ID: 946410844

View in Genome Browser
Species Human (GRCh38)
Location 2:219514511-219514533
Sequence GCAGCGGCAGAGGCAGCACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1267
Summary {0: 1, 1: 0, 2: 14, 3: 133, 4: 1119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946410839_946410844 22 Left 946410839 2:219514466-219514488 CCACAAGGAGACGATCGAGGAGA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 946410844 2:219514511-219514533 GCAGCGGCAGAGGCAGCACCAGG 0: 1
1: 0
2: 14
3: 133
4: 1119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946410844 Original CRISPR GCAGCGGCAGAGGCAGCACC AGG Exonic
900088805 1:910355-910377 GGACCGACAGAGGCAGCCCCGGG - Intergenic
900187189 1:1337993-1338015 GCTATGGCAGCGGCAGCACCGGG - Exonic
900228280 1:1543056-1543078 GCAGAGGCAGAGGCAGAGGCGGG + Intronic
900373373 1:2342338-2342360 GCCGCGGCAGGCGCAGGACCTGG + Intronic
900507615 1:3037493-3037515 GGAGGGGCAGAGGCAGCATTTGG + Intergenic
900558091 1:3290008-3290030 ACAGCAGCAGGGGCAGCCCCAGG - Intronic
900582332 1:3415327-3415349 GCAGCGCCATGGGCTGCACCTGG + Intronic
900970131 1:5987465-5987487 GGTGGGGCAGAGGCAGCAGCAGG + Intronic
901041865 1:6368801-6368823 GCAGCAGCAGTGGCAGCAGTGGG - Intronic
901057501 1:6455471-6455493 GCAGCTGCTGAGGCAGCGGCAGG + Intronic
901253263 1:7797853-7797875 GCAGCTGCAGTGGTAACACCGGG + Intronic
901361416 1:8703728-8703750 GCAGAAGCAGAGGCAGCTCTAGG - Intronic
901479065 1:9511654-9511676 AAAGCGGCAGAGGCAACGCCAGG + Intergenic
901540120 1:9910195-9910217 GCGGCGGCAGTAGCAGCAGCAGG + Exonic
902150762 1:14441379-14441401 GCAGCAGCAGCAGCAGCACCTGG + Intergenic
902259703 1:15215357-15215379 GCAGCGGCAGGGCGAGGACCTGG + Exonic
902476859 1:16693007-16693029 GCAGCTGCTGAGGCAGCGGCAGG - Intergenic
902511815 1:16970743-16970765 GCAGAGGCAGATCCAGCAGCTGG + Exonic
902954639 1:19917158-19917180 GCAGCCGCAGAAGCAGCAGCAGG - Intergenic
903016759 1:20366572-20366594 GCAGCGCGAGAGGCAGAACCTGG - Intergenic
903294194 1:22333253-22333275 GCCGTGGCAGAGGCAGGAGCTGG - Intergenic
903319837 1:22536132-22536154 GGAGCAGCAGAGGCCTCACCTGG + Intergenic
903330629 1:22595285-22595307 GCAGGAGCAGAAGCACCACCAGG - Exonic
903398298 1:23019633-23019655 GCGGCTGCAGCGGCAGCAACCGG + Exonic
903875141 1:26468918-26468940 GGAGCGGAAGAGGCAGCAGCTGG + Exonic
903894566 1:26595422-26595444 GCAGAGGCAGAGGCAGGGGCAGG - Intergenic
903894569 1:26595428-26595450 GCAGAGGCAGAGGCAGAGGCAGG - Intergenic
904245091 1:29181828-29181850 GCAGCGGCGGCGGCGGCAACGGG + Exonic
904583988 1:31569030-31569052 TCAGAGGCAGAGGCAGAGCCAGG + Intergenic
905022239 1:34825816-34825838 GCAGAGGCAGGGCCAGGACCAGG + Intronic
905181918 1:36172510-36172532 GCTGCGGGAGAAGCAGCTCCAGG + Exonic
905241228 1:36582771-36582793 GCAGAGGCAGTGGCTGCACGGGG + Intergenic
905416686 1:37808639-37808661 GCAGCGGCAGCGGCAGCTCCTGG + Exonic
905895403 1:41542650-41542672 GCAGAGGCAGAGGCAGTGCAAGG + Intronic
906289429 1:44610291-44610313 GCAAGGGCTGAGGCAGCGCCCGG + Intronic
907105474 1:51878695-51878717 CCCGCGGCTGCGGCAGCACCAGG - Exonic
907238901 1:53069867-53069889 GCAGCAGGAGCAGCAGCACCCGG - Exonic
907431486 1:54414615-54414637 GCAGAGGAGGAGGCAGCCCCGGG + Intergenic
907702854 1:56806210-56806232 GCAGCACCAGAGGCAGGACAGGG + Intronic
907935573 1:59039114-59039136 GGAGAGTCTGAGGCAGCACCAGG - Intergenic
908033524 1:60027435-60027457 GCAGGGCCAGAGGAAGCGCCAGG - Intronic
908959624 1:69680115-69680137 GCAGCAGCAGCAGCAGCATCTGG + Intronic
909318035 1:74248120-74248142 GAAGCTGCAGAGGGTGCACCGGG - Intronic
910171861 1:84386494-84386516 GCAGCAGCAGAGGTAGCAGAGGG + Intronic
910274754 1:85437101-85437123 GCAGCGAGAGAGGGAGAACCAGG - Intronic
910446143 1:87300422-87300444 GCAGCGCCAGATTCAGAACCAGG - Intergenic
911226888 1:95316633-95316655 GCAGGGGCAATGGCATCACCAGG - Intergenic
911288592 1:96028247-96028269 GCAGCAGGACAGGCAGCTCCAGG + Intergenic
911950879 1:104172475-104172497 GCAGCTGCGGAGGGGGCACCGGG + Intergenic
912222353 1:107692728-107692750 GCAGCAGCAGGAGCAGCAGCTGG + Intronic
912366572 1:109138573-109138595 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
912373780 1:109193833-109193855 ACAGCAGCAGAGGGAGCTCCAGG - Intronic
912486670 1:110034716-110034738 GCAGCCGCACAGCCACCACCCGG + Exonic
912844201 1:113064393-113064415 GGAGAGGCAGAGGCAGAAGCAGG + Intergenic
913169202 1:116217134-116217156 GCAGAGGCAGAGGCAAGGCCTGG - Intergenic
913178643 1:116298196-116298218 GCAGCTGCAGAGGGTGCGCCAGG - Intergenic
913280712 1:117182492-117182514 GCAGCCGCAGGGGCTGCAGCCGG - Intronic
913958580 1:143323047-143323069 GCAGCAGCAGGGGCAGGGCCTGG + Intergenic
914052897 1:144148427-144148449 GCAGCAGCAGGGGCAGGGCCTGG + Intergenic
914126300 1:144818114-144818136 GCAGCAGCAGGGGCAGGGCCTGG - Intergenic
914490332 1:148147275-148147297 CCATCGGCTGAGGCAGCACTTGG + Intronic
914747554 1:150511143-150511165 GCTGCGGCAGTGGCAGCAGCGGG - Exonic
914843339 1:151266027-151266049 GCAGCGGCAGCGGCAGGAGGAGG + Exonic
914852804 1:151327386-151327408 GCGGCCGCGGAGGCTGCACCAGG + Exonic
914915229 1:151815333-151815355 GCAGCGGCAACAGCAGCAACAGG - Exonic
914950474 1:152109616-152109638 GGAGCGGGAGAGGCAGTATCGGG - Exonic
914950663 1:152110819-152110841 GCAGCGGGAGAGGCAGCTGAGGG - Exonic
914950875 1:152112400-152112422 GCAGCGGCAAAGAGAGCTCCAGG - Exonic
915067064 1:153233456-153233478 GCAGAGGCAGAGGCAGAAAGAGG + Intergenic
915128000 1:153679159-153679181 GCAGCAGCGGCGGCAGCAGCAGG - Exonic
915142361 1:153775509-153775531 ACAGCAGCAGGGGCAGCAGCAGG - Exonic
915163416 1:153934802-153934824 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
915184994 1:154098098-154098120 GCAGTGGGACAGGCAGCTCCAGG + Intronic
915242320 1:154532305-154532327 GCAGCTGCGGAGGGTGCACCAGG - Intronic
915556744 1:156665024-156665046 GGAGCGGCAGCAGCAGCAACGGG + Intergenic
915647742 1:157285967-157285989 GCAGAGGGAGATGCAGCACAGGG - Intergenic
916482325 1:165225754-165225776 GCAGCAGCAGCAGCATCACCTGG - Intronic
916890219 1:169106459-169106481 GCAGCGGGAGCGGCAGCTACGGG + Exonic
917235573 1:172888492-172888514 GCAGCCATAGAGGCTGCACCTGG - Intergenic
917922040 1:179758785-179758807 GAAGGGGCTGAGGCAGCCCCAGG - Intronic
918149435 1:181785388-181785410 GAAGAAGCAGAGGCAGCAGCTGG + Exonic
918154583 1:181832563-181832585 GCAGCTGCAGAGGGGGCACCAGG + Intergenic
918209811 1:182340537-182340559 GCACAGACAGATGCAGCACCAGG - Intergenic
918712747 1:187751280-187751302 ACAGTGGCATAGGCAGCAGCAGG + Intergenic
918789978 1:188813228-188813250 GCAGCTGCGGAGGGTGCACCGGG + Intergenic
918793184 1:188857807-188857829 GCAGCTGCAGAGGGTGCACTGGG + Intergenic
919163336 1:193860356-193860378 GCAGCAGCAGCAGCATCACCTGG + Intergenic
919454051 1:197801824-197801846 GCAGCAGCATAGGCAGCTCCAGG - Intergenic
920110591 1:203584416-203584438 GCAGCGGCTAAGCCAGGACCAGG + Intergenic
920234623 1:204494557-204494579 GCAGAGGGAGAGGCAGCAAAGGG + Intronic
920299948 1:204982545-204982567 GGAGCCGCAGCGGGAGCACCAGG - Intronic
920458137 1:206116611-206116633 ACAGCAGCTGTGGCAGCACCTGG + Exonic
921094421 1:211874505-211874527 GCAGCTGCAGAGGGTGCGCCAGG - Intergenic
921180159 1:212625712-212625734 GCAGCAGCAGGGGCAGCTGCAGG + Exonic
921180162 1:212625724-212625746 GCAGCTGCAGGGGCAGCAACAGG + Exonic
921189848 1:212699672-212699694 GCAGCCGCAGCCGCAGCAGCAGG - Exonic
921325393 1:213983029-213983051 GCCGCGGCAGCCGCAGCATCTGG + Intergenic
921390206 1:214607939-214607961 CCATCGGCCGAGGCAGCACTTGG - Intronic
921466772 1:215497676-215497698 GCAGCAGCAGAGGCAGCAGCAGG + Intergenic
922314883 1:224434158-224434180 GCGGCGGGAGGGGCAGCAGCCGG + Exonic
922335592 1:224616341-224616363 GCGGCGGCAGCGGCAGCAGCAGG + Exonic
922513182 1:226186558-226186580 GCAGCGGTGGCGGCAGCAGCGGG + Exonic
923119711 1:230978798-230978820 GCAGCAGCAGCAGCAGCAGCCGG + Exonic
923141454 1:231163716-231163738 GCGGCGGCGGCGGCTGCACCAGG - Exonic
923369363 1:233295331-233295353 GCAGGGCCAGGGGCAGCAGCAGG + Exonic
923786362 1:237072207-237072229 GCAGCGGGGGAGGCACAACCGGG - Intronic
923810519 1:237309839-237309861 GCAGCTGCAGAGGGTGCACCAGG - Intronic
924052522 1:240092769-240092791 GCAGCAGCAGCAGCAGCTCCAGG + Exonic
924571583 1:245241758-245241780 ACAGCGGCAGCGGGAGCACTGGG + Intronic
924665708 1:246069732-246069754 CCTGAGGCAGAGGCAGCAGCAGG + Intronic
924706284 1:246505431-246505453 GCAGCAGCAGCAGCAGCACCAGG + Intronic
924740940 1:246794003-246794025 GCAGGGGCAGGGGGAGCACAGGG + Intergenic
1062849116 10:729363-729385 GCAGCGTGAGTGGCAGGACCAGG + Intergenic
1063029237 10:2215048-2215070 TCAGAGGCAGAGGCGGCCCCTGG - Intergenic
1063149313 10:3322207-3322229 GCAGAGGCAGGAGCAGCACTGGG + Intergenic
1063275128 10:4557653-4557675 GCAGCGGTAGCAGCAGCTCCAGG + Intergenic
1063429626 10:5977429-5977451 GCAGCAGCAGTAGCAGCGCCGGG + Exonic
1063478562 10:6350139-6350161 GCAGCAGCACAGGCATAACCTGG - Intergenic
1063695614 10:8332380-8332402 GCAGCGGCAGAGGGAGGTGCTGG + Intergenic
1064323741 10:14329978-14330000 GCAGCGGCAGCAGCAGCCCACGG + Intronic
1064642331 10:17427346-17427368 CCAGCAGCATTGGCAGCACCAGG - Intronic
1064645340 10:17454195-17454217 GCAGCAGCAGCAGCAGCAGCAGG + Exonic
1065069111 10:22003691-22003713 ACAGCTGTAGAGGCAGCGCCCGG + Exonic
1065201349 10:23316220-23316242 GCAGCAGGGCAGGCAGCACCAGG + Intronic
1065483509 10:26216280-26216302 GCAGCGGCTGTGGCAGCACCCGG + Intergenic
1065925998 10:30434240-30434262 GCGGCGGCAGCGGCAGAAGCAGG - Exonic
1065965839 10:30769632-30769654 GCAGCTGCAGAGGGTGCGCCGGG - Intergenic
1066431611 10:35357167-35357189 GCAGGGGCAGGGGCAGGAGCAGG - Intronic
1066745978 10:38604465-38604487 GCAGCGGCTGGAGCAGCAGCTGG + Intergenic
1066759083 10:38737529-38737551 GCAGCAGCAGGGGCAGGGCCTGG - Intergenic
1066962544 10:42235241-42235263 GCAGCAGCAGGGGCAGGGCCTGG + Intergenic
1067560357 10:47300693-47300715 GCAGCAGCAGCAGCAGCAGCTGG - Exonic
1067696919 10:48542489-48542511 GCGGAGGCAGAGGCAGCAGGAGG - Intronic
1067731352 10:48813983-48814005 GCTCCTGCAGAGGCACCACCAGG + Exonic
1067762501 10:49058754-49058776 GCAGCCTCAGAGCCAGCACATGG + Intronic
1068211337 10:53924329-53924351 GCAGCTGCGGAGGGTGCACCGGG + Intronic
1068763089 10:60733668-60733690 GGAGCAGCAGAGGCAGCTCCAGG + Intergenic
1068820963 10:61377084-61377106 GCAGCTGCCGAGGGTGCACCGGG - Intergenic
1069590139 10:69636280-69636302 GCACCTGCAGAGGCAGCTCAGGG - Intergenic
1069788380 10:71004243-71004265 ACAGTGGCAGAGGCAGGACCAGG - Intergenic
1069805073 10:71117087-71117109 GCAGCCATAGAGGCTGCACCTGG + Intergenic
1069819269 10:71217534-71217556 GCAGCGGCTGAGGCGGCTCCGGG - Intronic
1069987197 10:72292502-72292524 GCAGCGGCAGAGGCTGAAAGTGG + Intergenic
1070172729 10:73944750-73944772 GCAGCTGCAGAGGGTGTACCGGG + Intergenic
1070570865 10:77638461-77638483 GCAGCAGCAGCTGCAGCAACTGG + Intronic
1070614551 10:77959398-77959420 GTGGAGGCAGAGGCAGCACCGGG + Intergenic
1070685396 10:78476797-78476819 GCAGGGGCAGGGGCAGGAACTGG - Intergenic
1070732911 10:78843841-78843863 GAAGTGGAAGAGGCAGCACCTGG - Intergenic
1070742899 10:78914068-78914090 GCACCAGCAGCGGCAGCAGCCGG - Intergenic
1071293596 10:84203908-84203930 CCAAGGGAAGAGGCAGCACCTGG + Intronic
1071444202 10:85730848-85730870 GCAGCAGCAGCAGCATCACCTGG - Intronic
1071523352 10:86344520-86344542 ACGGCCTCAGAGGCAGCACCTGG - Intronic
1071566245 10:86672842-86672864 GCAGCTGCATAAGCAGCCCCAGG + Intronic
