ID: 946411356

View in Genome Browser
Species Human (GRCh38)
Location 2:219516828-219516850
Sequence CATTGTGCAGGGAGAAGAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 301}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946411346_946411356 28 Left 946411346 2:219516777-219516799 CCCGCCATTGGGCAGGGGAGTTA 0: 1
1: 0
2: 0
3: 9
4: 111
Right 946411356 2:219516828-219516850 CATTGTGCAGGGAGAAGAGTCGG 0: 1
1: 0
2: 1
3: 32
4: 301
946411347_946411356 27 Left 946411347 2:219516778-219516800 CCGCCATTGGGCAGGGGAGTTAG 0: 1
1: 0
2: 0
3: 6
4: 99
Right 946411356 2:219516828-219516850 CATTGTGCAGGGAGAAGAGTCGG 0: 1
1: 0
2: 1
3: 32
4: 301
946411349_946411356 24 Left 946411349 2:219516781-219516803 CCATTGGGCAGGGGAGTTAGGTA 0: 1
1: 0
2: 0
3: 9
4: 116
Right 946411356 2:219516828-219516850 CATTGTGCAGGGAGAAGAGTCGG 0: 1
1: 0
2: 1
3: 32
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946411356 Original CRISPR CATTGTGCAGGGAGAAGAGT CGG Intronic
900763999 1:4491750-4491772 CTGTGTGCAGGAAGAAGAGCAGG + Intergenic
901404658 1:9038213-9038235 GACTGTGCAGGCAGCAGAGTGGG - Intronic
901422421 1:9160201-9160223 CTATGAGCAGGGAGAAGAGGGGG - Intergenic
902914183 1:19626178-19626200 AATCTTCCAGGGAGAAGAGTGGG - Intronic
903009713 1:20320948-20320970 CCCTTGGCAGGGAGAAGAGTGGG + Intronic
903080816 1:20810862-20810884 CACTCTGAAGGTAGAAGAGTCGG + Exonic
903728562 1:25471637-25471659 CTTTGTGCAGGGAAAATACTAGG + Intronic
903874810 1:26466547-26466569 CATTGTTCAGATAGCAGAGTTGG - Intronic
904417317 1:30371287-30371309 CACATTGCAGGGAGGAGAGTGGG - Intergenic
904606373 1:31700106-31700128 CATTGTGCACCTAGAAGAGAAGG + Exonic
906492679 1:46280358-46280380 AATGGTGAAGGGAGAGGAGTAGG - Intronic
907053099 1:51342963-51342985 CAGTGTGCAGGGAGAGCAGAGGG - Intronic
908060043 1:60337805-60337827 TAATGTGCAGGGAGAAGGGCAGG - Intergenic
908524213 1:64972162-64972184 CAATGTGCATGTGGAAGAGTAGG - Intergenic
908766561 1:67559674-67559696 CTTGGAGCAGGGAGAAGAGTAGG + Intergenic
909830363 1:80181623-80181645 TATTGTAGAGGGAGAAGAGAAGG + Intergenic
911224340 1:95288794-95288816 TGTTGTCCTGGGAGAAGAGTAGG - Intergenic
911767680 1:101698734-101698756 CATTGTGCACAAAGAAGAATAGG + Intergenic
912883483 1:113444055-113444077 CACTTTCCAGGGAGAAGATTTGG + Intronic
913007777 1:114651766-114651788 AATTGTTCAGGAAGAAGAGTTGG - Intronic
913263537 1:117022907-117022929 CATTTAGCAGGGAGAAGAAGGGG - Intronic
913522269 1:119656124-119656146 CACTGTGCAGGGAAGAGAGCAGG - Intergenic
914461307 1:147888203-147888225 AATTTTGCAGGTAGAAGAGTAGG - Intergenic
914567393 1:148882152-148882174 GATGGGGCAGGGAGAAGAGACGG - Intronic
