12864914-12864936 AGCAGTGGCAGAAGTGGCTGTGG - Intergenic
1020897885 7:13965041-13965063 AGTAGTAGCAGCAGCGGCGGAGG - Intronic
1021106708 7:16646200-16646222 AGCAGCAGCAGCAGCAGCAGTGG - Exonic
1021510279 7:21427158-21427180 AGCCGAGGAGGCGGCGGCAGAGG + Intergenic
1021510684 7:21428696-21428718 GGAGGAGGCGGCAGCGGCAGCGG + Exonic
1022033963 7:26516796-26516818 AGCAGAGTGAGCAACGGGAGGGG - Intergenic
1022095740 7:27139884-27139906 AGCAGAGTGAGCAGCGCCTGTGG - Intronic
1022106290 7:27199930-27199952 AGCAGCGGCTGCAGCGGCGGCGG - Exonic
1022137105 7:27458791-27458813 AGCAGCTTCGGCAGCGGCAGAGG - Intergenic
1022522126 7:31015183-31015205 AGCAGTGACAGCAGTGGCAGTGG - Intergenic
1023362311 7:39429518-39429540 AGAAGATGCAGCTGGGGCAGGGG - Intronic
1023388263 7:39682302-39682324 AGCAGCAGCAGCAGCAGCAATGG - Intronic
1023418131 7:39950795-39950817 AGCAGAGGCGGCGGGGGCGGCGG - Exonic
1023418296 7:39951383-39951405 AGCGGCAGCAGCAGCAGCAGCGG + Exonic
1023780929 7:43654317-43654339 AGGAGAGGCAGGATTGGCAGCGG + Intronic
1024033076 7:45481503-45481525 AGCAGAGGGAGCAGGGGGTGGGG - Intergenic
1024075654 7:45816670-45816692 AGTAGAGGCAGGGGCAGCAGTGG - Intergenic
1024471712 7:49773599-49773621 GGCGGAGGCGGCTGCGGCAGGGG + Intergenic
1024628710 7:51230295-51230317 TGGAGAGGCAGGAGAGGCAGTGG - Intronic
1025207875 7:57003944-57003966 AGCAGCAGCAGCAGCAGCAGTGG + Intergenic
1025664065 7:63572919-63572941 AGCAGCAGCAGCAGCAGCAGCGG - Intergenic
1026005710 7:66598826-66598848 AGCAGCAGCAGCAGCAGCAGAGG - Intergenic
1026471967 7:70701303-70701325 GGCAGAGGCAGCAGGGGCCGTGG + Intronic
1026764984 7:73154818-73154840 AGCAGCAGCAGCAGCAGCACCGG + Intergenic
1026853481 7:73738661-73738683 AGCAGCAGCAGCGGCGGCCGAGG - Exonic
1026884056 7:73927476-73927498 GGCAGAGACAGCACCAGCAGAGG - Intergenic
1027024804 7:74843434-74843456 GGCAGAGGCTGCAACCGCAGTGG + Intronic
1027062960 7:75100685-75100707 GGCAGAGGCTGCAACCGCAGTGG - Intronic
1027128755 7:75575759-75575781 TGCAGAGTCTGCAGAGGCAGTGG - Intronic
1027156991 7:75775482-75775504 AGCAGAGGCAGCAACGCAAGGGG + Intronic
1027390280 7:77696906-77696928 AGCCGAGGCAGCGGCGGCGGCGG - Exonic
1027403758 7:77836272-77836294 AGCAGAGGCAGAAGAGGTAAAGG + Intronic
1027438466 7:78192839-78192861 TGATGAGGCAGCAGCAGCAGCGG + Intronic
1027438467 7:78192845-78192867 GGCAGCAGCAGCAGCGGCACAGG + Intronic
1027539882 7:79453585-79453607 AGCAGAGGAAGCAGTGGTGGTGG + Intergenic
1027856658 7:83520459-83520481 AGCAGTGGTAGTAGAGGCAGAGG - Intronic
1028253726 7:88566337-88566359 AGCAGAGGCCTCAGCAGCTGAGG + Intergenic
1028305903 7:89264157-89264179 AGCAGAGGCAGAAATGGCAGAGG - Intronic
1028462777 7:91115030-91115052 GGCAAAGGCAGCAGTGGCAGTGG + Intronic
1029211267 7:98910174-98910196 AGCAGGGCCAGGAGCTGCAGGGG - Exonic