1071572677 10:86706604-86706626 GCACTGGGAGAGGCAGCAGCAGG - Intronic
1071766204 10:88668681-88668703 GCAACAGCAGAGGAAACACCTGG + Exonic
1071857951 10:89644999-89645021 GCAGCCGCAGAGCCGGCGCCTGG + Exonic
1071919415 10:90332417-90332439 ACAGCTGCAGAGGCTGCAGCAGG + Intergenic
1072167353 10:92826980-92827002 GCAGAGGGAGAGGCAGAACATGG + Intergenic
1072290319 10:93959242-93959264 GCAGCGGCAGCGGCAGGAGGAGG - Intergenic
1072654323 10:97319717-97319739 GCAGCAGCAGCGGCACCGCCGGG - Exonic
1072656561 10:97334287-97334309 GCAGCAGCAGCGGCACCGCCGGG + Exonic
1073101828 10:101010531-101010553 GCAGCCGCAGCCGCAGCAGCCGG - Intronic
1073249890 10:102114854-102114876 GCACCAGGAGAGGCAGGACCCGG + Intronic
1073262483 10:102201081-102201103 GCAGCTGCAGAGGGGGCGCCGGG - Intergenic
1073326293 10:102645543-102645565 GCAGCTGGAGAGGCAGGACCGGG - Intronic
1073485767 10:103818248-103818270 GAGGGGGCAGAGGGAGCACCAGG - Intronic
1074437441 10:113446070-113446092 ACAGCAGCAGAGACAGGACCAGG + Intergenic
1074503110 10:114043943-114043965 GCAGCGGCAGCGACAGCGCTCGG + Intergenic
1074808087 10:117073994-117074016 GCAGGGGCAGAGGCAGCACTAGG + Intronic
1074993607 10:118735402-118735424 GCAGCAGCAGCAGCATCACCTGG + Intronic
1075015926 10:118909990-118910012 GCAGAGGCAGAGACAGGAGCTGG + Intergenic
1075085188 10:119410006-119410028 GCAGCTGCAGGAGCAGCAGCAGG - Intronic
1075625629 10:123962751-123962773 AGGGCAGCAGAGGCAGCACCTGG - Intergenic
1075782570 10:125026679-125026701 GCAGCTGCGGAGGCAGGACCGGG - Exonic
1076035553 10:127196289-127196311 GCAGCGGCTGGGCCAGCTCCGGG + Intronic
1076290611 10:129342739-129342761 GCAGCTGAACAGGCAGCACAAGG + Intergenic
1076462624 10:130656924-130656946 GCATCTCCACAGGCAGCACCAGG + Intergenic
1076575263 10:131461623-131461645 GCATCAGCAGAGGCAGCCTCAGG - Intergenic
1076756136 10:132572759-132572781 GCAGGGCCAGAAGCAACACCAGG - Intronic
1076789520 10:132769387-132769409 GCAGAGGCAGAGGCAGCCCAAGG - Intronic
1076861494 10:133140211-133140233 GCAGGGGCAGGGGCAGCACAGGG - Intergenic
1076861538 10:133140321-133140343 GCAGGGGCAGGGGCAGCACAGGG - Intergenic
1076893156 10:133294980-133295002 GCAGAGTCAGAGGCAGTTCCTGG - Intronic
1077072461 11:682085-682107 GCAGCAGCCGAGGCCGCCCCAGG - Intronic
1077098919 11:812606-812628 GCAGGGGCAGAACCAGCAGCAGG - Exonic
1077102933 11:830177-830199 GCAGCAGCAGAGGCGGTGCCAGG + Intronic
1077339380 11:2019206-2019228 GGACCAGCAGAGGCTGCACCTGG + Intergenic
1077365292 11:2159098-2159120 GCAGGGACCGTGGCAGCACCTGG - Intronic
1077530712 11:3093564-3093586 ACAGAGGCTGAGGCAGCACACGG - Exonic
1077886373 11:6390700-6390722 CCAGCGCCAGCGCCAGCACCAGG - Exonic
1078146620 11:8726046-8726068 GCAATGGCAGAGGTGGCACCTGG - Intronic
1078370730 11:10742572-10742594 CCAGCAGCATGGGCAGCACCTGG + Intergenic
1078668042 11:13342071-13342093 GCCTGGGGAGAGGCAGCACCTGG + Intronic
1079071854 11:17353714-17353736 GCAGCAGCAGCAGCAGCTCCTGG + Intronic
1079240847 11:18721280-18721302 GCAGGGGCAGAGCCAGAACGTGG - Intronic
1079573150 11:21969470-21969492 GCAGAGGTACAGCCAGCACCTGG - Intergenic
1079803177 11:24896439-24896461 GCAGCTGCAGAGGGGGCGCCGGG + Intronic
1080107497 11:28526013-28526035 GCAGCTGCAGAGGGTGCGCCAGG - Intergenic
1081324459 11:41728296-41728318 GCAGCTGCAGAGGGTGCGCCAGG - Intergenic
1082561946 11:54628517-54628539 GCAGTGGCAGTGGCAGCCTCAGG + Intergenic
1083315298 11:61811216-61811238 TCAGTGGCAGAGGCAGAACTAGG - Intronic
1083329613 11:61891459-61891481 GCGGCGGCGGAGGCGGCGCCCGG - Exonic
1083430967 11:62613299-62613321 GGGGCTGCAGGGGCAGCACCAGG - Exonic
1083431504 11:62615727-62615749 GCAGCTGCAGCGGCAGGGCCGGG - Exonic
1083528621 11:63396368-63396390 ACAGGGGCAGAGGAAGCAGCAGG - Intronic
1083572627 11:63768566-63768588 GCGGCGGCAGGGGCGGCCCCGGG - Exonic
1083635742 11:64120078-64120100 GCAAAGGCAGAAGCAGCAGCGGG + Intronic
1083657694 11:64237571-64237593 GCAGCGGCAGCGGCAGGTCCGGG - Exonic
1083680910 11:64351508-64351530 GCAGGGGCAGCTGCAGCACCTGG + Exonic
1083851309 11:65369039-65369061 GCAGCAGCAGCAGCAGCATCTGG + Intergenic
1084274412 11:68044173-68044195 GCGGCAGCAGCTGCAGCACCCGG - Exonic
1084544899 11:69810373-69810395 GCGGCGGCAGAAGCAGAGCCCGG - Exonic
1084605601 11:70170015-70170037 GAAGCCCCAGAGGCAGCTCCCGG + Intronic
1084650494 11:70486696-70486718 GCAGCGGCACAGCCGGCCCCGGG - Intronic
1084658515 11:70533547-70533569 GCTGCGGCAGAGGGAACGCCAGG - Intronic
1084697039 11:70761916-70761938 GCAGCAGCAGCAGCAGCAGCCGG - Intronic
1085127065 11:74008989-74009011 GCCACGGCAGGGGCAGCACAGGG + Exonic
1085294394 11:75422806-75422828 GCAGGGACAGAGGAAGCCCCAGG - Intronic
1085300695 11:75456683-75456705 GCAGCAGCAGAGGAAGGGCCTGG - Intronic
1085732985 11:79014899-79014921 GCAGGGGCAGAGGCATGTCCAGG - Intronic
1085963621 11:81494710-81494732 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
1086079593 11:82889540-82889562 GCAGCAGAAGACGCAGCAGCAGG + Intronic
1086524833 11:87712858-87712880 GCAGCAGCAGTGGCATCACCTGG + Intergenic
1087407765 11:97751677-97751699 GCAGCGGAACAGGCAGCTTCAGG + Intergenic
1087682342 11:101231548-101231570 GCAGCTGCAGAGGGTGCGCCAGG - Intergenic
1087683801 11:101241462-101241484 GCAGCTGCAGAGGGTGCATCGGG - Intergenic
1087977263 11:104565161-104565183 GCAGCTGCAGAGGGTGCGCCAGG - Intergenic
1088696269 11:112368663-112368685 CCAGCGGCAGAAGCAGCAGGAGG - Intergenic
1088859944 11:113790166-113790188 GCAGCGGCGGCAGCAGCACCAGG + Intergenic
1088863107 11:113820806-113820828 GGGGAGGCAGAAGCAGCACCAGG - Intronic
1089283520 11:117391176-117391198 GCAGCAGCTGAGGGAGCAGCTGG + Exonic
1089532303 11:119138266-119138288 GCAGAGGCAGAGGCAGAGGCAGG + Intergenic
1089653905 11:119933273-119933295 GCAGCGGCAGTGGCAGAAGCTGG - Intergenic
1090257075 11:125292374-125292396 GGAGTGGCAGTGGCAGCAGCAGG + Intronic
1090392576 11:126398643-126398665 GCAGGGTCAGAGCCACCACCAGG - Intronic
1090699386 11:129279922-129279944 GCAGCAGCAGCAGTAGCACCGGG + Intergenic
1090832338 11:130428226-130428248 GCAGCAGCAGCAGCAGCAGCAGG + Exonic
1090914833 11:131154241-131154263 CCAGCGGCACCAGCAGCACCGGG - Intergenic
1091114007 11:132996955-132996977 GCCTCGGCAGAGGCCGCACCAGG - Intronic
1202822365 11_KI270721v1_random:74395-74417 GGACCAGCAGAGGCTGCACCTGG + Intergenic
1091395932 12:154303-154325 GCAGAGGCAGCGGGAGCAGCTGG - Intronic
1091504401 12:1052195-1052217 CCAGCAGCAGAAGCATCACCTGG - Intronic
1091571522 12:1691091-1691113 GCAGCGGCGGCGGCTACACCGGG + Exonic
1091594334 12:1865654-1865676 CCAGCAGCAGCAGCAGCACCAGG + Intronic
1091778843 12:3201198-3201220 CAAGCAGCAGAGGCAGCCCCTGG - Exonic
1092247953 12:6873638-6873660 GCTGCGGCAGAGTCCGCACCCGG + Intronic
1092701744 12:11239274-11239296 CCAGCATCAGAGGCAGCACCTGG - Intergenic
1093584306 12:20819083-20819105 GCAGCGGCAGCCGCTGCACGCGG + Intronic
1093921672 12:24866224-24866246 GCAGCTGCGGAGGGTGCACCGGG + Intronic
1093988976 12:25569124-25569146 GCAGCTGCAGGGGCTGCACCCGG + Intronic
1094129908 12:27063607-27063629 GAAGCAGCAGAAGCAGCAGCAGG - Intronic
1094494560 12:30981245-30981267 GCAGAGCCAGGGCCAGCACCCGG + Intronic
1094494775 12:30982503-30982525 GCAGAGGCAGAGGCAGAGGCTGG - Intronic
1095326655 12:40903175-40903197 GCAGCAGCAGCAGCAGTACCTGG + Intronic
1095533190 12:43214679-43214701 GCAGTGGCAGAGGGAGAAACAGG - Intergenic
1096176562 12:49524753-49524775 GAAGCAGCAGAGGCATCACTTGG - Exonic
1096569423 12:52512732-52512754 GCAGCGGCAGCGGTGGCAACAGG - Intergenic
1096848161 12:54419108-54419130 GCAACAGCAGCGGCAGCAGCGGG + Exonic
1097100370 12:56584065-56584087 GCAGTGGCAGCAGCATCACCTGG - Intronic
1097253687 12:57655914-57655936 GCAGCTGCAGAGGATGCACTGGG + Intergenic
1097536066 12:60872432-60872454 GCAGCGGGATGGGCAGCTCCAGG + Intergenic
1098498754 12:71166421-71166443 GCAGCTGCAGAGGGTGCGCCGGG - Intronic
1100848026 12:98679794-98679816 GCAGCGGGGCAGGCAGCTCCAGG - Intronic
1101253835 12:102958409-102958431 GCAGCAGCAGCAGCAGCAGCAGG + Exonic
1101580783 12:106039487-106039509 GCAGTGGCGCAGGCAGCTCCAGG + Intergenic
1101603847 12:106233158-106233180 GCAGCTGCAGAGGGTGCGCCGGG + Intergenic
1101760207 12:107652115-107652137 CCAGCAGCAGAGACATCACCTGG - Intronic
1102465256 12:113127133-113127155 GCAGAGGCAGAGGCAGAGGCAGG - Intronic
1103624504 12:122207610-122207632 GCAGCGCCCCAGGCAGCGCCCGG - Intronic
1103706484 12:122876872-122876894 GCAGGGGCAGAGGCAGAGGCAGG + Intronic
1103920580 12:124397166-124397188 GCTGAGGCCGGGGCAGCACCTGG - Intronic
1103981563 12:124740099-124740121 GCAGAGGCAGAGGCAGAGGCAGG - Intergenic
1104021249 12:124993835-124993857 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1104198754 12:126567186-126567208 GCAGCTGCGGAGGATGCACCAGG + Intergenic
1104800836 12:131554442-131554464 GGAGGGGCAGTGGCAGCACCGGG + Intergenic
1104989567 12:132618322-132618344 GCTGCGGCGGAGGCAGGAGCTGG + Intergenic
1105605152 13:21920878-21920900 GCAGCTGCAGAGGGTGCGCCGGG - Intergenic
1105971409 13:25432250-25432272 GCCAGGGCAGAGGCAGCACTGGG + Intronic
1106027940 13:25973114-25973136 GCAAAGGCAGGGGCAGCAACCGG - Intronic
1106200702 13:27534591-27534613 GGAGCGGCTGAGTCAGCAGCAGG + Intergenic
1106477734 13:30112767-30112789 GCAGAGGGAGAGCCTGCACCTGG + Intergenic
1106956411 13:34942912-34942934 GCAGCGGTGGTGGCGGCACCGGG + Exonic
1106995558 13:35476296-35476318 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1107026280 13:35804867-35804889 ACAGCCACAGAGGCAGCATCGGG + Intronic
1107276713 13:38687428-38687450 GCAGCAGCAGCAGCAGCAGCCGG - Exonic
1107770894 13:43786814-43786836 GCAGCGGCGGCGGCAGCAGAGGG - Exonic
1108695638 13:52900200-52900222 GCAGCAGCAGCAGCATCACCTGG + Intergenic
1109111012 13:58318749-58318771 GCAGCTGCAGAGGGTGCACCGGG - Intergenic
1109134136 13:58625715-58625737 GCAGTGGCAGCAGCAGCAGCAGG - Intergenic
1109416446 13:62046751-62046773 GCAGCTGCAGAGGGGGCGCCGGG - Intergenic
1109495632 13:63168153-63168175 GCAGCAGCAGCAGCAGCATCAGG + Intergenic
1109821135 13:67656849-67656871 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
1109994679 13:70107942-70107964 GCAGGAGCAGAGGCAGGACTGGG + Exonic
1110322403 13:74175054-74175076 GCAGTGACAGTAGCAGCACCCGG - Intergenic
1111220910 13:85205060-85205082 GCAGCTGCAGAGGGTGCGCCAGG + Intergenic
1111333571 13:86792404-86792426 GCAGCTGCAGAGGGGGCGCCAGG + Intergenic
1112296387 13:98190991-98191013 ACAGTGCCAGAGGCAGGACCGGG - Intronic
1112505228 13:99971091-99971113 GCAGCGGCAAAGGCCACAGCAGG - Exonic
1112570744 13:100590745-100590767 CCAGCAGCACTGGCAGCACCTGG + Intergenic
1112595593 13:100804372-100804394 GCCGAGGCAGAGGGATCACCAGG - Intergenic
1113200782 13:107866299-107866321 GCAGCAGCAGCGGCGGCAGCAGG - Exonic
1113450707 13:110407458-110407480 GCCGTGGCACACGCAGCACCAGG + Intronic
1113680263 13:112238835-112238857 GCAGCTGCAGAGGGTGCACTGGG + Intergenic
1113683540 13:112261777-112261799 GCAGCTGCAGAATCAGCTCCAGG - Intergenic
1113903010 13:113806840-113806862 GCAGGGGCAGAGGTATCTCCAGG + Intronic
1113910061 13:113837497-113837519 CCAGTGGCAGCAGCAGCACCTGG + Intronic
1113928258 13:113952886-113952908 GGCGGGGCAGAGGCAGCCCCCGG + Intergenic
1114174589 14:20309268-20309290 GCAGAGGCAGAGGCAGGGGCAGG - Intergenic
1114559642 14:23580744-23580766 GCAGCTGCAGAGGGTGCGCCTGG + Intergenic
1115465260 14:33708080-33708102 GCAGCAGCAGCAGCAGCAGCTGG + Intronic
1115533234 14:34346012-34346034 GCAGCTGCAGAGGTTGCGCCGGG - Intronic