914605428 1:149248093-149248115 GATGGGGCAGGGAGAAGAGACGG + Intergenic
915655186 1:157353419-157353441 CATTTTGCTGGGAGCTGAGTTGG + Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
916822743 1:168415525-168415547 CAGAGTGCAGGTGGAAGAGTTGG - Intergenic
917169804 1:172158509-172158531 CAGTGTGCAGTGAGAAGAGAGGG + Intronic
917838763 1:178960904-178960926 AAGTGTGCAGGGAGTGGAGTGGG + Intergenic
918655304 1:187018469-187018491 CATTGTACATTGAGAAGAATGGG - Intergenic
919755257 1:201062436-201062458 CATGGGGCAGGGAGCACAGTGGG - Intronic
919790186 1:201285602-201285624 TCTTGTGCAGAGAGGAGAGTAGG - Intronic
919872145 1:201829751-201829773 GATTGTACTGGGATAAGAGTAGG + Intronic
920227422 1:204448768-204448790 TATTCTCCAGGGAGAAGAGGAGG - Intronic
921290346 1:213651074-213651096 CAGAGTGTAGGGAGAAAAGTGGG + Intergenic
921320526 1:213934191-213934213 CAGGGTGCAGTGGGAAGAGTCGG - Intergenic
921646868 1:217629770-217629792 CATTTTCCAGTGAGAAAAGTAGG - Intronic
921733595 1:218601134-218601156 TATCCTCCAGGGAGAAGAGTTGG + Intergenic
921840204 1:219820297-219820319 CATAGTGCAGGGAAAAGAACTGG - Intronic
922233456 1:223705635-223705657 CAGGGTGCTGGGAGAGGAGTTGG - Intronic
922567505 1:226610625-226610647 CTTGGTGCTGGGAGAAGAGAAGG - Intergenic
923937777 1:238782923-238782945 TATTGTGTTGGGAGAAGAGGAGG - Intergenic
923957346 1:239038388-239038410 CATTGTGCAGTGAGATGATGCGG - Intergenic
1062849038 10:729050-729072 CATGGTGCAGGGGGAGGATTGGG - Intergenic
1062980811 10:1720931-1720953 CTTTGTGCAGGGAGAGGAGGTGG - Intronic
1063015880 10:2076575-2076597 CATTGTGCAGGGAAAACCCTCGG + Intergenic
1063220913 10:3966968-3966990 CATGGTGGAGGGAGAAGAGAGGG - Intergenic
1063333703 10:5188305-5188327 CACTGTGAAGGGAAAAAAGTAGG + Intergenic
1063694829 10:8324216-8324238 CATTGTGGAGGGAGAAGAAGGGG - Intergenic
1067310271 10:45106340-45106362 CATTATGCAGGGAGCTGAGCAGG + Intergenic
1067793413 10:49304199-49304221 GTTTGTGCAGGGCGAGGAGTGGG - Intronic
1069686990 10:70324731-70324753 CCCTGTGCAGGGAGGAGAGCTGG + Intronic
1070409368 10:76125303-76125325 TGTTGTGCATGGAGAAGATTTGG + Intronic
1070745039 10:78928571-78928593 CATGGCACAAGGAGAAGAGTTGG + Intergenic
1071182619 10:83004561-83004583 CATTGTGGAAGGAGAAAAGAAGG + Intergenic
1074080732 10:110166264-110166286 CAATGAGCAGGGAGGAGAGGAGG - Intergenic
1074415898 10:113266296-113266318 TGGTCTGCAGGGAGAAGAGTGGG - Intergenic
1075060966 10:119256415-119256437 CTTTCTGCAAAGAGAAGAGTAGG - Intronic
1077372739 11:2191132-2191154 CAGTGTGCAGGGGGCAGAGCCGG + Intergenic
1077412287 11:2409282-2409304 CAGAGTGCAGGGAGGAGAGGGGG - Intronic
1077478180 11:2800771-2800793 CATTGAGCACGGAGAAGAGCAGG + Intronic
