ID: 946411262

View in Genome Browser
Species Human (GRCh38)
Location 2:219516355-219516377
Sequence ACAAGCACCCTCTCCGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 107}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946411259_946411262 -4 Left 946411259 2:219516336-219516358 CCTACGTGTGAGCACAAACACAA 0: 1
1: 0
2: 2
3: 10
4: 119
Right 946411262 2:219516355-219516377 ACAAGCACCCTCTCCGGGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 107
946411255_946411262 28 Left 946411255 2:219516304-219516326 CCCCATTTGGAGACTGCTGGCGC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 946411262 2:219516355-219516377 ACAAGCACCCTCTCCGGGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 107
946411256_946411262 27 Left 946411256 2:219516305-219516327 CCCATTTGGAGACTGCTGGCGCC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 946411262 2:219516355-219516377 ACAAGCACCCTCTCCGGGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 107
946411258_946411262 6 Left 946411258 2:219516326-219516348 CCATCTGTCACCTACGTGTGAGC 0: 1
1: 0
2: 0
3: 7
4: 106
Right 946411262 2:219516355-219516377 ACAAGCACCCTCTCCGGGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 107
946411257_946411262 26 Left 946411257 2:219516306-219516328 CCATTTGGAGACTGCTGGCGCCA 0: 1
1: 0
2: 0
3: 4
4: 102
Right 946411262 2:219516355-219516377 ACAAGCACCCTCTCCGGGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946411262 Original CRISPR ACAAGCACCCTCTCCGGGAG AGG Intronic