1029443783 7:100602085-100602107 AGCTGAGGAAGCAGGGGCGGGGG + Intergenic
1029479711 7:100805140-100805162 AGCAGTGGCAGGAGCTGGAGTGG - Intronic
1029513212 7:101009745-101009767 AGGAGAGGCAGTTGCAGCAGAGG + Intronic
1029550015 7:101232635-101232657 AGCAGGCGGAGCAGAGGCAGAGG + Exonic
1029705287 7:102272809-102272831 AACAGAGGCTCCAGCTGCAGTGG - Intronic
1029926919 7:104328481-104328503 AGCAGCTGCAGCGGCGGCGGCGG + Intergenic
1029947778 7:104551489-104551511 AGCAGAGGCAGCCAAGGGAGGGG - Intronic
1030063161 7:105639153-105639175 AGCAGCGGCAGCGGCGGCGGCGG - Intronic
1030111618 7:106031566-106031588 AGCAGCAGCAGCAGCGGCGGCGG - Intronic
1031036666 7:116794775-116794797 AGGAGAGTCAGCATGGGCAGAGG - Intronic
1031235353 7:119168724-119168746 TACAGAGGCTGCAGCTGCAGTGG + Intergenic
1031270360 7:119641694-119641716 AGAAGAAGCAGCAGGAGCAGGGG - Intergenic
1031629707 7:124032398-124032420 AGCAGCAGCAGCAGCAGCGGAGG - Exonic
1031629708 7:124032401-124032423 AGCAGCAGCAGCAGCAGCAGCGG - Exonic
1031829579 7:126609975-126609997 GGCAGAGGTAGCAGAGGCACAGG - Intronic
1031966640 7:128031970-128031992 AGCGGCGGCAGCAGCAGCAGCGG + Intronic
1032020695 7:128405914-128405936 AGCAGCAGCAGCGGCGGCAGCGG - Intronic
1032020697 7:128405923-128405945 AGCAGTAGCAGCAGCAGCAGCGG - Intronic
1032842818 7:135727417-135727439 GGCAGAGGCAGCAGCAGGAGCGG + Exonic
1032867900 7:135946919-135946941 TGAAGAGGTAGCAGCAGCAGAGG - Intronic
1033033174 7:137846639-137846661 GGCAGCAGCAGCAGCGGAAGCGG - Exonic
1033096947 7:138440607-138440629 TGCAGTGTCAGCAGCAGCAGCGG + Intergenic
1033096948 7:138440619-138440641 AGCAGCAGCGGCAGCAGCAGTGG + Intergenic
1033339285 7:140479284-140479306 ATCAGGAGCAGGAGCGGCAGCGG - Exonic
1033445236 7:141415552-141415574 AGCAGAGGCAGCATCTCCAGGGG + Intronic
1034182217 7:149147682-149147704 CGCGGTGGCAGCGGCGGCAGCGG + Exonic
1034224932 7:149474841-149474863 GGCGGTGGCGGCAGCGGCAGTGG - Exonic
1034448002 7:151123165-151123187 AGCAGGAGCAGGAACGGCAGAGG - Intronic
1034489911 7:151387603-151387625 AGCAGAAGCAGGAGAGGCACCGG + Intronic
1034708692 7:153171173-153171195 GTCAGGGGCCGCAGCGGCAGTGG + Intergenic
1034708696 7:153171188-153171210 GGCAGTGGTGGCAGCGGCAGTGG + Intergenic
1034967318 7:155399275-155399297 AGCAGGGGAAGCAGGAGCAGAGG - Intergenic
1034994725 7:155570646-155570668 AGCAGGGCCAGCAGAGCCAGAGG + Intergenic
1035010456 7:155711266-155711288 AGCAGCGGCTGCAGCGGCTGCGG - Exonic
1035156959 7:156922028-156922050 ATCAGAGGAAGAAGCAGCAGAGG - Intergenic
1035225375 7:157429647-157429669 GGCAGAGGCACCATGGGCAGTGG + Intergenic
1035404200 7:158587632-158587654 AGCAGTAGCAGCAGCAGCAGCGG + Exonic
1035404202 7:158587638-158587660 AGCAGCAGCAGCAGCGGGAGCGG + Exonic