1077889922 11:6411447-6411469 CTTAGTGCAGGGAGATGAGGAGG - Intronic
1078476901 11:11638181-11638203 CACTGTGCTTGGAGCAGAGTGGG + Intergenic
1079552680 11:21719721-21719743 GATTATGCAGGGGGTAGAGTGGG - Intergenic
1080289852 11:30658636-30658658 CATTCTTCAGAGAGAAGAGATGG - Intergenic
1080553378 11:33393678-33393700 CAATGTTCAGGAAGAAGAGCAGG + Intergenic
1081202898 11:40239607-40239629 CATTACTAAGGGAGAAGAGTTGG - Intronic
1081579454 11:44342161-44342183 CATTGTAAAGTGAAAAGAGTAGG + Intergenic
1082891363 11:58142427-58142449 CATTGTTCTGGGAGAAGATCAGG + Intronic
1083244958 11:61419735-61419757 CATTGTGCTGGGAGTCAAGTAGG - Intronic
1084612602 11:70212974-70212996 CATTGGTGAGGGAGAAGAGCTGG - Intergenic
1085299274 11:75449034-75449056 CATGATGCAGGGAGAGGAGATGG + Exonic
1086020533 11:82224159-82224181 CCTTTTGGAGGGTGAAGAGTGGG - Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1087872679 11:103317117-103317139 TATTGTGCAGGGCGAAGGGAGGG + Intronic
1090126154 11:124087057-124087079 AATTGTGGAGGGAGAAATGTTGG - Intergenic
1090532416 11:127604922-127604944 CATTGAGGAGGAAGAAGACTTGG + Intergenic
1091838346 12:3601799-3601821 CTCTGTGAGGGGAGAAGAGTGGG + Intergenic
1092279218 12:7086995-7087017 TATTGAGCAGGGACAAGACTAGG + Intronic
1092897941 12:13031805-13031827 CACAGTTCAGGGAGAAGAGGAGG - Intergenic
1094084385 12:26573761-26573783 CAGTGTGGATGGAGCAGAGTTGG + Intronic
1094443594 12:30506181-30506203 GATTGTGCTGGGAGAAGATCAGG + Intergenic
1095559161 12:43545109-43545131 CAGTGGGGAAGGAGAAGAGTGGG - Intronic
1095618663 12:44223198-44223220 CATTTTGCAGGGTGGAGGGTAGG - Intronic
1095716289 12:45350275-45350297 CATTGTCCAAGGAGAGGGGTGGG + Intronic
1097282685 12:57854383-57854405 CATTTGGAAGGGAGAAGAGGAGG + Intergenic
1098104380 12:67054067-67054089 CATTGTGGATGAAGAAGAATTGG - Intergenic
1098403053 12:70094049-70094071 CATTGAGCTGGGAGGAGGGTGGG + Intergenic
1099175974 12:79422580-79422602 AATGGTGCAGGGAGTAGAGAGGG + Intronic
1099262482 12:80400597-80400619 CCTTGGGAAGGGAGAGGAGTGGG - Intergenic
1100301304 12:93310356-93310378 CAAGGGGCAGAGAGAAGAGTGGG - Intergenic
1100916673 12:99431784-99431806 CATAGTCCAGGGAGAAGAATAGG - Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102378853 12:112446116-112446138 CATTGACCAAGGAGAAGAGGGGG + Intronic
1102520964 12:113477208-113477230 GATTGGGCAGGGAGAAAACTTGG - Intergenic
1102565408 12:113794378-113794400 CACTGTGCATGGAGAGGAGGAGG - Intergenic
1102656709 12:114488066-114488088 GATTGTTCAGGCAGAAGAGGAGG + Intergenic
1103507427 12:121451171-121451193 CATTGTGTAGGCAGAGGAGGAGG - Intronic