1115687199 14:35808836-35808858 GCAGTGGCAGTGGCAGCGACAGG - Exonic
1115754241 14:36517514-36517536 GCAGCAGCAGGCGCAGCACCAGG - Exonic
1116152167 14:41154605-41154627 GTAGAGGGAGAGGCACCACCGGG - Intergenic
1116297904 14:43136140-43136162 GCAGCTGCAGAGGGTGCACTGGG - Intergenic
1116849356 14:49893085-49893107 GCAGCGGCGGCGGCAGAACTGGG + Exonic
1116895522 14:50312010-50312032 GTAGCCGCAGCGCCAGCACCAGG - Exonic
1117763830 14:59059683-59059705 GCAGAGGCAGAGGCAGAGGCAGG + Intergenic
1117763833 14:59059689-59059711 GCAGAGGCAGAGGCAGGGGCAGG + Intergenic
1117875722 14:60249000-60249022 GCAGCGGCAGAGAAAGAAGCTGG + Intronic
1118059177 14:62116960-62116982 TCAGCGGCTGAGGAAGCAGCGGG - Intergenic
1118324055 14:64769601-64769623 CCTGCTGCAGCGGCAGCACCAGG - Exonic
1118443390 14:65831368-65831390 GCAACGGCAGAGGCTAAACCGGG + Intergenic
1118857956 14:69638687-69638709 ACAGCAGCACTGGCAGCACCTGG - Intronic
1119322288 14:73739222-73739244 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1120016175 14:79476244-79476266 ACAGCAGCAGTGACAGCACCAGG - Intronic
1120185875 14:81393407-81393429 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
1120214670 14:81668924-81668946 GCAGCTGCAGAGGGGGCACCAGG - Intergenic
1120431416 14:84420711-84420733 GCAGCAACAGAGGCAGCATTTGG + Intergenic
1121016678 14:90553166-90553188 GCACAGCCAGAGGCAGCCCCAGG + Intronic
1121137398 14:91510692-91510714 GCAGGGGCAGAGGCAGGGACGGG - Intergenic
1121195848 14:92071010-92071032 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1121242860 14:92442558-92442580 GCAGAAGCAGTGGCAGAACCAGG - Intronic
1121730845 14:96186064-96186086 GCAGAGGCAGAGGCAGAATTTGG + Intergenic
1121742510 14:96264126-96264148 GCAGCGGCGGAGGCAGGCCCGGG + Exonic
1121876363 14:97456978-97457000 ACAGAGCCAGAGGCAGCACCTGG + Intergenic
1122216530 14:100208381-100208403 GCAGCTGCGGAGGGCGCACCGGG - Intergenic
1122369598 14:101222054-101222076 GCAGGGGCAGGGGCAGCGGCAGG - Intergenic
1122389238 14:101369014-101369036 GCACTGGCAGAGGCAGCATCTGG + Intergenic
1122414341 14:101541705-101541727 GCAGTGGCAGAGGCAGACCTTGG + Intergenic
1122434984 14:101689227-101689249 GCAGCTGCGGAGGGTGCACCAGG + Intergenic
1122537062 14:102472849-102472871 GCCTCGGCAGGGGCAGCACCTGG - Intronic
1122541470 14:102499948-102499970 GTGGCAGCAGAGGCAGCCCCAGG + Exonic
1122652168 14:103231976-103231998 GCAGTGGCAGGGGCTGTACCTGG - Intergenic
1122743121 14:103883128-103883150 GCAGCGGCAGGGGCTGCATCAGG - Intergenic
1122874146 14:104655573-104655595 GCCGAGGCAGAGGCAGCAGCCGG + Intergenic
1122897899 14:104769450-104769472 GCAGCGGCAGCGGCAGCGTCTGG + Exonic
1122984362 14:105205457-105205479 GCAAGGGCAGAGGCAGCAGCGGG - Intergenic
1123078295 14:105680168-105680190 GCAGGGGCAGGGGCAGGGCCAGG - Intergenic
1123422477 15:20144100-20144122 GCAGCAGCAGGGGCAGGGCCTGG + Intergenic
1123531705 15:21150640-21150662 GCAGCAGCAGGGGCAGGGCCTGG + Intergenic
1123825573 15:24078639-24078661 GCAGCTGCAGAGGGTGCGCCAGG - Intergenic
1124061583 15:26298275-26298297 GCAGCTGCAGAGGGTGCGCCGGG - Intergenic
1124109479 15:26773032-26773054 GCGGCGGCGGCGGCAGCAGCAGG - Exonic
1124247754 15:28085277-28085299 CAAGAGGCAGAGGCAGCAGCTGG - Intronic
1124820987 15:33045208-33045230 GCAGCGGGATGGGCAGCTCCAGG - Intronic
1124971184 15:34490700-34490722 GCTGGAGCAGAGGCAGCAGCGGG - Intergenic
1125200758 15:37099091-37099113 GCAGCGGCAGCAGGAGAACCGGG + Intronic
1125506326 15:40269815-40269837 GCAGCAGCAGCAGCAGCACAGGG + Intronic
1125685117 15:41559293-41559315 GCGGCGGCAGCGGCAGCGGCGGG - Exonic
1125709634 15:41774507-41774529 GCAGCGGTAGAGGCAGCAGCAGG - Exonic
1125723585 15:41856852-41856874 GCACCTGCAGGAGCAGCACCAGG - Exonic
1125933957 15:43618680-43618702 GCAGCAGCAGCAGCAGCAGCAGG + Exonic
1125947054 15:43718142-43718164 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
1126110834 15:45173834-45173856 GCAGAGGCAGAGGCAGAGGCAGG + Intronic
1126165528 15:45651220-45651242 GCAGCTGCGGAGGGTGCACCAGG - Intronic
1126348079 15:47717507-47717529 GCAGCAGCAGCAGCAGCAGCGGG - Intronic
1126450781 15:48806333-48806355 GCTGCGGCAGAAGCAGCAGCAGG + Intronic
1127211581 15:56779765-56779787 GCAGCTGCAGAGGGTGCACTGGG + Intronic
1127606505 15:60592462-60592484 GCGGCGGCAGAGGGGGCTCCGGG - Intronic
1127621333 15:60737449-60737471 CCAGCGGCATGGGCAGTACCTGG + Intronic
1127789922 15:62390577-62390599 GCAGCGGCTGAGGCGGCTGCGGG + Intronic
1127868737 15:63052680-63052702 GTACCGGCAGAGGCAACAGCAGG + Intronic
1127975117 15:63991293-63991315 GCAGCAGCAAAGTCAGCAGCAGG + Intronic
1128119229 15:65133517-65133539 GCAGCGGCGGTGGTGGCACCGGG + Exonic
1128302855 15:66577973-66577995 GCAGCGGCAGGGAAAGCATCAGG - Intergenic
1128455037 15:67827392-67827414 GCGGCGGCAGCGGCAGCTGCTGG + Intronic
1128762330 15:70225868-70225890 ACAGCGTAAGAGGCAGAACCAGG + Intergenic
1128965412 15:72052752-72052774 GCAGCGGGGCAGGCAGCTCCGGG - Intronic
1128972243 15:72117957-72117979 GCACCGGCAGAGGCGGCCGCTGG - Exonic
1129107257 15:73318860-73318882 GGAGCGGCAGAGGCAGGGCGCGG - Intergenic
1129116451 15:73367929-73367951 GCGGCGGCAGCGGCGGCACGGGG - Exonic
1129509256 15:76108537-76108559 GCAGCAGCACTGGCATCACCTGG - Intronic
1129514973 15:76151836-76151858 GCAGCAGCAGCAGCATCACCTGG - Intronic
1129682153 15:77663969-77663991 GCAGAGGCTGGGGCAGGACCCGG + Intronic
1129746498 15:78025343-78025365 GCAGTGGCAGCGTCAGCATCAGG - Exonic
1130139959 15:81216654-81216676 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
1130305462 15:82709846-82709868 GCAGCGGCGGAGGCTGCGCGCGG + Intronic
1130903751 15:88225915-88225937 TCAGGGCCAGAGGCAGCAGCAGG - Intronic
1131259293 15:90880270-90880292 GCAGGGACAGAGCAAGCACCTGG - Exonic
1131431745 15:92393893-92393915 GCAGCGGCAGCGGCAGCGACAGG - Exonic
1131466053 15:92655614-92655636 GCAGCAGCAGCGGCAGGAGCGGG + Exonic
1131694136 15:94856636-94856658 GCGGCGGCGGAGGCAGCGGCAGG + Intergenic
1132111425 15:99104957-99104979 GCGGCCGCAGAGGCCGCGCCGGG + Intronic
1132414373 15:101610126-101610148 GCAGCTGCAGGGGCATCAGCAGG + Intergenic
1132547837 16:541351-541373 GACGCGGCAGAGGCAGGGCCGGG + Intronic
1132703003 16:1229933-1229955 GCAGCAGCAGATTCAGCATCTGG + Exonic
1132705320 16:1240935-1240957 GCAGCAGCAGATTCAGCATCTGG - Exonic
1132735488 16:1383935-1383957 GCAGCAGCAGAGGCCAGACCCGG + Intronic
1132882737 16:2169666-2169688 ACAGCAGCAGAGGGAGCCCCAGG - Intronic
1133124874 16:3640290-3640312 GCAGCTGCAGAGGCAGAGCCAGG - Intronic
1133583858 16:7172654-7172676 GTAGCAACAGAGGCAGCACAAGG + Intronic
1133969357 16:10556433-10556455 GCAGTTGCTGAGGCTGCACCTGG - Intronic
1134517676 16:14900225-14900247 GCAGGGGCAGAGGCAGATGCCGG + Intronic
1134678235 16:16105353-16105375 GGAGTGGCAGAGGGAGCAACTGG - Intronic
1134705344 16:16298876-16298898 GCAGGGGCAGAGGCAGATGCCGG + Intergenic
1134962197 16:18413238-18413260 GCAGGGGCAGAGGCAGATGCCGG - Intergenic
1134966494 16:18495837-18495859 GCAGGGGCAGAGGCAGATGCCGG - Intronic
1135757024 16:25107002-25107024 GCAGCGGCGGCGGCAGCCCGCGG + Intergenic
1135821882 16:25692371-25692393 GCGGCGGCGGCGGCAGCCCCCGG - Exonic
1136147359 16:28323170-28323192 GCAGAGGAGGTGGCAGCACCAGG - Exonic
1136264570 16:29107385-29107407 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
1136356647 16:29748505-29748527 GCAGCTGCAGAGGGTGCGCCAGG + Intergenic
1136511006 16:30738332-30738354 GCGGCGGCGGCGGCAGCAGCGGG + Exonic
1136568067 16:31081655-31081677 GCAGCACCAGCAGCAGCACCAGG + Exonic
1136718683 16:32303294-32303316 GCAGCAGCAGGGGCAGGGCCTGG + Intergenic
1136722858 16:32338688-32338710 GCCGGGGCAGCGGCAGGACCAGG - Intergenic
1136723711 16:32341658-32341680 GCAGCAGCAGGGGCAGGGCCTGG + Intergenic
1136737084 16:32475179-32475201 GCAGCGGCTGGAGCAGCAGCTGG - Intergenic
1136773230 16:32858665-32858687 GCAGCAGCAGGGGCAGGGCCTGG - Intergenic
1136837054 16:33509558-33509580 GCAGCAGCAGGGGCAGGGCCTGG + Intergenic
1136841179 16:33544687-33544709 GCTGGGGCAGCGGCAGGACCAGG - Intergenic
1136842042 16:33547702-33547724 GCAGCAGCAGGGGCAGGGCCTGG + Intergenic
1136863139 16:33714320-33714342 GCCGGGGCAGCGGCAGGACCAGG + Intergenic
1136897385 16:34002854-34002876 GCAGCAGCAGGGGCAGGGCCTGG + Intergenic
1137402628 16:48165589-48165611 GCAGAGGAAAAGGCAGCCCCCGG - Intergenic
1137619397 16:49866664-49866686 GCGGAGGCAGCGGCAGCCCCGGG - Intergenic
1138028759 16:53542448-53542470 GCAGCTGCTGACACAGCACCGGG + Intergenic
1138166655 16:54808119-54808141 GCAGCAGCAGCAGCAGCATCTGG - Intergenic
1138196262 16:55054436-55054458 GCAGGGGCTGAGGCAGGACGTGG + Intergenic
1138248759 16:55486300-55486322 GCATTAGCAGAGGCAGCATCAGG - Intronic
1138360770 16:56425509-56425531 GCGCCGGCAGGGGCAGCAGCGGG - Exonic
1138619196 16:58198038-58198060 GCACCGGCAGCGGCAGCCACCGG + Intergenic
1139051488 16:63129782-63129804 GCAGCTGCGGAGGGTGCACCGGG + Intergenic
1139165285 16:64558431-64558453 GCAGAGGCAGAAGGATCACCTGG + Intergenic
1139346547 16:66307528-66307550 GCAGGGGCAGAGGCAGAGGCAGG - Intergenic
1139347964 16:66316643-66316665 GCAGCAGCAGCAGCAGCAGCAGG - Intergenic
1139468056 16:67164634-67164656 ACAGCGGCCGAGGCACCAGCAGG - Exonic
1139574035 16:67830198-67830220 ACAAAGCCAGAGGCAGCACCAGG + Intronic
1140080220 16:71739314-71739336 GCAGGGGCAGGAGCAGCAGCTGG + Exonic
1140488918 16:75317787-75317809 GCTGAGGCAGAGTCAGCATCTGG + Intronic
1140771705 16:78211555-78211577 GCAGCAGCAGCAGCAGCAGCAGG - Intronic
1141038917 16:80654990-80655012 GCAGCGGCCCAGGCAGATCCAGG + Intronic
1141062998 16:80892243-80892265 GCAGCAGCAGCAGCCGCACCTGG + Intergenic
1141461321 16:84180173-84180195 GCAGCTGCAGCTGCTGCACCTGG - Exonic
1141506430 16:84481429-84481451 CCAGCCTCACAGGCAGCACCCGG - Intronic
1141633062 16:85299341-85299363 GCAGAGCCAGGGGCAGGACCTGG + Intergenic
1141774886 16:86116624-86116646 GGAGAGGCAGAGCCAGCAGCTGG + Intergenic
1141835777 16:86538325-86538347 GCGGCGGCAGTGGCAGACCCGGG + Intronic
1141990083 16:87604287-87604309 GCAGCAGCAGCAGCAGCAGCAGG - Intronic
1142113332 16:88343627-88343649 GCAGCATCTGAGGCAGCACAGGG + Intergenic
1142270309 16:89085568-89085590 GGAGGGGCAGGGGCAGCGCCCGG - Intergenic
1142441653 16:90102317-90102339 GCAGCAGCAGCAGCAGCAACTGG + Intergenic
1203002720 16_KI270728v1_random:176107-176129 GCAGCAGCAGGGGCAGGGCCTGG - Intergenic
1203003573 16_KI270728v1_random:179076-179098 GCCGGGGCAGCGGCAGGACCAGG + Intergenic
1203007748 16_KI270728v1_random:214477-214499 GCAGCAGCAGGGGCAGGGCCTGG - Intergenic
1203015987 16_KI270728v1_random:354398-354420 GCAGCGGCTGGAGCAGCAGCTGG + Intergenic
1203034322 16_KI270728v1_random:627556-627578 GCAGCGGCTGGAGCAGCAGCTGG + Intergenic
1203075652 16_KI270728v1_random:1120775-1120797 GCAGCAGCAGGGGCAGGGCCTGG - Intergenic
1203123767 16_KI270728v1_random:1559432-1559454 GCAGCAGCAGGGGCAGGGCCTGG - Intergenic
1203124627 16_KI270728v1_random:1562473-1562495 GCCGGGGCAGCGGCAGGACCAGG + Intergenic
1203134326 16_KI270728v1_random:1712513-1712535 GCAGCAGCAGGGGCAGGGCCTGG - Intergenic
1203135181 16_KI270728v1_random:1715483-1715505 GCCGGGGCAGCGGCAGGACCAGG + Intergenic
1203147231 16_KI270728v1_random:1809837-1809859 GCAGCAGCAGGGGCAGGGCCTGG + Intergenic
1203151344 16_KI270728v1_random:1844984-1845006 GCTGGGGCAGCGGCAGGACCAGG - Intergenic
1203152207 16_KI270728v1_random:1847999-1848021 GCAGCAGCAGGGGCAGGGCCTGG + Intergenic
1142788311 17:2243037-2243059 GCAGTGGCAGTGGCAGGACGGGG + Intronic