1036128467 8:6085513-6085535 AGCACAGTCAGCAGAGGAAGGGG + Intergenic
1036197410 8:6731920-6731942 AGAAGAGGAAGCAGTGCCAGCGG - Intronic
1036396812 8:8377354-8377376 AGCGGCAGCGGCAGCGGCAGCGG - Exonic
1036648428 8:10626193-10626215 GGCGCAGGCAGCAGGGGCAGTGG + Intronic
1036910649 8:12754946-12754968 GGCAGAGGCGGCAGCGGGCGCGG + Exonic
1037150024 8:15626064-15626086 TGCAGGAGCAGCAGTGGCAGTGG + Intronic
1037288264 8:17323634-17323656 AGCAGAGGCCGCAGGGGTGGGGG + Intronic
1037648526 8:20815764-20815786 ACCAGAGGCACCAGCTGAAGTGG + Intergenic
1037814797 8:22106521-22106543 GGCAGAGGCAGGAGAGCCAGGGG + Intergenic
1037821467 8:22137224-22137246 AGCAGGTGCAGCAGTGGCAGAGG + Intergenic
1037887907 8:22604772-22604794 GGCGGCGGCAGCAGCGGCTGTGG + Exonic
1037901902 8:22693383-22693405 GGCAGAGGCGGCGGCGGCGGCGG - Intergenic
1037901907 8:22693398-22693420 AGCGGCGGCAGCGGCGGCAGAGG - Intergenic
1038055599 8:23854743-23854765 AGCAGCAGCAGCAGCGGCGGTGG - Exonic
1038055600 8:23854746-23854768 AGCAGCAGCAGCAGCAGCGGCGG - Exonic
1038055601 8:23854749-23854771 TGCAGCAGCAGCAGCAGCAGCGG - Exonic
1038217815 8:25578650-25578672 AGGAGAGGCAGCATGGTCAGAGG + Intergenic
1038296000 8:26291545-26291567 GGCGGCGGCGGCAGCGGCAGGGG - Intronic
1038883602 8:31640069-31640091 AGTAGTGGCAGCAGCGGCAGCGG - Intronic
1039453944 8:37696022-37696044 AGCAGCGGCAGCGGCAGCGGCGG + Exonic
1039453946 8:37696028-37696050 GGCAGCGGCAGCGGCGGCGGCGG + Exonic
1039518259 8:38150855-38150877 AGCAGCGGCGGCAGCAGCAGCGG - Exonic
1039518260 8:38150867-38150889 AGAAGAGGCAGCAGCAGCGGCGG - Exonic
1039632992 8:39133549-39133571 AGCAGTGGCAGTAGCAGTAGTGG + Intronic
1039898039 8:41730197-41730219 AGCGGGGTCAGCAGCGGCTGGGG - Intronic
1040063779 8:43127791-43127813 GGCAGTGGCAGTAGCAGCAGTGG + Intergenic
1040870267 8:52093503-52093525 AGTGGAGGCAGCAGGGGCTGTGG - Intergenic
1041067051 8:54092113-54092135 GGGGGAGGCAGCGGCGGCAGAGG + Intronic
1041167440 8:55103170-55103192 AACAGCGGCAGCAACAGCAGCGG + Exonic
1041280883 8:56210720-56210742 GGCAGCGGCAGCAGCGAGAGCGG - Intronic
1041433970 8:57817494-57817516 GGCAGTGGCAGTAGGGGCAGTGG - Intergenic
1041530323 8:58858434-58858456 AGCAGAGCCAGCCGAGGCGGTGG - Intronic
1041834398 8:62195667-62195689 AGCAGAGGGAGTAGTGGCAAGGG - Intergenic
1042040226 8:64581415-64581437 AGCAGCGGTAGCAGTGGCGGCGG + Exonic
1042180255 8:66080427-66080449 AGCAGTTGCAGCAGCAGCACAGG - Exonic
1042229223 8:66540153-66540175 AGAAGAAGCAGCAGTGTCAGAGG - Intergenic
1042316799 8:67434699-67434721 AGCAGCTGCAGCTGCAGCAGTGG + Intronic
1042337253 8:67641050-67641072 TGCACAAGCAGCAGTGGCAGCGG - Intronic
1042567220 8:70124240-70124262 AGCCGAGACAGCAGGGGAAGTGG + Intronic
1042964667 8:74337651-74337673 AGCAGATGCAGCAAGGCCAGAGG + Intronic