1103703733 12:122860591-122860613 CAGGGTGCAGGGAGTAGAGGGGG + Intronic
1105573059 13:21622390-21622412 CTTTATGAAGGGAGAAGAGATGG + Intergenic
1106625465 13:31416647-31416669 CATTGAGTAGGTAGAAGAGGAGG - Intergenic
1106930198 13:34654965-34654987 GATTTTGCAGGGAGAAGCGGAGG - Intergenic
1111983593 13:95042374-95042396 CATTGTGCATGGTGTAGAGAGGG + Intronic
1112557133 13:100478911-100478933 CCCTGTGCAGAGAGAAAAGTTGG - Intronic
1115378433 14:32705341-32705363 CATTGGGAAGGGAAGAGAGTGGG + Intronic
1115518109 14:34205807-34205829 CAAGGTGGAGGGAGAAGAGTTGG - Intronic
1117025344 14:51614085-51614107 TATTTTTCAGGCAGAAGAGTGGG - Intronic
1122066829 14:99179660-99179682 CATTGTGCAGAGGGAAGTATTGG - Intronic
1123000927 14:105293702-105293724 GACTGTGCAGAGAGAAGGGTGGG - Intronic
1124119141 15:26874007-26874029 CACTGAGCAGGCAGGAGAGTCGG + Intronic
1124587923 15:31026272-31026294 CTGTGTGAAGGGAGAAGTGTCGG + Intronic
1124591458 15:31057378-31057400 CCTTTTGGAGGGAGGAGAGTGGG + Intronic
1125157170 15:36601130-36601152 CATTCTGCAGTGTGAGGAGTTGG + Intronic
1127263989 15:57346651-57346673 CTGTGGCCAGGGAGAAGAGTAGG - Intergenic
1128735230 15:70049856-70049878 CATTGTTCAGGGGGAGGAGGAGG + Exonic
1129101724 15:73271159-73271181 CTTTGTACAGAGAGAAGGGTTGG + Intronic
1129181805 15:73882431-73882453 CATTGTGGAGGGAGGAGAAAGGG - Intronic
1130434070 15:83879138-83879160 GACTGAGCAAGGAGAAGAGTAGG - Intronic
1131386800 15:92014763-92014785 CTCTGTGGAGGGAGAAGGGTGGG + Intronic
1132627151 16:896711-896733 GATTCTGCAGGGAGCAGAGCTGG - Intronic
1132683062 16:1151821-1151843 CATCGTGCAGGGTGAAGAAGAGG - Intergenic
1132976667 16:2714428-2714450 CATTGTGCAGAGAGAGGTGTGGG - Intronic
1133256107 16:4517394-4517416 CACTGTGCAGGCAGGAGGGTGGG - Intronic
1134227203 16:12400248-12400270 GCTGGTGCAGGGAGAGGAGTGGG - Intronic
1135630936 16:24035223-24035245 CAGGGTTCAGGGGGAAGAGTTGG + Intronic
1135872999 16:26169525-26169547 CATTATGCAGAGAGATGAGCTGG + Intergenic
1135967062 16:27044606-27044628 CAGTGTGCATGGGGAAGAGCAGG - Intergenic
1136042407 16:27590720-27590742 CATTCTCCAGGGAGAGGAGAAGG - Intronic
1136654852 16:31703596-31703618 CCCTGTTCAGGGAGAGGAGTGGG + Intergenic
1136924763 16:34361917-34361939 CACTGTGCTGATAGAAGAGTTGG - Intergenic
1136979810 16:35049889-35049911 CACTGTGCTGATAGAAGAGTTGG + Intergenic
1137465750 16:48707414-48707436 GACTGTGCAAGGAGAAGGGTGGG - Intergenic
1137646100 16:50076036-50076058 CATTCTGCAGAGAAAAGAGTTGG - Intronic
1137998405 16:53246250-53246272 CATTGTACAGAGAGAACACTGGG - Intronic
1138298906 16:55910204-55910226 CATGGTGCACTTAGAAGAGTGGG - Intronic
1138786520 16:59852938-59852960 CATTGAGGAGGGAGAAAAGGAGG + Intergenic