1143119850 17:4599835-4599857 GCAGCGGCGGAGGCTGGTCCAGG + Intronic
1143410038 17:6703195-6703217 TCAGCAGCAGAGTCAGGACCTGG - Intronic
1143548596 17:7614838-7614860 GGAGCGGCAGCGGCAGCAGCGGG - Exonic
1143982744 17:10883928-10883950 GCAGCAACAGAGGCAACAACAGG - Intergenic
1143994585 17:10995712-10995734 GCAGCAGCAGCAGCAGCAGCAGG - Intergenic
1144671516 17:17135230-17135252 GCAGATGCAGAGGCAGTCCCTGG - Intronic
1145014308 17:19386811-19386833 GCAGCAGCAGCGGCAGGGCCAGG + Exonic
1145190924 17:20841878-20841900 CCATCGGCCGAGGCAGCACTTGG + Intronic
1145267366 17:21386314-21386336 GGAGAGGGAGAGGCAGCACAGGG - Intronic
1145992413 17:29087004-29087026 GCGGCTACAGAGGCAGCTCCGGG - Exonic
1145993924 17:29094986-29095008 GCAGCGGGAGAAGCTGCAGCGGG - Exonic
1146284963 17:31568242-31568264 CCAGTGGCAGCGGCAGCCCCTGG + Intergenic
1147400412 17:40177541-40177563 GCGGCGGCAGAGGCAGCGGGCGG - Intronic
1147511412 17:41072112-41072134 GCAGCAGCTGGGGCAGCACAGGG - Intergenic
1147515978 17:41117989-41118011 GCAGCTGGAGATGCAGCATCTGG + Exonic
1147515994 17:41118094-41118116 GCAGCTGGAGATGCAGCATCTGG + Exonic
1147517952 17:41140041-41140063 GCAGCTGGAGATGCAGCAGCTGG + Exonic
1147518887 17:41149378-41149400 GCAGCTGGAGATGCAGCAGCTGG + Exonic
1147632344 17:41940217-41940239 GCAGAGGCAGGGGAAGCAGCAGG - Intronic
1147671876 17:42181064-42181086 GCAGCGGCAGCGGCAGTAAGAGG - Exonic
1147805350 17:43126968-43126990 GCAGCTGCAGAGGGTGCGCCGGG + Intergenic
1147943506 17:44066610-44066632 GCGGCGGCGGCGGCAGCAGCGGG + Exonic
1148021694 17:44557715-44557737 GCAGCAGCAGCGGCAGCAGCAGG - Exonic
1148032108 17:44628540-44628562 GCAGCGGCAGGGGCAGGGTCAGG + Intergenic
1149644517 17:58230262-58230284 TCAGCAGCAGTGGCACCACCTGG - Intronic
1150029951 17:61722273-61722295 GCCGAGGCAGAGGGATCACCAGG - Intronic
1150063408 17:62088422-62088444 GCAGCAGCAGCAGCAGCAGCTGG + Intergenic
1150441583 17:65195880-65195902 CCAGCGGCATCCGCAGCACCAGG + Intronic
1151513915 17:74580052-74580074 TCAGGAGCAGAGGCAGCTCCAGG + Exonic
1151667344 17:75552958-75552980 CCAGCAGCAGAGGCAGCTCAGGG - Intronic
1151683215 17:75632718-75632740 GCAGCTGCAGAGGCCGCAAGAGG + Intronic
1151778644 17:76226936-76226958 GCAGCGGCGGCAGCAGCACCAGG - Intronic
1151802052 17:76384533-76384555 GCAGAGGCCGAGGCCGCGCCGGG + Intronic
1151840644 17:76615125-76615147 GCAGGGGAGGAGGCAGCACCAGG - Intergenic
1151854307 17:76710547-76710569 GCAGCGGCAGCCGGAGCCCCGGG + Intronic
1151906178 17:77050824-77050846 GCAGCTGTGGAGGCAGAACCAGG + Intergenic
1152000068 17:77639762-77639784 GCAGCAGCAGCAGCAGCAGCTGG - Intergenic
1152184112 17:78843429-78843451 GCACAGGCAGAGGCAGCTGCTGG + Intergenic
1152315723 17:79579284-79579306 CCGGCAGCAGAGCCAGCACCCGG - Intergenic
1152395557 17:80030757-80030779 GCAGGGGCAGAGGCAGAGGCAGG + Intronic
1152746489 17:82042455-82042477 GCAGGGCCAGAGGGAGCACAGGG + Intergenic
1152939487 17:83160715-83160737 CCAGCAGCAGAGCCAGCAGCAGG - Intergenic
1153665049 18:7360789-7360811 GCAGCTGCAGAGGGTGCGCCGGG + Intergenic
1153868712 18:9297084-9297106 GCAGATGCAGAGGGTGCACCGGG + Intergenic
1154294111 18:13134895-13134917 GCAGCTGCAGAGGGTGCACCGGG - Intergenic
1154307543 18:13241561-13241583 GCAGGGGCAGAGAGAGCAGCAGG + Intronic
1154511307 18:15105439-15105461 GCAGGGGAAGAGAGAGCACCAGG + Intergenic
1155208184 18:23578536-23578558 GCAGCTGCAGAGGCAGGCCTGGG - Intronic
1155961861 18:32001936-32001958 GCAGAGGCTGAGGAAGAACCGGG - Intergenic
1156160293 18:34350942-34350964 GGAGGGGCAGAGGCAGCAGGGGG - Intergenic
1157840262 18:50950814-50950836 CCAGCAGCATAGGCATCACCTGG - Exonic
1158553882 18:58459521-58459543 GCAGCTGCGGAGGGTGCACCAGG + Intergenic
1158597332 18:58827905-58827927 GCAGCTGCAGAGGGTGCGCCGGG - Intergenic
1158888965 18:61855616-61855638 GCAGCGGGGCAGGCAGCTCCAGG - Intronic
1159874951 18:73800622-73800644 GCAGCAGCAGAGGCAGCAGCTGG + Intergenic
1160143736 18:76347928-76347950 GCAGCAGCTGAGGGGGCACCTGG - Intergenic
1160156863 18:76441322-76441344 GCAGCGGCACAGGCGGAGCCAGG + Exonic
1160229368 18:77034766-77034788 GGAGAGGCAGGGGCTGCACCAGG - Intronic
1160500525 18:79399518-79399540 GCGGCGGGAGAGGCAGGCCCAGG + Intronic
1160535270 18:79588348-79588370 GCAGCACCCGCGGCAGCACCCGG + Intergenic
1160540426 18:79617536-79617558 GGAGAGGCAGATGCAGCAGCGGG - Intergenic
1160551468 18:79696327-79696349 ACAGCTGCGGCGGCAGCACCTGG - Intronic
1160962349 19:1728576-1728598 GCAGCGGCAGAGGAAGGAGATGG - Intergenic
1160995279 19:1879545-1879567 CCATCGGCCGAGGCAGCACTTGG - Intronic
1161009975 19:1955298-1955320 GCAGCAGCAGCAGCAGCAGCAGG - Intronic
1161435099 19:4258379-4258401 GGAGCGGCGGAGGCAGCAGCAGG + Exonic
1161457765 19:4378086-4378108 GGGGTGGCAGAGGCAGCACAGGG + Intronic
1161950914 19:7467420-7467442 CGAGCGCCAGTGGCAGCACCAGG + Exonic
1161961876 19:7527768-7527790 CCAGCTGCAGAGTCAGCACGTGG + Intronic
1161973310 19:7595899-7595921 GCAGCGGCGGTAGCAGCAGCGGG + Exonic
1162062288 19:8103511-8103533 GCAGTCACAGAAGCAGCACCTGG - Intronic
1162063270 19:8109674-8109696 GCAGCTGCAGAGGTAGCTGCCGG + Exonic
1162481106 19:10927683-10927705 GCAGCAGCAGCAGCAGCAGCCGG - Exonic
1162531988 19:11241495-11241517 GCAGCGGCAGAGGCGGGAGATGG + Exonic
1162818034 19:13207858-13207880 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1162964962 19:14151259-14151281 GCAGCAGCAGAGGCTCCTCCAGG + Exonic
1163124757 19:15238889-15238911 GCAGCAGCAGCAGCAGCGCCAGG - Exonic
1163313150 19:16525911-16525933 CCAGCGGCAGAAACAGCCCCGGG - Intronic
1163333560 19:16657220-16657242 GAAGCAGCAGGTGCAGCACCTGG + Intronic
1163428946 19:17255406-17255428 GCAGCGGAGGTGGCAGCAGCGGG - Exonic
1163644709 19:18482427-18482449 GCAGAGGCAGAGGCAGAGGCAGG - Intronic
1163721218 19:18899090-18899112 GGGGCGGCAGGAGCAGCACCTGG + Intergenic
1165073938 19:33270430-33270452 CCAGGGGCAGGGGCAGGACCAGG + Intergenic
1165074549 19:33273627-33273649 GCAGCGGGGGCGGCAGCACAGGG - Intergenic
1165144532 19:33722828-33722850 GCAGCTGCAGAGGCTGAGCCAGG - Intronic
1165285425 19:34838047-34838069 ATAGCGGCAGTGGCAGCAGCAGG + Intergenic
1165293304 19:34906185-34906207 GCAGCGGCAGTGGCAGCAGCGGG - Intergenic
1165758654 19:38308357-38308379 GCAGCGGGAGGGGCAGTGCCAGG + Intronic
1165823574 19:38692826-38692848 GCAGCGTCAGAGGCCACAGCAGG + Intronic
1165850915 19:38849900-38849922 GCTGGAGCAGAGGCAGCAGCCGG - Exonic
1166047050 19:40235833-40235855 GCAGGGACAGTGGCAGCAGCTGG + Intronic
1166743451 19:45128462-45128484 GTAGAGGCAGCGGCAGCAGCAGG + Intronic
1167001112 19:46746266-46746288 GCGGCGGCGGAGGCAGCCCCGGG - Exonic
1167121531 19:47520247-47520269 GCAGGGGCAGGGGCAGAACGAGG - Intergenic
1167158957 19:47755452-47755474 GCGGCGGCAGAGGCGGCGGCAGG + Exonic
1167234244 19:48304034-48304056 GCAGCGGCAGATCTTGCACCTGG - Exonic
1167443682 19:49525049-49525071 GCAGCAGCAGCAGCAGCAGCAGG - Intronic
1167584423 19:50365573-50365595 GCAGAGGCAGCAGCAGCAGCAGG + Exonic
1167633482 19:50639789-50639811 GCGGCGGCAGCGGCGGCTCCGGG - Intronic
1167741059 19:51325317-51325339 GCAGCGGCAGAGGCTGAATATGG - Intronic
1167817916 19:51900342-51900364 ACAGCAGCAGAGACAGCATCTGG - Intronic
1167821899 19:51935965-51935987 ACAGCAGCAGTGACAGCACCTGG + Intronic
1168268945 19:55239355-55239377 GCTGCTGCAGAGGCAGGACAGGG + Intronic
1168344188 19:55642505-55642527 GCGGCGGCAGCAGCAGCATCTGG - Exonic
1168353534 19:55689230-55689252 GCAGAGTCAGAGGCAGAGCCAGG - Intronic
1168462047 19:56567542-56567564 GCAGCGGCCGAGGCTGGACTGGG + Exonic
1168643059 19:58042669-58042691 GCAGCGGCTGAGGAAGCCCGTGG - Intronic
1202692294 1_KI270712v1_random:100851-100873 GCAGCAGCAGGGGCAGGGCCTGG + Intergenic
1202710874 1_KI270714v1_random:18833-18855 GCAGCTGCTGAGGCAGCGGCAGG - Intergenic
924977476 2:191570-191592 GCAGCTGCAGAGGGTGCACTGGG - Intergenic
925172596 2:1759509-1759531 GCAGCTGCGGAGGGAGCGCCAGG - Intergenic
925361104 2:3280905-3280927 GCAGCTGCACAGGCGGCTCCTGG - Intronic
925405651 2:3604106-3604128 GCAGCCCCAGGGTCAGCACCAGG - Intronic
925764956 2:7223910-7223932 GCAGCAGCAGAGGCACCATCTGG + Intergenic
926305901 2:11637076-11637098 GCAGGGGCAGAGGCAGGGGCAGG + Intronic
927217734 2:20677967-20677989 GCAGCAGCAGCAGCAGCAGCTGG + Intergenic
927278372 2:21280999-21281021 GCAGAGCCAGAGGTAGGACCTGG - Intergenic
927678358 2:25123498-25123520 GCAGCTGCAGAGTCCACACCTGG - Intronic
928123803 2:28602596-28602618 GCAGCGGCAATGGCACCTCCTGG - Intronic
928510557 2:31999226-31999248 GCAGTGGCAAGGGCAGAACCAGG - Intronic
928617939 2:33057640-33057662 GCAGCTGCAGAGGGTGCGCCAGG - Intronic
929805913 2:45145007-45145029 GCAGGGGCAGAGGAAGCAGCTGG + Intergenic
929958816 2:46480662-46480684 CCAGCGGCAGCGGCAGCACGAGG + Exonic
929958822 2:46480701-46480723 GCAGCGGGAGCGGCAGCACGAGG + Exonic
930011486 2:46941242-46941264 GCGGCGGCGGCGGCAGCGCCAGG + Exonic
930332197 2:49999114-49999136 CCAGCAGCAAAGGCATCACCTGG - Intronic
930420883 2:51151831-51151853 GCAGCTGCAGAGGGTGCGCCGGG - Intergenic
930441285 2:51410095-51410117 GAAGCAGCTGAGGCTGCACCAGG - Intergenic
930706475 2:54509482-54509504 GCAGCGGCAGCTGCTGCACGGGG + Intronic
931868801 2:66438407-66438429 GCAGTGGCAGAGCCAGCATAAGG - Intronic
931881393 2:66574867-66574889 GCAGCCGCAGCAGCAGCAGCAGG + Intergenic
931909894 2:66887819-66887841 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
932593709 2:73081499-73081521 GCGGCAGCAGTGGCAGCAGCGGG + Intronic
932662968 2:73672948-73672970 GAACTGGCAGGGGCAGCACCTGG + Intergenic
933049920 2:77590621-77590643 GCAGCTGCGGAGGGTGCACCGGG + Intronic
933139813 2:78779142-78779164 GCAGCTGCAGAGGGTGCGCCGGG + Intergenic
933415819 2:81985306-81985328 GCAGCTGCAGAGGGTGCACTGGG + Intergenic
933700139 2:85249238-85249260 GTAGCGGCAGTGGCAGCAGCTGG - Intronic
933729623 2:85446915-85446937 GGAGCTGAAGTGGCAGCACCAGG + Intergenic
933954104 2:87353121-87353143 GCAGCAGCAGGGGCAGGGCCTGG - Intergenic
934274890 2:91567369-91567391 GCAGCAGCAGGGGCAGGGCCTGG + Intergenic
934308382 2:91843657-91843679 GCAGCGGCTGGAGCAGCAGCTGG + Intergenic
934322418 2:91981878-91981900 GCAGCAGCAGGGGCAGGGCCTGG - Intergenic
934460724 2:94212701-94212723 GCAGCAGCAGGGGCAGGGCCTGG - Intergenic
934761880 2:96861078-96861100 GCACCAGCAGCAGCAGCACCAGG + Exonic
935144746 2:100387958-100387980 GCAGAGGCAGGGGGAGCAGCAGG + Intergenic
935207101 2:100905679-100905701 GCAGTGGCAGAGGCAGAAAGGGG - Intronic
935290846 2:101609764-101609786 GAAGCCGCAGAAGCAGCCCCAGG - Intergenic
935825265 2:106941552-106941574 GCAGCGGCAGAGCCTGCTCAGGG + Intergenic
936493150 2:112993102-112993124 GCAGAGGCTGAGGTAGCACTGGG + Intergenic
936734643 2:115426575-115426597 CCAGCGTCAGAGGTGGCACCTGG - Intronic
936781625 2:116039828-116039850 GCAGCAGCAGCAGCAGCATCTGG - Intergenic
937011140 2:118563759-118563781 GCACCAGCAGCAGCAGCACCTGG - Intergenic
937155897 2:119718652-119718674 ACAGGGGCTCAGGCAGCACCTGG - Intergenic
937160817 2:119759719-119759741 GGAGCGGCGGCGGCAGCAACAGG - Exonic
937234666 2:120423443-120423465 GGAGCAGCACAGCCAGCACCAGG - Intergenic
937789431 2:125943137-125943159 GCAGCTGCAGAGGGTGCACCAGG - Intergenic
937863570 2:126731791-126731813 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
938201355 2:129375332-129375354 GCAGCTGCAGAAGCAGCACCAGG + Intergenic
938305472 2:130251644-130251666 GCAGCTGCTGGGGCAGGACCTGG - Intergenic
938458829 2:131484584-131484606 TCAGCGGCAGCAGCAGCAGCAGG + Intronic