1043769682 8:84183124-84183146 AATCGCGGCAGCAGCGGCAGAGG + Intronic
1043769713 8:84183302-84183324 AGTGGCGGCAGCAGCGGCAGCGG - Intronic
1044242431 8:89902639-89902661 AGCCGGGGCAGCCGCGGCAACGG + Exonic
1044340436 8:91040834-91040856 AGCAGCTGCAGCGGCAGCAGCGG - Exonic
1044340437 8:91040843-91040865 GGCAGCAGCAGCAGCTGCAGCGG - Exonic
1045102658 8:98861113-98861135 AGCAGAAGCAGCTGCAGAAGTGG + Intronic
1045324137 8:101104330-101104352 AACAGGGGAAGCAGCAGCAGTGG + Intergenic
1045718323 8:105074913-105074935 AGCAGCAGCAGCAGCAGCAGCGG - Intronic
1046174396 8:110556279-110556301 AAAAGCAGCAGCAGCGGCAGCGG + Intergenic
1046174397 8:110556285-110556307 AGCAGCAGCGGCAGCGGCAGCGG + Intergenic
1046174398 8:110556291-110556313 AGCGGCAGCGGCAGCGGCAGCGG + Intergenic
1046174399 8:110556297-110556319 AGCGGCAGCGGCAGCGGCAGCGG + Intergenic
1046174400 8:110556303-110556325 AGCGGCAGCGGCAGCGGCAGCGG + Intergenic
1046174401 8:110556309-110556331 AGCGGCAGCGGCAGCGGCAGCGG + Intergenic
1046174402 8:110556315-110556337 AGCGGCAGCGGCAGCGGCAGCGG + Intergenic
1046639532 8:116712104-116712126 AGCAGCAGCAGCGGCGGCGGCGG - Intronic
1046639535 8:116712113-116712135 AGCAATGACAGCAGCAGCAGCGG - Intronic
1046871314 8:119208446-119208468 CGGAGACGCAGCAGCGGCAGCGG + Exonic
1047499458 8:125430565-125430587 GGCAGAGGCGGCGGCGGCAGCGG - Exonic
1048213905 8:132479362-132479384 AGGAGAAGCAGCAGCGACTGAGG + Intronic
1048752630 8:137697380-137697402 AGCAGCAGCAGCAGCAGCAGGGG + Intergenic
1048980904 8:139703130-139703152 GGCAGCAGCAGCAGCAGCAGCGG + Intergenic
1049062582 8:140287370-140287392 AGCAGAGGGAGGAGGGGCATGGG + Intronic
1049180191 8:141218227-141218249 GGCAGCGGCAGCACCGGCACCGG - Exonic
1049191368 8:141289700-141289722 TGCAGAGGCCACAGCCGCAGGGG - Intronic
1049243511 8:141550368-141550390 AGCAGAGGGAGCAGGGGCCAGGG + Intergenic
1049409029 8:142464244-142464266 AGCAGCAGCAGCAGTAGCAGCGG - Exonic
1049443498 8:142619671-142619693 TGCAGAGGCTGCAGAGGGAGGGG - Intergenic
1049454726 8:142681081-142681103 AGAAGAGGAAGCTGCGGCTGTGG - Intronic
1049535697 8:143180297-143180319 ACCAGCAGCAGCAGCAGCAGTGG + Intergenic
1049552916 8:143268835-143268857 AGCAGCAGCAGCAGCAGCAAAGG - Intronic
1049585631 8:143431181-143431203 AGCGGCGGCGGCGGCGGCAGCGG + Intergenic
1049696391 8:143986196-143986218 GGCAGAGGCAGGGGTGGCAGTGG - Exonic
1049819892 8:144627117-144627139 AGCAGAGGCAGCTGCAGCCTTGG - Intergenic
1050241993 9:3646402-3646424 AGCAGAAGCAGGAAGGGCAGAGG - Intergenic
1050676589 9:8062739-8062761 AGCATAGCCAGCAGCAGCAGTGG + Intergenic
1050709732 9:8447819-8447841 AACAGAGGAAGGAGGGGCAGTGG + Intronic
1050725411 9:8643587-8643609 TGCAGAGGCAGCAGTGGTGGTGG - Intronic
1051041885 9:12821491-12821513 AGCAGAGGCAGCAGCCTCAGTGG + Exonic