1139312744 16:66041020-66041042 CTTTGTGGAAGGAGAAGAGAAGG - Intergenic
1140899876 16:79357791-79357813 CACTGGGCAGGGAGGAGAATGGG - Intergenic
1142587094 17:980245-980267 CTTCGTGCAGGGAGAGGAGGAGG - Intergenic
1143901247 17:10176365-10176387 CGCTGTGCAGGGAGGAGAGTGGG - Intronic
1145755768 17:27389044-27389066 CCTTGTTGAGGGAGAAGAGCAGG - Intergenic
1146009822 17:29184990-29185012 CATGGTGTAGGGAAAAGAATGGG - Intergenic
1148078464 17:44953801-44953823 CATTCTGCAGGCAACAGAGTAGG + Intergenic
1148149009 17:45385162-45385184 ACTTGTGCAGGGCGCAGAGTGGG - Intergenic
1149304327 17:55333805-55333827 CAAGGTCCAGGGAGAAGAGAGGG - Intergenic
1149496620 17:57122373-57122395 TCTGGTGCAGGGAGAAGGGTGGG + Intergenic
1149853016 17:60052641-60052663 AATTGTGAAGGGAAAAGAATAGG + Intronic
1151213141 17:72559734-72559756 CACTGTGCAGAGAGATGCGTGGG - Intergenic
1151806346 17:76407915-76407937 GATGGTGCTGGGAGCAGAGTGGG + Intronic
1152975494 18:213494-213516 CTTTGAGAAGGGAGAGGAGTAGG + Exonic
1154383887 18:13876172-13876194 CATTCTGCTGGGAGAAGGGCTGG - Intergenic
1156485721 18:37464415-37464437 CATTCTGCAGCCAGAACAGTGGG - Intronic
1157725716 18:49962138-49962160 CAGTGTGCTGGAAGAAGCGTTGG - Intronic
1158428509 18:57361550-57361572 CATTGTGCAGTGGCAAGAGTTGG + Exonic
1159005755 18:63008897-63008919 CTGTGTGTAGGGAGAAGAGAGGG - Intergenic
1160534612 18:79585467-79585489 CATGGTGCAGGGTGCAGGGTGGG - Intergenic
1161594624 19:5144764-5144786 TACTCTGCAGGGAGAAGAGGTGG - Exonic
1162115853 19:8428986-8429008 CAGAGTGTAGGGAGAAAAGTGGG + Intronic
1163577717 19:18120384-18120406 CATGGTACAGGGAAAAGTGTGGG + Intronic
1164247000 19:23439600-23439622 CAGTGTGCAGGAAGGAGTGTAGG + Intergenic
1164703917 19:30305249-30305271 GCTTGTGCAGGGGCAAGAGTGGG + Intronic
1165071414 19:33256950-33256972 GAGTGTGCAGTGAGAAGACTGGG - Intergenic
1166231554 19:41427907-41427929 CATTGTGGAGAGGGAAGAGACGG + Intronic
1166561109 19:43732967-43732989 CAGGCAGCAGGGAGAAGAGTGGG + Exonic
1168145557 19:54418646-54418668 CAGTGAGCAGGGAGGAGAGGGGG + Intronic
1168167925 19:54565999-54566021 CAGTGGACAGGGAGAAAAGTAGG + Intergenic
1168228628 19:55014661-55014683 CAGTGTGCAGGGAGGAGGATGGG + Exonic
925670124 2:6302442-6302464 CAGTCTGCAGGAGGAAGAGTGGG + Intergenic
926692212 2:15745279-15745301 CATTGTGCAGGGAAATGGTTTGG - Intergenic
927541768 2:23918511-23918533 CAGTGTGTAGGGAGAGGAGCAGG - Intronic
928633396 2:33216906-33216928 GCTTGAGCAGGCAGAAGAGTAGG - Intronic
928809513 2:35205602-35205624 CTTGGTGCTGGGAGAGGAGTGGG + Intergenic
930126084 2:47797981-47798003 CATTATGAAGGAAGCAGAGTGGG - Intronic