938693687 2:133815743-133815765 CCAGCAGCAGTGGCAGCAGCAGG - Intergenic
939191055 2:138917247-138917269 GGAGCGGGGGATGCAGCACCCGG + Intergenic
939888823 2:147711309-147711331 GCAGCAGCAGAAGCAGCATCAGG - Intergenic
940157814 2:150677840-150677862 GGAGAGGCAGAGGCAGAACTGGG - Intergenic
940361931 2:152805033-152805055 GCAGCTGCAGAGGGTGCACTGGG - Intergenic
940639948 2:156334436-156334458 GCAGCGGCAGCCGCAACATCTGG - Intronic
941625519 2:167826470-167826492 TCAGGGGCATAGGGAGCACCAGG - Intergenic
942053362 2:172161673-172161695 GCAGTGGGACAGGCAGCTCCAGG + Intergenic
942156205 2:173131110-173131132 GCAGCAACAGAGGCAGCCCAAGG + Intronic
942463993 2:176189078-176189100 GCCGCGGCAGGTGCGGCACCAGG - Exonic
942564236 2:177250781-177250803 GTAGCAGCAGAGGCCCCACCTGG - Intronic
943018221 2:182540395-182540417 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
943890274 2:193277309-193277331 GAAGCGGGAGCGGCAGCACCAGG - Intergenic
943954921 2:194176461-194176483 GCAGCTGCGGAGGGTGCACCGGG + Intergenic
944048182 2:195437706-195437728 GCAGCGGCAGCGGCAACCCGCGG - Intergenic
944263944 2:197704369-197704391 GCAGCAGAACTGGCAGCACCTGG - Intronic
945023791 2:205600640-205600662 GCAGTGGGAGGGGCAGCATCAGG - Intronic
946019840 2:216633544-216633566 GCGGCGGCAGCGGCAGCGCGGGG - Exonic
946121831 2:217523074-217523096 GCAACAGCAGAAGCATCACCTGG + Intronic
946134525 2:217634879-217634901 GCTGGGGCAGAGGGAGCACCAGG + Intronic
946159338 2:217826592-217826614 GGAGCAGCGGAGGCAGCAGCAGG - Intronic
946203950 2:218089907-218089929 CCAGCTGCAGAGGCCGCCCCAGG + Exonic
946329347 2:219000872-219000894 GCTCAGGCAGAGGCAGCCCCGGG - Intergenic
946410844 2:219514511-219514533 GCAGCGGCAGAGGCAGCACCAGG + Exonic
946856686 2:223957307-223957329 GCAGGGGCGGAGACAGCCCCGGG - Intergenic
947140450 2:227015342-227015364 GCAGCAGCAGCGGCAGCACCTGG + Intronic
947171914 2:227320775-227320797 GCAGCTGCAGAGGGTGCGCCGGG + Intergenic
947197952 2:227587369-227587391 GCGGCAGCAGGGGCAGCAGCTGG + Intergenic
947200301 2:227608947-227608969 GCGGCAGCAGGGGCAGCAGCTGG - Intergenic
947200998 2:227614670-227614692 GCGGCAGCAGGGGCAGCAGCTGG + Intronic
947201394 2:227617661-227617683 GCGGCAGCAGGGGCAGCAGCTGG - Intronic
947205600 2:227658289-227658311 GCAGCAGCAGCAGCAACACCTGG - Intergenic
947206608 2:227666907-227666929 GCGGCAGCAGGGGCAGCAGCTGG - Intergenic
947212940 2:227724596-227724618 GCGGCAGCAGGGGCAGCAGCTGG + Intergenic
947213444 2:227728471-227728493 GCGGCAGCAGGGGCAGCAGCTGG - Intergenic
947590839 2:231384245-231384267 GCAGGGGCAGGGGCAGGGCCAGG - Intergenic
947938019 2:234024496-234024518 GCAGCTGCAGAGGGTGCACTGGG - Intergenic
947955844 2:234190043-234190065 GCAGCGGAAGGGGCAGTCCCTGG - Intergenic
947989193 2:234473559-234473581 GCAACTGCAGAGGTAACACCTGG + Intergenic
948119545 2:235518914-235518936 TCAGTGGCAGGGGCAGCAACAGG + Intronic
948174702 2:235934111-235934133 GCAGCAGCAGCAGCAGCCCCTGG + Intronic
948257351 2:236577890-236577912 GCAGCAGCAGGGACAGCAGCTGG - Intronic
948284715 2:236774579-236774601 GCAGAGGCTGTGGCTGCACCTGG - Intergenic
948456404 2:238106510-238106532 GGAGCTGGAGAGGCAGCCCCGGG - Intronic
948574702 2:238942224-238942246 GCAGCCCCGGAGGCAGCTCCCGG + Intergenic
948612131 2:239176458-239176480 GGAGCTGGAGAAGCAGCACCGGG - Exonic
948747268 2:240105863-240105885 GGAGGGGCAGAGGTGGCACCTGG - Intergenic
948754705 2:240152074-240152096 GCATCGGCTGAGACAGCACTGGG + Intergenic
948757433 2:240167649-240167671 GCTGCTGCAGAGGCCGCCCCAGG - Intergenic
948765188 2:240215830-240215852 GCTGGGGCAGGGGCAGCCCCGGG + Intergenic
948816496 2:240512939-240512961 TCAGCTGCAGAGGAAACACCGGG + Exonic
1169000218 20:2163039-2163061 GCGGCACCAGAGGGAGCACCTGG - Intronic
1170330201 20:15201050-15201072 TCAGCAGCAGCAGCAGCACCTGG - Intronic
1170408250 20:16062271-16062293 GCAGCAGAAGTGGCAGCACCTGG - Intergenic
1170629611 20:18056375-18056397 GCAGTTCCAGAGGCAGCACTCGG + Intronic
1170629727 20:18056789-18056811 GCAGCGGCAGCAGCAGCGCGGGG - Exonic
1170799617 20:19580179-19580201 GCAGCTGCAGCGGGAACACCAGG + Intronic
1170858890 20:20084401-20084423 GCAGCAGCAGCAGCAGCAGCAGG - Intronic
1170924746 20:20712595-20712617 GCGGCGGCGGCGGCAGCAGCGGG - Intergenic
1171034689 20:21705770-21705792 GCAGCGGCGGCGGCAGGCCCTGG + Exonic
1171135704 20:22692728-22692750 GCAGGGGTAGAGACAGCATCAGG - Intergenic
1171180254 20:23086153-23086175 GCAGCAGCAGCAGCAGCAGCAGG + Exonic
1171428719 20:25065211-25065233 GCAGAGGCACCGGCAGCAGCAGG + Intergenic
1171973424 20:31578775-31578797 GCAGCTGCAGAGGGTGCACCGGG - Intergenic
1172064277 20:32207983-32208005 GGAGCGGCAGAAGCAGCAGCAGG - Exonic
1172100848 20:32483441-32483463 GCAGCAGCAGCAGCAGCAGCTGG - Exonic
1172152622 20:32801114-32801136 GCAGGGACACAGGCAGCAGCAGG - Intronic
1172181899 20:33008598-33008620 GCAGCAGCAGTGCCAGCAGCAGG - Exonic
1172280546 20:33704732-33704754 GCAGCACCACTGGCAGCACCAGG + Exonic
1172894227 20:38288124-38288146 GCAGGGGCAAAGACAGCACTGGG + Intronic
1172970931 20:38872621-38872643 CCAGCAGCAGCAGCAGCACCTGG - Intronic
1173197967 20:40931590-40931612 GCAGCTGCACAGGCAGCAGATGG + Intergenic
1173397335 20:42691642-42691664 GCAGGGGCAGAGGCAGCCCTAGG - Intronic
1173800467 20:45891598-45891620 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1174363075 20:50040452-50040474 GCAGGGGCAGGGGCAGGGCCAGG + Intergenic
1174725944 20:52862239-52862261 ACAGAGGCAGCGGCAGCTCCTGG - Intergenic
1174734997 20:52957391-52957413 GCAGCAGCAGCAGCAGCACCTGG + Intergenic
1175056585 20:56204371-56204393 CCAGCTGCATGGGCAGCACCTGG + Intergenic
1175182285 20:57157132-57157154 ATGGCGGCAGAGGCAGCAGCAGG + Intergenic
1175246566 20:57585856-57585878 CCAGCGACAGCAGCAGCACCTGG + Intergenic
1176029884 20:63006806-63006828 GCAGCGGCAGCGGCAGCGGCGGG - Exonic
1176188215 20:63793131-63793153 GCCGCCGTTGAGGCAGCACCTGG - Intronic
1176301706 21:5101764-5101786 GCAGGGGCAGAGGCAGGACAGGG + Intergenic
1176379191 21:6103342-6103364 GCAGGGGCAGAGGCAGCAGCAGG + Intergenic
1176379197 21:6103360-6103382 GCAGGGGCAGGGGCAGCAGCAGG + Intergenic
1176379205 21:6103384-6103406 GCAGGGGCAGAGGCAGCGGCAGG + Intergenic
1176379211 21:6103396-6103418 GCAGCGGCAGGGGCAGGGGCAGG + Intergenic
1176379217 21:6103414-6103436 GCAGGGGCAGGGGCAGCAGCAGG + Intergenic
1176379229 21:6103450-6103472 GCACGGGCAGGGGCAGCAGCAGG + Intergenic
1176383093 21:6123115-6123137 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1176383943 21:6127722-6127744 CCAGCTGCACAGGCAGGACCCGG - Intergenic
1176717336 21:10364393-10364415 GCAGCCGCAGAGGCAGCCCTTGG + Intergenic
1176865849 21:14054814-14054836 GCAGGGCCAGAAGCAGCACAGGG + Intergenic
1177237570 21:18412723-18412745 GCAGCAGCAGCAGCAGCAGCAGG - Intronic
1177287986 21:19076397-19076419 GCAGCAGCACAAGCAGCATCTGG - Intergenic
1178054535 21:28783904-28783926 GCAGCTGCAGAGGGTGCGCCAGG + Intergenic
1178709133 21:34898844-34898866 CCAGCGGCAGTGGCAACACTGGG - Intronic
1179411829 21:41168278-41168300 GCAGAGGCAGCAGCAGCGCCCGG - Exonic
1179459589 21:41524929-41524951 GCAGCAGCAGAAGCAGTGCCTGG - Intronic
1179583447 21:42359867-42359889 GCATGGGAAGAGGCAGCACAAGG + Intergenic
1179618944 21:42599773-42599795 GCAGCAGCAGAAGCAGGAGCAGG - Intergenic
1179739531 21:43410516-43410538 CCAGCTGCACAGGCAGGACCCGG + Intergenic
1179740376 21:43415124-43415146 GCAGCAGCAGCAGCAGCAGCAGG + Exonic
1179744244 21:43434787-43434809 GCACGGGCAGGGGCAGCAGCAGG - Intergenic
1179744256 21:43434823-43434845 GCAGGGGCAGGGGCAGCAGCAGG - Intergenic
1179744262 21:43434841-43434863 GCAGCGGCAGGGGCAGGGGCAGG - Intergenic
1179744268 21:43434853-43434875 GCAGGGGCAGAGGCAGCGGCAGG - Intergenic
1179744276 21:43434877-43434899 GCAGGGGCAGGGGCAGCAGCAGG - Intergenic
1179744282 21:43434895-43434917 GCAGGGGCAGAGGCAGCAGCAGG - Intergenic
1179855325 21:44160135-44160157 GCAGGGGCAGAGGCAGGACAGGG - Intergenic
1179970571 21:44834993-44835015 GCAGCAGCACTGGCAGCACCTGG - Intergenic
1179982227 21:44901473-44901495 GCAGGGGCAGCGGCCTCACCGGG + Exonic
1180053902 21:45347246-45347268 GCAGCGGCACAGGGAGCTGCTGG + Intergenic
1181056926 22:20264731-20264753 ACAGCTGCAGAGGCAGCAGGCGG + Intronic
1181085211 22:20436652-20436674 GCAGCCGCAGAGGCGGCCGCCGG - Intronic
1181104613 22:20566541-20566563 GCAGCAGCAGCAGCAGCAGCAGG + Exonic
1181130173 22:20726603-20726625 GCAGAAGCAGAGGCAGGGCCTGG - Intronic
1181175492 22:21032530-21032552 GCAGCGGCTGCGGCAGCAGCAGG - Exonic
1181271398 22:21660928-21660950 GTAGCGGCAGAGGTGGCAGCAGG - Intronic
1181355520 22:22294053-22294075 GCAGCAGCAGGGGCAGGGCCTGG + Intergenic
1181855676 22:25779995-25780017 GAGGTGGCAGTGGCAGCACCTGG + Intronic
1181912636 22:26252061-26252083 GCACAGGCAGCAGCAGCACCTGG + Intronic
1182254887 22:29031045-29031067 GCAGGGGCAGCGGCAGGAGCGGG - Intronic
1182254889 22:29031051-29031073 GCAGGGGCAGGGGCAGCGGCAGG - Intronic
1182256934 22:29045965-29045987 CCAGCAGCAACGGCAGCACCTGG + Intronic
1182358960 22:29735497-29735519 GTAGTGGCAGTGGCAGCAGCAGG - Intronic
1182942352 22:34288927-34288949 GCAGGGACAGAGGCAGGAGCAGG - Intergenic
1183187636 22:36301018-36301040 GCAGCTGCAGGAGCAGCTCCAGG - Exonic
1183358933 22:37373465-37373487 GCAGCGGCGGGGGCAGCGGCGGG - Exonic
1183370204 22:37427744-37427766 GCAGCTGCAGCGGCGGCGCCAGG - Intergenic
1183554299 22:38513214-38513236 GCAGTGGCAGAGGCCTGACCAGG - Intergenic
1183713550 22:39520692-39520714 GCAGCGGCGGCAGCAGCACCAGG + Exonic
1183736018 22:39645396-39645418 GCAGCTGCAGAGGCAGGGGCGGG + Intronic
1183750780 22:39719222-39719244 GCAGCGGCCCAGGCAGCCCTAGG - Intergenic
1183784841 22:40023345-40023367 GCAGCAGCAGCAGCAGCAGCTGG - Intronic
1183831125 22:40418796-40418818 GCTCCGGCAGAAGCAGCAGCTGG - Exonic
1183989736 22:41589843-41589865 GCAACGGCAGAAGCAGCTCAGGG + Exonic
1184069353 22:42138430-42138452 GCAGCTGCAGAGGGGGCACCGGG + Intergenic
1184118169 22:42434028-42434050 GCAGGAGCGGAGGCGGCACCAGG - Intergenic
1184159430 22:42689103-42689125 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
1184414187 22:44342666-44342688 ACTGAGGCAGAGGCAGCTCCTGG - Intergenic
1184425740 22:44408275-44408297 GCACCCGCAGAGGCTGCACCCGG + Intergenic
1184489996 22:44802985-44803007 GCAGCAGCAGCAGCAGCAGCAGG - Intronic
1184797041 22:46738486-46738508 GGAGCGCCAGATTCAGCACCCGG - Intergenic
1184858812 22:47161688-47161710 TGAGTGGCAGAGGCAGCGCCTGG + Intronic
1184933729 22:47702256-47702278 GCAGCAGCAGCAGCAGCAGCGGG - Intergenic
1184972618 22:48037252-48037274 CCAGCGACAGCAGCAGCACCAGG + Intergenic
1185055450 22:48576387-48576409 GCGGCCGCGGAGGCTGCACCCGG + Intronic
1185056921 22:48586025-48586047 GCAGGGGCAGAGGCCGAAGCTGG - Intronic
1185143550 22:49117187-49117209 GCAGGGGCAGGGGCAGGGCCAGG + Intergenic
1185166893 22:49266910-49266932 GCTGGGGCAGAGTCCGCACCAGG - Intergenic
1185205462 22:49535657-49535679 GCAGAGGCTGAGGGAGCCCCAGG + Intronic
1185205502 22:49535765-49535787 GCAGGGGCCGAGGGAGCCCCCGG + Intronic
1185250449 22:49799047-49799069 GCAGCGGCTGCGGCACGACCTGG - Exonic
1185384611 22:50526103-50526125 CCAGCGCCAGCGGCAGCGCCCGG + Exonic
949202381 3:1394412-1394434 GCAGCGGCAGGCCCAGCGCCAGG + Intronic
949292755 3:2485056-2485078 GCAGCTGCAGAGGGTGCGCCGGG + Intronic
949808137 3:7977668-7977690 GCAGCATCAAAGGCATCACCTGG + Intergenic
949933841 3:9101416-9101438 CCAGCCACAGACGCAGCACCCGG + Intronic