1051126418 9:13810618-13810640 TTCAGAGGCAGCAGCTGCTGTGG - Intergenic
1051472602 9:17463944-17463966 AGCAGCAGCAGCAGTAGCAGTGG + Intronic
1052142405 9:25003810-25003832 ACCAAAGGCAGCAGCAGCACAGG + Intergenic
1052452292 9:28647088-28647110 AGTAGAGGCAGCAGTGGCAAAGG - Intronic
1052534731 9:29732338-29732360 AGCTCTAGCAGCAGCGGCAGTGG + Intergenic
1052778315 9:32755295-32755317 AGCACACCCAGCAGCAGCAGCGG - Intergenic
1052925949 9:34016353-34016375 AGCAGCGGCGGCAGCGGCGGTGG + Intronic
1052994522 9:34544116-34544138 GGCAGAGGCAGAAGAGGGAGAGG + Intergenic
1053146424 9:35715140-35715162 AGGAGCAGCAGCAGCGGCTGCGG - Exonic
1053329500 9:37190212-37190234 AGCAGTGACAGCAGCAGCAGTGG - Intronic
1053451940 9:38201043-38201065 AACAGAGGCAGCAGCCAAAGCGG + Intergenic
1053482273 9:38424378-38424400 AGCAGCAGCAGAAGCAGCAGCGG + Exonic
1055315915 9:75034023-75034045 AGCAGAGGCAGTAGATCCAGTGG - Intergenic
1055757634 9:79572704-79572726 AGAGGAGGCGGCCGCGGCAGCGG - Exonic
1055770201 9:79708746-79708768 GGCAGCAGCAGCAGCGGCGGCGG - Exonic
1055770204 9:79708752-79708774 CCCATAGGCAGCAGCAGCAGCGG - Exonic
1056058202 9:82851812-82851834 AGGAGAGGCAGGGGAGGCAGGGG - Intergenic
1056253212 9:84771978-84772000 AGCAGAAGGAGCAGGGGCTGAGG + Intronic
1056615201 9:88159698-88159720 AGCAGAGGCAGCCCAGACAGGGG - Intergenic
1056677246 9:88686137-88686159 ACCCGAGCCAGCAGCTGCAGAGG - Intergenic
1056781480 9:89554384-89554406 AGAAGAGGGAGCAGAGGCTGGGG - Intergenic
1056993803 9:91436104-91436126 AGCAGAGACAGCAGTGCCTGCGG - Intergenic
1057245538 9:93451693-93451715 CGCAGCGGCGGCAGCGGCGGCGG + Intronic
1057245539 9:93451696-93451718 AGCGGCGGCAGCGGCGGCGGCGG + Intronic
1057781853 9:98056741-98056763 AGTAGAGGCGGCGGCGGCGGCGG + Exonic
1057790107 9:98119056-98119078 CGCACACGCAGCGGCGGCAGCGG + Exonic
1057948776 9:99353118-99353140 TGCCAAGGCAGCAGAGGCAGAGG + Intergenic
1057996130 9:99822756-99822778 GGCGGCGGCGGCAGCGGCAGCGG + Intronic
1058574527 9:106386113-106386135 AACATAGGAAGCAGCGGCAATGG - Intergenic
1058885777 9:109320486-109320508 AGCGGCAGCGGCAGCGGCAGCGG - Exonic
1059102465 9:111483780-111483802 GGCGGCGGCGGCAGCGGCAGCGG - Intronic
1059178985 9:112193952-112193974 AGCAGAGGTAACAGCTGGAGAGG - Intergenic
1059739980 9:117140689-117140711 AGGAGAAGAAGCAGCAGCAGAGG + Intronic
1059769835 9:117414820-117414842 AGCAGGAACAGCAGCAGCAGCGG + Exonic
1059769836 9:117414829-117414851 AGCAGCAGCAGCGGCAGCAGTGG + Exonic
1059769838 9:117414835-117414857 AGCAGCGGCAGCAGTGGCGGCGG + Exonic
1060061150 9:120460985-120461007 AGTAAAGGCAGGAGTGGCAGTGG - Intronic
1060200119 9:121647452-121647474 AGCAGGGGCACCAGATGCAGGGG - Intronic
1060371835 9:123080972-123080994 AGCAGAGGCAGAAGTGGAGGAGG - Intronic
1060584428 9:124777292-124777314 GGCAGAAGGAGCAGCGGCCGGGG - Exonic
1060588249 9:124800004-124800026 AGCAGAGTGAGCAGAGGCACTGG + Intronic
1060634560 9:125189732-125189754 AGCCGCGGCAACAGCGGCGGCGG + Exonic
1060634568 9:125189765-125189787 AGCGGCGGCGGCAGCGGCGGAGG + Exonic
1060667457 9:125440494-125440516 AGTAGAATCAGCAGAGGCAGTGG - Intronic
1060936098 9:127517118-127517140 CGCAGGAGCGGCAGCGGCAGTGG - Exonic
1060979955 9:127786100-127786122 AGCGGCGGCAGCAGCGACTGGGG + Exonic
1061203316 9:129149389-129149411 AGCAGGGACAGGAGGGGCAGAGG - Intergenic
1061334625 9:129923970-129923992 GGCAGAGGCAGGAGGGGGAGGGG + Exonic
1061481312 9:130898889-130898911 AGCAGAGGAGGAAGGGGCAGAGG - Intergenic
1061640634 9:131952320-131952342 AGCAGAGGCACCAGCAGCAGAGG + Intronic
1061726092 9:132582727-132582749 GGCAGGGGCAGCGGCGGCTGGGG + Exonic
1061853635 9:133429707-133429729 AGCAGAGGGAGCGGCGACGGAGG - Intronic
1062084621 9:134642248-134642270 AGCAGCAGCAGCAGCAGCGGGGG - Exonic
1062132392 9:134905782-134905804 AGAAGAAGAAGCAGCAGCAGCGG - Intergenic
1062230339 9:135479082-135479104 AGCAGAAGCAGAAACAGCAGCGG + Intronic
1062347662 9:136122856-136122878 ACCAGAAGCAGCTGCGGCCGGGG - Intergenic
1062403707 9:136383583-136383605 AGCAGCAGCGGCAGCAGCAGTGG - Exonic
1062513837 9:136922373-136922395 GGCTGAGCCAGCAGCTGCAGAGG - Intronic
1062567512 9:137169891-137169913 AGCAGCAACAGCAGCAGCAGCGG + Exonic
1062567513 9:137169897-137169919 AACAGCAGCAGCAGCGGCCGAGG + Exonic
1062580192 9:137225969-137225991 AGCAGGGGCAGCAGCAGCAGTGG - Exonic
1062580204 9:137226020-137226042 AGCAGCAGCAGCTGTGGCAGCGG - Exonic
1062631047 9:137463329-137463351 AGCGGAGGCAGCTGTGGCAGGGG + Intronic
1203779982 EBV:95931-95953 AGCAGGAGCAGGAGCGGGAGGGG + Intergenic
1203488670 Un_GL000224v1:83003-83025 AGCAGGGGCAACAGAGGGAGGGG - Intergenic
1203501291 Un_KI270741v1:24898-24920 AGCAGGGGCAACAGAGGGAGGGG - Intergenic
1185472204 X:390729-390751 GGCAGAGGCTGCAGAGGCTGTGG - Intergenic
1186470342 X:9816578-9816600 AGCAGCAGCAGCAGCAGCAGGGG - Intronic
1187181440 X:16946882-16946904 GGCGGCGGCGGCAGCGGCAGCGG + Exonic
1187205132 X:17174797-17174819 AGCAGCAGCAGCAGCGGCGGCGG - Intergenic
1187205133 X:17174800-17174822 AGCAGCAGCAGCAGCAGCGGCGG - Intergenic
1187367995 X:18680201-18680223 AGCAGCAGCAGCAGCAGCAAAGG - Intronic
1187443878 X:19344013-19344035 AGCACAGGCAGTGGCGGCAGCGG - Exonic
1187472378 X:19580553-19580575 AGCAGCAGCAGCAGCAGCACTGG + Intronic
1187507208 X:19887488-19887510 AGCAGCGGCAGCAGCAGCAGAGG - Exonic
1187547319 X:20266738-20266760 GGCGGCGGCGGCAGCGGCAGCGG + Exonic
1187547321 X:20266762-20266784 AGCGGCAGCAGCAGCAGCAGCGG + Exonic
1187547323 X:20266768-20266790 AGCAGCAGCAGCAGCGGCGGCGG + Exonic
1187587090 X:20675275-20675297 AGCAGCAGCAGCAGCAGCAATGG - Intergenic