950124944 3:10505267-10505289 GCAGCAGCCGAGGCTGCACTGGG - Intronic
950562497 3:13742814-13742836 GGTGAGGCAGGGGCAGCACCAGG + Intergenic
950674576 3:14546875-14546897 GCAGCCACAGTGGCAGCACCTGG + Intergenic
950710554 3:14810581-14810603 GCGGCGGCTGGGGCAGCGCCGGG - Intergenic
950729788 3:14947614-14947636 GCGGCGGCGGCGGCGGCACCGGG + Intronic
950864758 3:16180198-16180220 GCAGCAGCAGCAGCAGTACCAGG - Intronic
951529180 3:23682748-23682770 GCAGCAGCAACAGCAGCACCTGG - Intergenic
951551878 3:23882748-23882770 GCAGCTGCAGAGGGTGCGCCTGG - Intronic
951881398 3:27484179-27484201 GCAGGGGCAGCGGCAGAAGCAGG - Intronic
951995197 3:28719730-28719752 GCAGCAGCAGCAGCATCACCTGG - Intergenic
952011277 3:28903378-28903400 GCAGCTGCAGAGTGTGCACCGGG - Intergenic
952076316 3:29701719-29701741 GCAGCTGCGGAGGGTGCACCTGG + Intronic
952286087 3:31971052-31971074 GCTACTGCAGAGGAAGCACCTGG - Intronic
952533449 3:34286137-34286159 GCAGCAGCAGCAGCAGCAGCAGG - Intergenic
952995866 3:38881673-38881695 GCAGCAGCAGCAGCATCACCTGG - Intronic
953809334 3:46098164-46098186 GCAGCAGCTGCTGCAGCACCAGG - Intergenic
954089320 3:48272135-48272157 GCAGCTGCAGAGGGTGCACCGGG - Intronic
954365580 3:50144443-50144465 GCCGAGGCAGAGGCAGCAGGGGG - Intergenic
954394755 3:50287609-50287631 GTAGGGGGAGAGGCACCACCTGG + Exonic
954439823 3:50515796-50515818 GCAGGGACAGGGGCAGCAGCAGG - Intergenic
954687456 3:52378546-52378568 GAGGCGGCAGAGGGAGCTCCTGG + Intronic
956198929 3:66684807-66684829 GCAGTGACAGAGGCTGCAGCTGG - Intergenic
956438825 3:69260422-69260444 GCAGCTGCGGAGGGTGCACCGGG + Intronic
956620288 3:71214985-71215007 ACAGCCGCAAAGGCATCACCTGG + Intronic
957209429 3:77240299-77240321 GCAGCTGCAGAGGGAGCGCCGGG - Intronic
957792485 3:84959049-84959071 GCGGCGGCAGTGGCGGCTCCCGG - Intronic
957923166 3:86772822-86772844 ACAGCGGGACAGGCAGCTCCAGG - Intergenic
958731874 3:97968536-97968558 TCAGCAGCAGAAGCATCACCTGG - Intronic
958798730 3:98732875-98732897 GCCGCGAGAGAGGCAGCAGCCGG + Exonic
959179766 3:102963252-102963274 GCACTGGCAGGCGCAGCACCAGG + Intergenic
960271215 3:115676493-115676515 GCAGCAGCAGTGACAGCAGCAGG - Exonic
960848203 3:122023794-122023816 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
960949572 3:122990437-122990459 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
960998083 3:123352431-123352453 GCAGCGGGAGAACCAGCAGCAGG - Exonic
961041579 3:123682176-123682198 GCAGAGGCAGAGGCAGGGGCAGG - Intronic
961087307 3:124079172-124079194 GCAGCTGCAGAGGAAGCAGAGGG + Intergenic
961202483 3:125055830-125055852 GCAGCGGCAGCAACAGCAGCAGG + Exonic
961348085 3:126277860-126277882 CCAGGGGTTGAGGCAGCACCCGG + Intergenic
961442351 3:126960555-126960577 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
961484333 3:127206757-127206779 GCAGGGTCAGAGGCAGGGCCAGG + Intergenic
961539068 3:127588300-127588322 GCAGCAGCAGGGGCACCACCTGG - Intronic
961827668 3:129607179-129607201 GGAGAAGCAGAGGCAGAACCCGG - Intergenic
961856709 3:129878733-129878755 CCAGCAGCAGCAGCAGCACCTGG + Intronic
961936139 3:130585896-130585918 GCAGCAGCACTGGCATCACCTGG - Intronic
962177241 3:133167604-133167626 GCAGCTGCAGAGGGTGCACCAGG - Intronic
962205813 3:133432925-133432947 GCAGCGGCAGCCGCTGCACGCGG - Intronic
962269060 3:133964851-133964873 GCAGCGGAAGAGAAAGCCCCTGG - Intronic
962671693 3:137714735-137714757 GCAGCTGCGGAGGGTGCACCGGG - Intergenic
962711950 3:138094861-138094883 GGAGAGGCAGCGGCAGCTCCAGG - Exonic
962837189 3:139199812-139199834 GCAGTAGCAGAGGCAGCAGCAGG + Intronic
962847942 3:139287445-139287467 TCAGCAGCAGCAGCAGCACCTGG - Intronic
963357237 3:144224177-144224199 ACAGCGGCATAAGCATCACCTGG - Intergenic
963554669 3:146772493-146772515 GCAGCTGCAGAGGGTGCGCCGGG + Intergenic
963583340 3:147154234-147154256 GCAGCTGCAGAGGGGGCACTGGG + Intergenic
964227908 3:154428765-154428787 CCAGCGGCAGCGGGCGCACCCGG + Exonic
964376264 3:156051914-156051936 GCAGCTGCAGAGGGTGCGCCGGG + Intronic
964421547 3:156509371-156509393 GCAGCAGCAGCAGCAGCACCTGG - Intronic
964791058 3:160453357-160453379 GCAGCTGCAGCGGCAGGGCCAGG + Intronic
965092251 3:164179396-164179418 GCAGCTGCAGAGGGTGCGCCGGG + Intergenic
965369801 3:167847719-167847741 GCAGAGGCAGAGGCAGAGGCAGG + Intergenic
966183025 3:177204075-177204097 GCAGCTGCAGAGGGTGCGCCAGG - Intergenic
966448177 3:180027115-180027137 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
968132051 3:196197692-196197714 GCAGCAGCAGGGGCAGCACTGGG + Exonic
968137245 3:196228228-196228250 GCAGGGGCAGCAGCAGCAGCAGG - Exonic
968258346 3:197298577-197298599 TCCGCGGCAGAGACAGCGCCTGG + Intronic
968262119 3:197333967-197333989 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
968361909 3:198153284-198153306 GCAGCAGCAGCAGCAGCAACTGG + Intergenic
968462655 4:733057-733079 GCAGGGGCGGAGGCAGCACGCGG - Intronic
968462661 4:733079-733101 GCAGGGGCGGAGGCAGCACGGGG - Intronic
968498191 4:930563-930585 GGAGAGACAGAGGCAGCACAGGG - Intronic
968538294 4:1148909-1148931 GCAGGGGCAGGGGCAGGCCCAGG + Intergenic
968577670 4:1375543-1375565 GCAGAGGCTGTGGCAGCGCCGGG - Intronic
968712122 4:2126828-2126850 GCAGCTGAAGAGGGAGCACCAGG + Intronic
968843969 4:3029531-3029553 GCAGGGGCAGGGGCAGGGCCTGG - Intronic
968923021 4:3532352-3532374 GCAGCAGCAGTAGCAGCGCCGGG + Exonic
968952604 4:3702616-3702638 GCAGAGGCAGATGCAGGAGCGGG - Intergenic
969006134 4:4021332-4021354 GCAGCAGCAGCAGCAGCAGCTGG + Intergenic
969185012 4:5468410-5468432 GCAGTGGCAGAGCCAGGACTTGG - Intronic
969222200 4:5768323-5768345 GTAGGGGCAGAGGCAGAAGCAGG + Intronic
969703371 4:8779703-8779725 CCAGTGGCAGGGGCAGCATCTGG + Intergenic
969708783 4:8830940-8830962 TCAGCGGGAGAGGGAGAACCGGG - Intergenic
969806814 4:9615958-9615980 GCAGCAGCAGCAGCAGCAGCTGG - Intergenic
970333158 4:15004263-15004285 GCAGCTCCAGCAGCAGCACCAGG + Exonic
970574573 4:17414499-17414521 GCAGCTGCAGAGGGTGCGCCGGG - Intergenic
971756594 4:30716910-30716932 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
972270097 4:37502601-37502623 CCAGCAACAGAGGCAGCACAGGG + Intronic
972725826 4:41745970-41745992 GCAGCGGCAGCGGCGGCAGCTGG - Exonic
973306688 4:48659985-48660007 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
973676505 4:53268683-53268705 GCAGAGGCAGGGGCAGCACAGGG + Intronic
973764303 4:54149512-54149534 GCAGCTGCAGAGGGTGCGCCGGG - Intronic
973793588 4:54400953-54400975 TCAGCTGCAGAGGCAGCCTCTGG + Intergenic
974147714 4:57967345-57967367 GCAGCTGCAGAGGGGGCACCGGG + Intergenic
975395561 4:73869803-73869825 GCGGTGGCAGAGGCAGCGCGGGG - Intronic
975464282 4:74691955-74691977 AGAGGAGCAGAGGCAGCACCAGG + Intergenic
975670710 4:76778140-76778162 CCAGCAGCAGTGGCATCACCTGG - Intronic
975779091 4:77820037-77820059 GCGGCGGCAGCCCCAGCACCAGG - Intergenic
976595241 4:86889667-86889689 GCAGAGGCAGAGGCAGAGGCAGG + Intronic
976774826 4:88697258-88697280 GCTGCGGCAGAGGCTGCCGCGGG - Exonic
976830379 4:89308027-89308049 GCAGCAGCAGCGGCGGCAGCAGG + Intergenic
977696523 4:99971941-99971963 CCAGCGGCAGTGTCAGCACAGGG - Intergenic
977696578 4:99972238-99972260 GCAGAGGCAGCAGCAGCACAGGG - Intergenic
977885761 4:102250500-102250522 GCAGCTGCAGAGGGTGCGCCGGG - Intergenic
978030596 4:103936926-103936948 GCAGCTGCGGAGGGTGCACCAGG + Intergenic
978466259 4:109012625-109012647 GCAGCTGCAGAGGGGGCGCCAGG + Intronic
978710182 4:111770674-111770696 GCAGCAGCTGTGGCAGCACAGGG + Intergenic
979349669 4:119628981-119629003 GCGGCGGCAGCGGCAGCGCCCGG + Exonic
979678610 4:123435582-123435604 GCAGCTGCAGAGGGGGCACCAGG - Intergenic
980882053 4:138721036-138721058 CCAGCAGCAGAGGCAGCCCTGGG + Intergenic
981338916 4:143597922-143597944 GCATCGGCAGATGCAGCATCTGG + Intronic
981694160 4:147542473-147542495 GCAGCAGCAGAGGCATGACTGGG - Exonic
981782136 4:148442421-148442443 GCAGGGGCAGGGGCAGGGCCAGG + Exonic
982157458 4:152536014-152536036 GCAGCGGCAGCGGCAGCGCCCGG + Exonic
983112631 4:163772028-163772050 TCAGGAGCAGAGGCATCACCTGG + Intronic
983141992 4:164161554-164161576 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
983238644 4:165207483-165207505 GCAGCGGCAGCAGCAGCAGCAGG + Intronic
983449680 4:167894945-167894967 ACAGGGGCAGAGGAAGCAGCAGG + Intergenic
983734717 4:171043307-171043329 GCAGCTGCGGAGGGTGCACCGGG + Intergenic
983834240 4:172369682-172369704 GCATCTGCAGAGGGTGCACCAGG - Intronic
984069295 4:175092260-175092282 GCAGCTGCGGAGGGTGCACCGGG + Intergenic
984805339 4:183746653-183746675 GCAGCTGCAGAGGGGGCGCCAGG - Intergenic
984862485 4:184253086-184253108 GCAGCTGCGGAGGGGGCACCAGG + Intergenic
984973433 4:185209953-185209975 GCAGCAGCAGCGGCGGCGCCGGG + Intronic
985527638 5:415256-415278 GCTGAGCCAGAGGCAGCACACGG + Intronic
985539725 5:482306-482328 GCAGAGGAGGAAGCAGCACCCGG + Intronic
985616298 5:923669-923691 GCTGCTGCAGAGTCAGCACAGGG - Intergenic
985875905 5:2593810-2593832 GCAGTGGCACACGCAGCACAGGG + Intergenic
986082862 5:4412083-4412105 GAAGCGGCAGAGGCCGCATTTGG + Intergenic
986176464 5:5356406-5356428 GCAGGGGGAGGGGCAGCATCAGG - Intergenic
986334457 5:6743087-6743109 GCAGGGGCAGACGCACCTCCGGG + Intronic
986469359 5:8058902-8058924 GGGGCAGCAGAGGCAGCACGGGG + Intergenic
986737448 5:10678653-10678675 GCAGCTTCAGAGGCAACACCAGG + Intergenic
986919031 5:12662055-12662077 GCAGCTGCAGAAGGTGCACCGGG + Intergenic
987030502 5:13972515-13972537 GCAGAGGTAGAGGAAGCAGCGGG - Intergenic
987080140 5:14418741-14418763 GAAGCAGCAGAGACAGAACCTGG + Intronic
988500137 5:31777251-31777273 GCAGCTGCAGAGGGGGCGCCAGG + Intronic
988600195 5:32632510-32632532 GCACCTGCAGAGGTACCACCGGG + Intergenic
989216342 5:38908101-38908123 GCAGCCACAGTGGCAGCACAGGG - Intronic
989559683 5:42836517-42836539 GCAGCTGCAGAGGGTGCGCCGGG + Intronic
990512147 5:56498869-56498891 GCAGCTGCAGAGGGTGCGCCGGG - Intergenic
990665713 5:58069346-58069368 GCAGCTGCAGAGGGTGCACCAGG - Intergenic
990825521 5:59893686-59893708 GCAGCAGCAGCAGCAGCATCAGG - Exonic
991361101 5:65821089-65821111 GCAGCGGCAGGGGCAGGAATGGG + Intronic
991626196 5:68603501-68603523 CCAGCAGCACAGGCATCACCTGG + Intergenic
991657800 5:68921016-68921038 GCAGCTGCGGAGGGTGCACCAGG + Intergenic
991952322 5:71958446-71958468 GCAGCAGCAGCAGCAGCAGCAGG - Intergenic
992259631 5:74956863-74956885 GCAGCAGCATAGATAGCACCCGG + Intergenic
992689859 5:79231667-79231689 GAAGGGGCAGAGGCAGAATCAGG - Intronic
993901119 5:93584837-93584859 GCGGCGGCGGAGGCAGCGGCCGG + Exonic
993972099 5:94432224-94432246 GCAGCGGGAGCAGCATCACCTGG + Intronic
994083264 5:95731322-95731344 GCAGCGGCAGCGGCAGCAGGAGG + Exonic
994570266 5:101506029-101506051 GCAGAGGCATAGGCAGGACCAGG + Intergenic
995696690 5:114885819-114885841 GCAGCAGCAGAGACATAACCTGG + Intergenic
995872270 5:116756034-116756056 GCAGGGGGAGAGGTAGCCCCAGG - Intergenic
996185005 5:120464399-120464421 GCAGCGGCCGTAGCAGCGCCAGG + Exonic
996521956 5:124437188-124437210 GCATCCTCAGGGGCAGCACCCGG - Intergenic
996575892 5:124976326-124976348 GCAGCTGCGGAGGTTGCACCAGG - Intergenic
997319079 5:132963297-132963319 GCTGCGGCAGTGGCGGCGCCGGG + Exonic
997636140 5:135408545-135408567 GCAGAGGCAGAGGCAGACCGTGG - Intergenic
997919539 5:137965333-137965355 GCGGTGGCAGTGGCAGCAGCAGG + Intronic
999114906 5:149154170-149154192 GCAGCAGCAGGGGCAGCCCAAGG + Intronic
999134667 5:149310543-149310565 GTAGCTGCAGAGGCAGAAACTGG - Intronic