1187795576 X:23000127-23000149 GTCAGGGGCAGCAGAGGCAGTGG + Exonic
1187795578 X:23000136-23000158 AGCAGAGGCAGTGGCTGGAGTGG + Exonic
1187915418 X:24149371-24149393 GGCCGAGGCGGCGGCGGCAGCGG + Intronic
1187932956 X:24311040-24311062 TGCAGCAGCAGCAGCGGCTGTGG + Intergenic
1188441564 X:30218780-30218802 CGCAGCCGCAGCAGCGGCAGTGG - Exonic
1188505391 X:30877083-30877105 TGGAGGGGCAGCAGGGGCAGAGG + Intronic
1188757961 X:33987544-33987566 AGCAGAGGTAGAGGTGGCAGTGG + Intergenic
1188768452 X:34125568-34125590 AGCAGCTGCAGCAGCAGCATTGG + Intergenic
1189042158 X:37553966-37553988 AGCAGAAGGAGCAGAGTCAGAGG + Intronic
1189104314 X:38220725-38220747 AGCAGCAGCAGCAGCAGCAGAGG + Exonic
1189131496 X:38502740-38502762 AGTAGAGACAGCAGCAGCACTGG + Intronic
1189384250 X:40524326-40524348 AGCAGCAGCAGCAGCAGGAGAGG - Intergenic
1189418454 X:40834529-40834551 AGCAGGAGCAGCAGCGGCGGAGG + Intergenic
1189498271 X:41529388-41529410 AGCAGCGGCAGCAGCAGCAGTGG + Intronic
1189659324 X:43279716-43279738 AGCAGCAGCAGCAGTGGCGGCGG - Intergenic
1189821528 X:44873580-44873602 AGCGGCGGCGGCAGCGGCGGCGG - Exonic
1190008061 X:46758956-46758978 AGCAGCAGCAGCCGCGGCGGCGG + Exonic
1190287618 X:48971496-48971518 GGCAGTGGCAGTAGCAGCAGCGG + Exonic
1190290320 X:48988166-48988188 AGCTGAGAGATCAGCGGCAGGGG - Exonic
1190573952 X:51814272-51814294 GGCGGTAGCAGCAGCGGCAGCGG - Intronic
1190573954 X:51814290-51814312 GGCAGCGGCAGCGGCGGCGGCGG - Intronic
1191830020 X:65406740-65406762 AGCAGCAGCAGCAGAAGCAGCGG + Intronic
1192261091 X:69506181-69506203 GGCAGCGGCAGCGGCCGCAGTGG + Intronic
1192656888 X:73002681-73002703 AGCAGGGGCGGGAGCGGGAGCGG - Intergenic
1192665232 X:73080320-73080342 AGCAGGGGCGGGAGCGGGAGCGG + Intergenic
1192739277 X:73877175-73877197 GGCAGAAGCAGCAGTGGCAGAGG - Intergenic
1192739278 X:73877181-73877203 AGCAGGGGCAGAAGCAGCAGTGG - Intergenic
1192847908 X:74925028-74925050 GGCAGAGGCGGCGGCGGCGGCGG - Exonic
1192847910 X:74925034-74925056 AGCTGAGGCAGAGGCGGCGGCGG - Exonic
1192925013 X:75747127-75747149 AGCGGCGGCGGCGGCGGCAGCGG - Intergenic
1192925016 X:75747139-75747161 GGCAGCGGCAGCAGCGGCGGCGG - Intergenic
1193454995 X:81720743-81720765 GTCATAGGCAGCAGCGGCAATGG - Intergenic
1193743287 X:85244148-85244170 AGCGGCGGCGGCAGCGGCGGCGG + Exonic
1193801460 X:85941849-85941871 AGCAGCAGCAGCAGCAGCAATGG + Intronic
1194206829 X:91019917-91019939 GGCAAAGGCAGCAGTGTCAGAGG + Intergenic
1194315600 X:92372593-92372615 CGCAGCGGCAGCAGCCACAGCGG + Intronic
1194318502 X:92412124-92412146 AGCAACAGCAGCAGCAGCAGAGG + Intronic
1194421023 X:93673108-93673130 GGCAGCAGCAGCAGCAGCAGCGG - Exonic
1194421024 X:93673129-93673151 AGTGGCAGCAGCAGCGGCAGCGG - Exonic