999802071 5:155047614-155047636 CCAGCACCAGGGGCAGCACCTGG + Intergenic
999868925 5:155729679-155729701 GAAGCAGCAGAGGCAGCCCGGGG - Intergenic
1000060531 5:157651679-157651701 GCAGCGCCAGGGGCTGCACCGGG + Exonic
1000065525 5:157690501-157690523 GCAGCGCCCGGGGCTGCACCGGG + Intergenic
1000085871 5:157886996-157887018 GCAGCTGCGGAGGGGGCACCGGG + Intergenic
1000279898 5:159773411-159773433 GCGGCGGCGGCGGCAGCAGCCGG + Intergenic
1001005699 5:168047888-168047910 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
1001293315 5:170481393-170481415 GCAGCAGCAGCAGCAGCAGCAGG - Intronic
1001794437 5:174490346-174490368 GCACCTGCAGAGGCAGCAGCAGG + Intergenic
1001892537 5:175351326-175351348 GCAGTGACAGAGCCAGCAGCTGG - Intergenic
1002000686 5:176194871-176194893 GCAGGGGCAGGGGCAGGAGCGGG + Intergenic
1002093560 5:176818094-176818116 GCAGGGGCAGGGGCTGCAGCTGG - Intronic
1002253656 5:177944116-177944138 GCAGGGGCAGGGGCAGGAGCGGG - Intergenic
1002616455 5:180459318-180459340 GCAGCTGCGGAGGGTGCACCGGG + Intergenic
1003115736 6:3282874-3282896 CCAGGGGCAGAGACGGCACCAGG + Intronic
1003564756 6:7213707-7213729 GCAGAGGCAGAAACAGCACAGGG + Intronic
1003870387 6:10398303-10398325 GCAGCAGCAGTAGCAGCAGCAGG + Exonic
1003881397 6:10482932-10482954 GCAGCTGCAGAGGGGGCGCCGGG - Intergenic
1004044713 6:12012530-12012552 GCAGCGGCAGCGGCTCCGCCGGG + Exonic
1004217585 6:13716900-13716922 GCAGCTGCAGAGGGTGCGCCGGG + Intergenic
1004278572 6:14259307-14259329 GCTGGGGCAGAAGGAGCACCAGG + Intergenic
1004354076 6:14916132-14916154 GCAGCTGCGGAGGGTGCACCAGG + Intergenic
1004483224 6:16040546-16040568 GCAGCTGCAGAGGGGGCACCAGG - Intergenic
1004884422 6:20037697-20037719 ACAGAGGCAGAGGCAGGACCAGG - Intergenic
1005624723 6:27652897-27652919 GCAGAGGCAGAGGCAGGGGCAGG - Intergenic
1005624726 6:27652903-27652925 GCAGTGGCAGAGGCAGAGGCAGG - Intergenic
1006097323 6:31664210-31664232 GCAGTGGCAGAAGGAGCATCAGG - Exonic
1006143578 6:31945306-31945328 GCCCTGGCTGAGGCAGCACCTGG + Exonic
1006154235 6:32005703-32005725 GCAGGGGCAGCAGCAGCAGCAGG - Intergenic
1006154522 6:32007078-32007100 GAAGCAGCTGAGGCAGCACAAGG + Intergenic
1006160539 6:32038437-32038459 GCAGGGGCAGCAGCAGCAGCAGG - Exonic
1006310049 6:33250924-33250946 GCTGCGGCTGGGACAGCACCCGG + Exonic
1006333983 6:33411016-33411038 GCAGCGGCAGCGGCAGGAGGAGG - Exonic
1006381539 6:33700782-33700804 GCAGCAGCATGGGCATCACCTGG - Intronic
1006421286 6:33935686-33935708 GCTGCAGCAGAGGCAGCTGCGGG + Intergenic
1006497889 6:34437206-34437228 GCAGCTGCGGAGGGTGCACCGGG - Intergenic
1006860453 6:37169140-37169162 GAAGGGGCTGAGGCAGCATCTGG + Intergenic
1007112747 6:39322483-39322505 CCAGCAGCAGGGGCAGCACCCGG + Exonic
1007176620 6:39901842-39901864 GCAGCGGCAGCGGAAGGTCCTGG + Exonic
1007409386 6:41653217-41653239 CCTGCGGCAGCGGCAGCAGCAGG - Intronic
1007792139 6:44316441-44316463 GCAGCAGCAGCAGCATCACCGGG - Intronic
1008018828 6:46552756-46552778 GCAGCAGCAGCGGCATCACCTGG + Intronic
1008469374 6:51866041-51866063 CCAGCAGCAGCAGCAGCACCAGG - Intronic
1008535583 6:52504258-52504280 GCGGCGGCAGTAGCAGCACTTGG + Intronic
1008572540 6:52829405-52829427 GCAGCTGCAGAGGGTGCGCCAGG - Intergenic
1008583722 6:52929983-52930005 CCAGCAGCATGGGCAGCACCTGG - Intergenic
1008716395 6:54295096-54295118 GCAGCAGCAGCAGCAGCAGCGGG + Intergenic
1009853743 6:69232683-69232705 GCAGCAGCAGCGGCATCAGCTGG - Intronic
1010357705 6:74953840-74953862 GCAGCTGCAACAGCAGCACCTGG + Intergenic
1011016911 6:82767152-82767174 GCAGCAGCAGCAGCATCACCTGG + Intergenic
1011044599 6:83067758-83067780 GAAGCGGCCGAGCCAGCAGCAGG + Exonic
1011129331 6:84037694-84037716 GCAGCTGCAGAGGGGGCGCCAGG - Intronic
1012164159 6:95927115-95927137 GTAGCTGCAGAGCCAGCATCTGG - Intergenic
1012247164 6:96938631-96938653 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
1012815719 6:104019332-104019354 GCAGCAGCAGCAGCAGCAGCAGG - Intergenic
1012979976 6:105819057-105819079 GCAGCAGCAGAAGCATCCCCTGG + Intergenic
1013175239 6:107670910-107670932 ACACAGGCAGATGCAGCACCAGG - Intergenic
1013204368 6:107933657-107933679 GCAGGGGCAGAGGCAGAGGCAGG - Intronic
1013349876 6:109295924-109295946 GCAGAGGCAGAGTAAGAACCAGG - Intergenic
1013514655 6:110875023-110875045 GCAGCGGCGGCGGCAGCGGCGGG + Exonic
1013803327 6:113970945-113970967 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1013957247 6:115855344-115855366 GCAGCTGCAGAGGGTGCGCCAGG + Intergenic
1014592145 6:123286840-123286862 GCAGCAGCAGCAGCAGCACCTGG + Intronic
1015137318 6:129888036-129888058 GCAGCGGCAGCAACAGCTCCTGG + Intergenic
1016867260 6:148779523-148779545 GGAGCAACAGAGGCAGGACCAGG - Intronic
1017163934 6:151390824-151390846 GCAGCAGCGGCGGCAGCAGCAGG + Intronic
1017672012 6:156777822-156777844 GCGGCGGCGGCGGCGGCACCGGG + Intergenic
1017672313 6:156778959-156778981 GCGGCGGCGGCGGCAGCAGCAGG + Exonic
1017774782 6:157672511-157672533 GCAGAGGCAATTGCAGCACCAGG + Intronic
1017996983 6:159540818-159540840 GCAGCTCCAGACGCAGCTCCCGG + Intergenic
1018109401 6:160520478-160520500 GCAGCTGCAGAGGGTGCGCCGGG - Intergenic
1018166080 6:161098318-161098340 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1018799334 6:167210328-167210350 GCAGCGTCCGAGGCAGCACCAGG + Intergenic
1018929667 6:168232696-168232718 CCAGCCGCAAAGGCAGCTCCGGG + Intergenic
1019173977 6:170150467-170150489 GAATTGCCAGAGGCAGCACCTGG - Intergenic
1019174137 6:170151453-170151475 CGGGCGGCAGAGGCAGCTCCAGG + Intergenic
1019183747 6:170208983-170209005 GCATTGGCAGGGGCAGCCCCTGG - Intergenic
1019230901 6:170562000-170562022 GCAGCAGCAGCAGCAGCAACAGG + Exonic
1019253769 7:35438-35460 GCAGCAGCAGCAGCAGCAACTGG - Intergenic
1019340647 7:507359-507381 GCAGTGGTAGAGCCAGGACCAGG - Intronic
1019493735 7:1326659-1326681 GGGACGGCAGAGGCAGCAGCAGG - Intergenic
1019519852 7:1455648-1455670 GGTGGGGCAGAGGCAGAACCAGG + Intronic
1019774403 7:2903914-2903936 GCAGCTGAACAGGCAGGACCTGG + Intergenic
1019940554 7:4285887-4285909 ACAGCAGCAGTGGCAGCAGCAGG - Intergenic
1020418567 7:7972202-7972224 GCAGCAGCAGTGGCAGCGGCAGG - Intronic
1020890629 7:13873682-13873704 GCAGGGGCAGAGAAAGCATCAGG - Intergenic
1021440058 7:20667722-20667744 GCAGAGGCAGAGGCAGGGGCAGG - Intronic
1021440061 7:20667728-20667750 GCAGAGGCAGAGGCAGAGGCAGG - Intronic
1021570150 7:22056916-22056938 GCAGCAGCAGCAGCATCACCTGG - Intergenic
1021761270 7:23904922-23904944 GCAGCTGCAGAGGGTACACCAGG - Intergenic
1022072487 7:26930992-26931014 GCAGAGGCAGCAGCAGCATCAGG + Intronic
1022476281 7:30712538-30712560 TCAGCAGCAGCGGCATCACCCGG + Intronic
1022480196 7:30738613-30738635 GCAGCAGCAGCAGCATCACCAGG - Intronic
1022506108 7:30909557-30909579 GCAGGGGCAGAGCAGGCACCAGG - Intergenic
1022619948 7:31972818-31972840 GCAGAAGCACAGCCAGCACCAGG + Intronic
1023054365 7:36279647-36279669 GCAGAGGCTGAGGGAGGACCTGG + Intronic
1023232505 7:38049897-38049919 GCAGCTGCAGAGGGTGCGCCAGG + Intergenic
1023377994 7:39577549-39577571 GCAGCTGCAGAGGGTGCACCAGG + Intronic
1024233398 7:47379795-47379817 GAGGCTGCAGCGGCAGCACCAGG + Intronic
1024794349 7:53004081-53004103 GCAGCTGCGGAGGGTGCACCAGG + Intergenic
1026236992 7:68535312-68535334 GCAGCTGCAGAGGGTGCGCCGGG - Intergenic
1026764985 7:73154819-73154841 GCAGCAGCAGCAGCAGCACCGGG + Intergenic
1027082183 7:75237793-75237815 GCAACAGCAGCAGCAGCACCGGG - Intergenic
1027231381 7:76274648-76274670 GCAGCGGCAGAACCAGGACTAGG + Intronic
1028270053 7:88777243-88777265 GCGGTGGCAGAATCAGCACCAGG - Intronic
1029390748 7:100272311-100272333 GCAGCAGCAGCAGCAGCACCGGG - Intergenic
1029403276 7:100358314-100358336 GGAGCAGCAGGGGCAGCAGCAGG - Exonic
1029425835 7:100493651-100493673 GCAGAGGCAGCGGCAGCGCGGGG - Exonic
1029443852 7:100602369-100602391 GCAGCGGTGGCGGCAGCAGCAGG - Exonic
1029569528 7:101360453-101360475 GCAGAGGCAGAGGCAGGGGCAGG + Intergenic
1029705505 7:102273758-102273780 GCAGAGGCAGAGGCAAGGCCAGG + Intronic
1029795200 7:102887184-102887206 CCAGCAGCATAGGCATCACCTGG + Intronic
1030292698 7:107888136-107888158 GCAGCTGCAGAGGGTGCGCCAGG + Intergenic
1031056528 7:116998209-116998231 GCAGCTGCAGAGGGTGCGCCGGG - Intronic
1031902869 7:127429319-127429341 GCAGCTGCAGAGGGTGCGCCGGG + Intronic
1031966641 7:128031971-128031993 GCGGCGGCAGCAGCAGCAGCGGG + Intronic
1032125379 7:129189193-129189215 GCAGCAGCAGCAGCAGCCCCAGG - Exonic
1032163725 7:129529715-129529737 GCAGCCATAGAGGCAGGACCCGG - Intergenic
1032316603 7:130843878-130843900 GCCCGAGCAGAGGCAGCACCCGG - Intergenic
1032442503 7:131952809-131952831 GCAGGGGCTGAGGTTGCACCAGG + Intergenic
1032842817 7:135727412-135727434 GGACGGGCAGAGGCAGCAGCAGG + Exonic
1033273969 7:139957144-139957166 GCAGCTGCAGTGGCAGCTCTTGG + Intronic
1033312722 7:140273558-140273580 GCAGCGGCTGAGGCTTCACCTGG - Intergenic
1033426877 7:141252809-141252831 GCAGTGGCACAGTTAGCACCAGG + Intronic
1033565531 7:142574912-142574934 GCAGAGGCAGAGGCAGAGGCAGG - Intergenic
1034193020 7:149225478-149225500 GCTGGGGCCGAGGCGGCACCAGG - Exonic
1034224347 7:149471303-149471325 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
1034269543 7:149796966-149796988 CCAGCAGCATCGGCAGCACCTGG + Intergenic
1034386138 7:150742718-150742740 GGAGGAGCAGAGGCAGCAGCAGG + Exonic
1034386796 7:150747208-150747230 GGAGGAGCAGAGGCAGCAGCAGG - Intronic
1034440037 7:151081677-151081699 GGAGCAGCAGGGGCAGCAGCAGG + Exonic
1034777191 7:153839070-153839092 GCAGCAGCAGCAGCAGCATCTGG - Intergenic
1034908117 7:154968955-154968977 GCAGCAGCAGCAGCAGCACCCGG - Exonic
1035032943 7:155874177-155874199 GCAGCGGCAGTGGCAGACCAGGG + Intergenic
1035048617 7:155984987-155985009 GCAGAGGCAGACGCAGACCCTGG - Intergenic
1036135063 8:6152856-6152878 GCAGCTGCAGAGAGTGCACCAGG + Intergenic
1036283562 8:7422628-7422650 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
1036337908 8:7888893-7888915 GCAGCAGCAGCAGCAGCAGCAGG - Intergenic
1036422128 8:8606855-8606877 GCAGCAGCAGCAGCATCACCTGG - Intergenic
1036656122 8:10678561-10678583 GCAGGACCAGAGGCAGGACCAGG + Intronic
1036691821 8:10949139-10949161 GCCCCTGCAGAGGCAGCCCCGGG - Intronic
1036706159 8:11048776-11048798 GCAGAGCCAGGGGCAGCGCCAGG - Intronic
1037065025 8:14566988-14567010 GCAGCTGCGGAGGGTGCACCAGG + Intronic
1037882264 8:22579060-22579082 GCGGCGGCAGGGGCGGCCCCGGG + Exonic
1038220129 8:25599555-25599577 GCAGGGGCAGGGGCAGCCCAAGG - Intergenic
1038285502 8:26203133-26203155 GCAGCAGCTGTGGCAGCAGCAGG - Intergenic
1039453947 8:37696029-37696051 GCAGCGGCAGCGGCGGCGGCGGG + Exonic
1039512853 8:38105554-38105576 GCGGCGGCAGGAGCAGGACCTGG + Exonic
1039733244 8:40302574-40302596 GCAGGGGCAGGGGCAGCTCTGGG + Intergenic
1040804344 8:51377665-51377687 GCAGCTGCGGAGGGTGCACCGGG + Intronic
1040954004 8:52961542-52961564 GCAGCTGCAGAGGGTCCACCAGG + Intergenic
1041068528 8:54104342-54104364 GCAGCTGCGGAGGGGGCACCAGG + Intergenic
1041588372 8:59547246-59547268 GCAGCTGCAGAGGGTGCACTGGG + Intergenic
1041715293 8:60926707-60926729 GCAGCAGCAGCAGCAGCAGCCGG + Intergenic
1042169482 8:65978003-65978025 GCAGCTGCAGAGGGGGCGCCAGG - Intergenic
1042316800 8:67434709-67434731 GCTGCAGCAGTGGCAGCAGCAGG + Intronic
1042336029 8:67630872-67630894 GCAGCTGCGGAGGCTGCACTGGG + Intronic
1042337199 8:67640812-67640834 GCAGCAGCAGTGGCAGCCCCTGG + Intronic
1042444026 8:68862552-68862574 GAAGCGGCAGCAGCAGCAGCAGG - Intergenic