1194421077 X:93673471-93673493 CGCTGAGGTGGCAGCGGCAGTGG + Exonic
1194977682 X:100410226-100410248 AGCAGCAGCAGTAGCGGCGGCGG - Exonic
1195060457 X:101189448-101189470 AGCAGAGGACGCATCGTCAGAGG - Intergenic
1195114978 X:101688223-101688245 AGCAGGCACAGCAGCAGCAGGGG - Intergenic
1195310194 X:103624948-103624970 TGCAGAGGCAGCAGCCACAGAGG + Intronic
1195311791 X:103638907-103638929 TGCAGAGGCAGCAGCCACAGAGG + Intergenic
1195834367 X:109096122-109096144 AGCAGTTGCAACAGTGGCAGTGG + Intergenic
1195871168 X:109487839-109487861 AACAGCTGCAGCAGCTGCAGAGG + Intergenic
1196189417 X:112779343-112779365 AGCAGCAGTAGCAGCGGCAGTGG + Exonic
1197147242 X:123184353-123184375 AGAAGAGGAGGCGGCGGCAGCGG + Exonic
1197415258 X:126165946-126165968 AGCAGCGGCGGCGGCGGCGGCGG + Exonic
1197491936 X:127128683-127128705 AGCAGAGGCAGCAAAGGGAGTGG + Intergenic
1197754456 X:129984174-129984196 AGCAGCGGCGGCGGCGGCAGCGG - Intronic
1197754458 X:129984183-129984205 AGCAGGAGCAGCAGCGGCGGCGG - Intronic
1197783371 X:130177927-130177949 AGGAGAGGCAGCTGCGAAAGAGG + Intronic
1197903730 X:131400975-131400997 AGGAGCAGCTGCAGCGGCAGCGG - Intergenic
1197903731 X:131400981-131401003 AGCAGCAGGAGCAGCTGCAGCGG - Intergenic
1198005384 X:132488896-132488918 AGCGGCAGCAGCAGGGGCAGCGG + Intronic
1198377242 X:136052270-136052292 ACCATAGGCAGCAGCAGGAGAGG - Intergenic
1198683331 X:139204250-139204272 GGCAGCGGCGGCGGCGGCAGCGG - Intronic
1198767193 X:140091676-140091698 AGAGTAGGCAGCAGCGGCGGCGG + Intergenic
1199337849 X:146641207-146641229 AGGAGAGACAGCAAAGGCAGAGG - Intergenic
1199500370 X:148500675-148500697 AGCCGGGGCGGCAGCGGCGGCGG - Exonic
1199716858 X:150512757-150512779 GGCAGAAGCAGCAGCAGCGGTGG - Exonic
1199840975 X:151648668-151648690 AGCAGCAGCAGCAGCAGCAGCGG - Exonic
1200044795 X:153395795-153395817 AGCGGGGGCAGCAGCGGGAGGGG - Intergenic
1200063735 X:153495156-153495178 AGCGGAGGCAGCAGAGCCAGGGG - Intronic
1200078935 X:153566083-153566105 AGGAGAGGCTGCAGGGGCTGCGG - Intronic
1200110077 X:153736546-153736568 AGCACCTGCAGCAGCAGCAGGGG - Intronic
1200128920 X:153830671-153830693 GCCGGAGGCGGCAGCGGCAGCGG - Intergenic
1200138499 X:153886153-153886175 TGCTGCGGCAGCAGCGGCTGTGG + Intronic
1200252967 X:154563638-154563660 AGCAGCTGGAGCAGCTGCAGAGG + Exonic
1200264800 X:154640777-154640799 AGCAGCTGGAGCAGCTGCAGAGG - Intergenic
1200358503 X:155577781-155577803 AGTGGTGGCAGCAGTGGCAGTGG - Intronic
1200552580 Y:4594706-4594728 GGCAAAGGCAGCAGTGTCAGAGG + Intergenic
1200623649 Y:5484132-5484154 CGCAGCGGCAGCAGCCACAGCGG + Intronic
1201300199 Y:12498574-12498596 AGAAGAAGCAGCAGCAGGAGCGG - Intergenic
1201339426 Y:12917482-12917504 CGCGGAAGCAGCAGCCGCAGTGG + Exonic
1202602968 Y:26613299-26613321 AGCAGAGCCAGGAGTGGCTGTGG + Intergenic