1043474206 8:80590503-80590525 CCAGCAGCATTGGCAGCACCTGG + Intergenic
1043527364 8:81111690-81111712 GCAGCGGCAAGTGCAGGACCAGG + Exonic
1043769712 8:84183292-84183314 GCAGCGGCAGCGGCAGCTCGCGG - Intronic
1044306444 8:90645857-90645879 GCAGCAGCCGGGGCAGCGCCTGG + Exonic
1044391846 8:91661236-91661258 GCAGGGCCAGAGGCAGTGCCTGG + Intergenic
1044459648 8:92429443-92429465 GCAGCTGCAGAGGGTGCACCAGG - Intergenic
1044900701 8:96941175-96941197 GCAGCAGCAGCAGCAGCACCAGG - Intronic
1044927897 8:97224683-97224705 GCAGCGGCAGAGGGGGCGCCTGG - Intergenic
1044963919 8:97557063-97557085 GCAGCTGCAGAGGGTGCGCCAGG + Intergenic
1044999735 8:97869137-97869159 ACAGAGGCAGAGGCAGAAGCTGG + Exonic
1045718322 8:105074912-105074934 GCAGCAGCAGCAGCAGCAGCGGG - Intronic
1045933738 8:107655754-107655776 GCAGCTGCAGAGGGTGCACTGGG + Intergenic
1046056682 8:109086671-109086693 GCAGAAGCAGAAGCAGCAGCAGG - Exonic
1046174403 8:110556319-110556341 GCAGCGGCAGCGGCAGCGGCAGG + Intergenic
1046260317 8:111758967-111758989 GCAGCTGCAGAGGGGGCGCCGGG - Intergenic
1046962422 8:120125130-120125152 GGAGAGGCGGAGGCAGCTCCAGG + Exonic
1047318248 8:123754374-123754396 GCAGCGGGGCAGGCAGCTCCAGG + Intergenic
1047403357 8:124564239-124564261 GCAGTTGTAGAGGCAGCAGCAGG + Intronic
1047851541 8:128862905-128862927 AAAGGGTCAGAGGCAGCACCAGG - Intergenic
1048274467 8:133055851-133055873 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
1048307673 8:133295468-133295490 GTGGCGGCAGAGCCAGCCCCAGG - Intronic
1048606369 8:135972777-135972799 GCAGAGGTAGATGCAGCACATGG + Intergenic
1048752628 8:137697378-137697400 GCAGCAGCAGCAGCAGCAGCAGG + Intergenic
1048876108 8:138837967-138837989 GGAGGGGCACAGACAGCACCTGG + Intronic
1048980905 8:139703131-139703153 GCAGCAGCAGCAGCAGCAGCGGG + Intergenic
1049287773 8:141785822-141785844 GCAGCAGCAGCAGCAGCACCCGG - Intergenic
1049342319 8:142119725-142119747 GGAGCGGCAGGGGAAGTACCTGG - Intergenic
1049364990 8:142232796-142232818 GCAGAGGCAGAGGCAGAGGCAGG + Intronic
1049440670 8:142608111-142608133 GCAGGGGCAGAGGCAACATGGGG + Intergenic
1049614307 8:143569399-143569421 ACAGCGGCAGGGGCGGGACCCGG + Intronic
1049681811 8:143922197-143922219 GCAGCGGCAGCAGCAGCAGATGG - Exonic
1049740333 8:144237410-144237432 GCAGAGGCACGGGCAGCCCCAGG - Intronic
1049747391 8:144268815-144268837 GCAGGGACAGAGGCAGCAGCAGG + Intronic
1051253345 9:15185502-15185524 GCAGCAGCAGCAGCATCACCTGG + Intronic
1051311616 9:15780065-15780087 GCAGTAACAGAGGCAGCAGCAGG + Intronic
1051774893 9:20622462-20622484 GCAGCAGCAGCAGCAGCTCCAGG + Exonic
1051913919 9:22185342-22185364 ACAGAGGCAGGGGCAGCTCCCGG + Intergenic
1052597275 9:30575793-30575815 GCAGCGGGATGGGCAGCTCCAGG - Intergenic
1052863487 9:33451070-33451092 GGAGCTGCAAAGGCAGCACAGGG + Intergenic
1053023181 9:34709600-34709622 GCAGCAGCTGATGCAGCATCTGG - Exonic
1053122979 9:35560186-35560208 GCAGCAGCAGCGGCAGCACAAGG + Exonic
1053171735 9:35891977-35891999 GCAGTGGCAGAGACAGCAGCAGG - Intergenic
1053435140 9:38069213-38069235 GCGGCGGCAGTGGCAGCGACAGG - Intergenic
1053691222 9:40588399-40588421 GCAGCAGCAGGGGCAGGGCCTGG - Intergenic
1054273579 9:63049086-63049108 GCAGCAGCAGGGGCAGGGCCTGG + Intergenic
1054302482 9:63389370-63389392 GCAGCAGCAGGGGCAGGGCCTGG - Intergenic
1054401255 9:64715870-64715892 GCAGCAGCAGGGGCAGGGCCTGG - Intergenic
1054434863 9:65200190-65200212 GCAGCAGCAGGGGCAGGGCCTGG - Intergenic
1054495526 9:65821491-65821513 GCAGCAGCAGGGGCAGGGCCTGG + Intergenic
1056318002 9:85410006-85410028 GCAGTGGCAGAGCCTGGACCAGG - Intergenic
1056514851 9:87340415-87340437 TCAAAAGCAGAGGCAGCACCAGG + Intergenic
1056556921 9:87697282-87697304 GCAGCAGCAGTGGCAGGAGCAGG - Intronic
1056567738 9:87789671-87789693 GATGTGGCAGAGGCAGCACTGGG + Intergenic
1056570990 9:87814542-87814564 GGATGGGCAGAGGCAGAACCTGG + Intergenic
1056677240 9:88686127-88686149 GCAGCTGCAGAGGGTGCACTGGG - Intergenic
1056763913 9:89433259-89433281 GCAACTGCAGAGACAGCAGCCGG + Intronic
1057123501 9:92598521-92598543 ACATGGGCAGAGGCAGCACTGGG + Intronic
1057551905 9:96057276-96057298 ACAGGGGCAGGGGCAGGACCTGG + Intergenic
1057892490 9:98880031-98880053 TCAGCGGCCAAGGCAGCCCCTGG + Intergenic
1057996131 9:99822760-99822782 GCGGCGGCAGCGGCAGCGGCAGG + Intronic
1058379568 9:104363112-104363134 GCAGCTGCGGAGGGTGCACCAGG - Intergenic
1058492826 9:105520105-105520127 GCAGTGGCAGTGGCAGCGGCAGG + Intronic
1058885775 9:109320476-109320498 GCAGCGGCAGCGGCAGCGCAGGG - Exonic
1059331116 9:113536451-113536473 GCAGCAGCTGAGGGAGCACGTGG - Intronic
1059392549 9:114008255-114008277 GCAGTGGCAGAGGCAGCTCTGGG + Intronic
1059520297 9:114934440-114934462 GCAGTGGCAGCAGTAGCACCTGG + Intergenic
1059769833 9:117414797-117414819 GCAGCGGCGGCGGCGGCAGCAGG + Exonic
1060374875 9:123108825-123108847 GCAGCAGCAGCAGCAGCCCCTGG + Intergenic
1060521424 9:124296196-124296218 GCAGCACCAGTGCCAGCACCAGG - Intronic
1060634569 9:125189775-125189797 GCAGCGGCGGAGGCCGAAGCCGG + Exonic
1060995716 9:127874043-127874065 GCAGCAGCAGCAGCAGCAGCAGG + Intronic
1061196310 9:129108984-129109006 GCAGTGGCAGGGGAAGCTCCTGG + Intronic
1061371597 9:130200698-130200720 GCAGCGGCAGTGGCAGTGGCAGG + Intronic
1061413523 9:130433408-130433430 CCAGGGGCAGCGGCAGCAGCCGG - Exonic
1061513095 9:131072694-131072716 GCAGCTGCAGAGGCTGAACAAGG + Exonic
1061546562 9:131308092-131308114 GCAGGGGCACCGCCAGCACCAGG - Exonic
1061679806 9:132237432-132237454 GCAGGGGCAGGGGCAGCGGCAGG - Intronic
1061737553 9:132671312-132671334 GCAACGACAGAGGCAGGCCCCGG - Intronic
1061756930 9:132820816-132820838 GCAGCGGAGCAGACAGCACCTGG + Intronic
1061852522 9:133424349-133424371 GCAGAGGCAGAGGCAGAGGCGGG + Exonic
1061860956 9:133468590-133468612 CCAGCAGCAGAGGCAGCAGGCGG + Exonic
1061999929 9:134210799-134210821 TCTGCGGCGGAGGCAGCAACTGG - Intergenic
1062084619 9:134642238-134642260 GCAGCAGCGGGGGCAGCAGCGGG - Exonic
1062109457 9:134773988-134774010 TCAGAGGTGGAGGCAGCACCTGG + Intronic
1062495829 9:136831277-136831299 GCAGCCGCAGAGGCACCCCAGGG + Intronic
1062513373 9:136920266-136920288 GCAGTGGCTGCGGGAGCACCTGG + Exonic
1062566123 9:137164720-137164742 GGAGTGACAGAGGCAGCTCCCGG - Intronic
1062659102 9:137619091-137619113 GCAGCGGCGGAGGCGGCGCGGGG + Intronic
1062746627 9:138217105-138217127 GCAGCAGCAGCAGCAGCAACTGG + Intergenic
1203653816 Un_KI270752v1:4590-4612 GCAGAGGCAGAGGCAGAGGCAGG - Intergenic
1185541449 X:905917-905939 ACATGGGCAGAGGCTGCACCGGG + Intergenic
1185643134 X:1599437-1599459 GCGGCTGCAGAGGGAGCCCCCGG - Intronic
1186470344 X:9816580-9816602 GCAGCAGCAGCAGCAGCAGCAGG - Intronic
1187147742 X:16653363-16653385 GCAGCAGCATTGGCACCACCTGG + Intronic
1187159749 X:16753312-16753334 GCTGAGGCAGAAGCATCACCTGG + Intronic
1187181443 X:16946892-16946914 GCAGCGGCAGCGGCAGCGGCGGG + Exonic
1187472379 X:19580554-19580576 GCAGCAGCAGCAGCAGCACTGGG + Intronic
1187476397 X:19614775-19614797 GTAGCGGCATTGGCATCACCTGG - Intronic
1187507206 X:19887478-19887500 GCAGCAGCAGAGGCAGCAGCGGG - Exonic
1187647707 X:21367245-21367267 GCAGCAGCAGCAGCAGCAGCAGG - Intergenic
1187939112 X:24364390-24364412 GCAGCGGCAGGAGCAGGAGCAGG - Intergenic
1187940700 X:24378059-24378081 GCAGCAGCAGCAGCAACACCTGG - Intergenic
1187950413 X:24465291-24465313 GCAGCAGCAGCAGCAGCTCCAGG - Intronic
1188005354 X:25012874-25012896 GCAGCGGCAGAGAGCGCACGCGG - Intronic
1188499133 X:30806633-30806655 GCAAGGGCAAAGGCAGAACCAGG - Intergenic
1188984902 X:36760502-36760524 GCAGAGGTGTAGGCAGCACCTGG - Intergenic
1189204712 X:39227815-39227837 CCAGGCTCAGAGGCAGCACCTGG - Intergenic
1189294325 X:39908178-39908200 GCTGTGGCAGAGGCATCACGGGG + Intergenic
1189658927 X:43277693-43277715 GAAGGGCCAGAGGCAGGACCAGG + Intergenic
1190237925 X:48631672-48631694 GCAGCAGCAGCAGCAGCAGCAGG - Intergenic
1190248420 X:48705706-48705728 GCAGAGGCAGAGGGAGGCCCAGG - Intronic
1190264823 X:48821970-48821992 ACAGCTGAAGAGGCAGCACTGGG - Intronic
1190290318 X:48988156-48988178 TCAGCGGCAGGGGGAGCGCCTGG - Exonic
1190329536 X:49227054-49227076 GCAGCGGGAGAAGCAGCAGATGG - Exonic
1190360459 X:49644283-49644305 GCAGTGGGACAGGCAGCTCCAGG + Intergenic
1191640276 X:63424182-63424204 GCACCTGCAGAGGCAGCAGCTGG + Intergenic
1191830022 X:65406744-65406766 GCAGCAGCAGAAGCAGCGGCGGG + Intronic
1192261092 X:69506182-69506204 GCAGCGGCAGCGGCCGCAGTGGG + Intronic
1192361649 X:70444744-70444766 GCAGCGGCAGCGGCGGCGGCAGG - Intergenic
1192630751 X:72776607-72776629 GAAGCTGCAGAGGCAGCCGCTGG + Intergenic
1192650959 X:72944197-72944219 GAAGCTGCAGAGGCAGCCGCTGG - Intergenic
1193271071 X:79530728-79530750 GCAGCTGCAGAGGGTGCACTGGG + Intergenic
1193996309 X:88369200-88369222 GCAGCAGCAGTGACAACACCTGG - Intergenic
1194217412 X:91148062-91148084 GCAGCGGCAGTGGCAGCATGGGG + Intergenic
1194384383 X:93235879-93235901 GCAGCTGCAGAGGGTGCGCCAGG + Intergenic
1195702615 X:107716439-107716461 GCAGCCGCAGAGGCAGCCGGAGG - Intronic
1196047371 X:111270389-111270411 GCAGCAGCAGCAGCAGCAGCAGG - Exonic
1197020164 X:121677333-121677355 GCAACAGCAGAAGCAGCTCCAGG - Intergenic
1197501558 X:127248602-127248624 GCAGTGGCACAGGTAGCACTTGG - Intergenic
1198031921 X:132761428-132761450 GCAGGGGGCGAGCCAGCACCAGG + Intronic
1198177516 X:134171746-134171768 GCGGCGGCTGAGGCTGCACGAGG - Intergenic
1198326510 X:135579007-135579029 ACAGCAGCAGAGGGAGCCCCAGG - Intronic
1198329214 X:135606063-135606085 ACAGCAGCAGAGGTAGCCCCAGG - Intergenic
1198337331 X:135679515-135679537 GCAGCAGCAGAGGGAGCCCCAGG + Intergenic
1198341676 X:135720155-135720177 ACAGCAGCAGAGGGAGCCCCAGG - Intronic
1198346322 X:135763206-135763228 ACAGCAGCAGAGGGAGCCCCAGG + Intronic
1198348228 X:135780491-135780513 ACAGCAGCAGAGGGAGCCCCAGG + Intergenic
1198350130 X:135797754-135797776 ACAGCAGCAGAGGGAGCCCCAGG + Intronic
1198352040 X:135815027-135815049 ACAGCAGCAGAGGGAGCCCCAGG + Intronic
1198353948 X:135832295-135832317 ACAGCAGCAGAGGGAGCCCCAGG + Intronic
1198355856 X:135849545-135849567 ACAGCAGCAGAGGGAGCCCCAGG + Intronic
1198357767 X:135866824-135866846 ACAGCAGCAGAGGGAGCCCCAGG + Intergenic
1198359685 X:135884106-135884128 ACAGCAGCAGAGGGAGCCCCAGG + Intronic
1198361862 X:135903299-135903321 ACAGCAGCAGAGGGAGCCCCTGG - Intronic
1198366539 X:135945884-135945906 ACAGCAGCAGAGGGAGCCCCAGG + Intergenic
1199543120 X:148979604-148979626 ACAGCAGCAGAAGCATCACCAGG - Intronic
1199713230 X:150487083-150487105 GCAGCAGCAGCAGCAGCCCCTGG - Intronic
1199759906 X:150897870-150897892 CCAGCCGCATAGGCATCACCTGG - Intronic
1199840974 X:151648667-151648689 GCAGCAGCAGCAGCAGCAGCGGG - Exonic
1200053251 X:153445714-153445736 GGAGAGGCAGAGGCAGCTCAGGG + Intronic
1200111601 X:153743585-153743607 GCAGCGGCTGGAGCAGCAGCTGG + Exonic
1200255582 X:154580774-154580796 GCAGCGGTGGCAGCAGCACCAGG + Intergenic
1200262187 X:154623630-154623652 GCAGCGGTGGCAGCAGCACCAGG - Intergenic
1200292659 X:154887025-154887047 GCGGCGGCAGTGACTGCACCGGG - Exonic
1200306030 X:155026906-155026928 GCAGCGGAAGAGGGAGGGCCGGG - Exonic
1200339503 X:155382765-155382787 GCGGCGGCAGTGACTGCACCGGG - Exonic
1200346967 X:155457928-155457950 GCGGCGGCAGTGACTGCACCGGG + Exonic
1200380242 X:155829637-155829659 GCAGCAGCAGTGGCAGCAGCAGG - Intergenic
1200553926 Y:4611854-4611876 GCAGCGGCAGTGGCAGCATGGGG + Intergenic
1201189905 Y:11437054-11437076 GCAGCAGCAGGGGCAGGGCCTGG - Intergenic