931308715 2:61057890-61057912 GAAAGTGCAGGGAGAAGAGAGGG - Intergenic
931912318 2:66914128-66914150 AATTGTCCAGGGAGGAGAGTGGG + Intergenic
932403773 2:71500247-71500269 CATTGCTCAGGGAGGAGAGGTGG - Intronic
932499209 2:72167513-72167535 CTTTCTGCAGGGAGATGAGGGGG - Intergenic
933588314 2:84203704-84203726 CATTGTGAAGGGAGAATTTTTGG - Intergenic
934588528 2:95526712-95526734 CCTTGTGCTGGGGGAAGAGGCGG + Intergenic
934653551 2:96105609-96105631 CAGTGAGCAGAGAGAAGGGTAGG - Intergenic
937218065 2:120325167-120325189 TGTTGTGCAGGGAGAAGGGCAGG + Intergenic
939165967 2:138641736-138641758 CATTGAGCAGGGAGAGGAGGTGG - Intergenic
940308005 2:152247129-152247151 CACTGTGCAGGGGGTAGGGTGGG - Intergenic
941580812 2:167293601-167293623 CACTTTGCAGCGAGAACAGTGGG + Intergenic
944302017 2:198134347-198134369 CATTGTGGAGGAAGCTGAGTTGG + Intronic
944376574 2:199052101-199052123 CATTTTGCAGGGATTAGAGAGGG + Intergenic
945221727 2:207490457-207490479 CATTGTGAAGGGAGTGGAGAGGG + Intergenic
946003987 2:216507360-216507382 CCTAGAGCAGGGGGAAGAGTAGG + Intronic
946411356 2:219516828-219516850 CATTGTGCAGGGAGAAGAGTCGG + Intronic
946960272 2:224977832-224977854 CTTTGTGCAGAGATAAGATTTGG - Intronic
948034362 2:234846431-234846453 CATTTTGGAGACAGAAGAGTTGG + Intergenic
948061503 2:235045914-235045936 CAGTGTGCAGGGAGATGGGAAGG + Intronic
948313137 2:237004683-237004705 GGCTGTGCAGGGAGAGGAGTCGG + Intergenic
948665403 2:239531666-239531688 CAGTGTGCAGGGGGCAGAGAAGG - Intergenic
1169251408 20:4064042-4064064 AAATGTGAAGGGAGAAGAGGAGG + Intergenic
1170039052 20:12020857-12020879 CCTTCTGCAGGGAGAAGACATGG - Intergenic
1170508163 20:17050245-17050267 CGCTGTGCAGGGAGAGTAGTGGG - Intergenic
1172838562 20:37888327-37888349 CATTGGTCAGGGCTAAGAGTGGG + Intergenic
1173304092 20:41831497-41831519 AATGGGGCAGGGAGAAGACTAGG + Intergenic
1173586923 20:44189393-44189415 GATTGTCCTGGGAGAAGACTTGG + Intergenic
1174453166 20:50631971-50631993 CATCGTGCAGGAAGATGAGGTGG - Intronic
1175312026 20:58018783-58018805 CATGGAGCAGGGAGAAGAGCTGG - Intergenic
1178225433 21:30711652-30711674 TATTGTTGAGGGAGCAGAGTAGG + Intergenic
1179525926 21:41975803-41975825 CAGTCTGCAGGGACCAGAGTGGG - Intergenic
1182831065 22:33304827-33304849 CTTTGTGGAGAGAGAAGTGTAGG - Intronic
1184869121 22:47222359-47222381 CATTGTCCAGTGAGAAGAGGGGG + Intergenic
950267571 3:11586009-11586031 CACTTTGCAGGGGGAAGGGTTGG - Intronic
957107986 3:75915723-75915745 AATGGTGTAGAGAGAAGAGTGGG + Intronic
960057189 3:113284113-113284135 TCTTCTGCAGGGAGAAGGGTGGG - Intronic
961502008 3:127342871-127342893 CAATGTGAAGGGGGAAGAGTAGG + Intergenic
961611587 3:128143949-128143971 CATTTTGCAGGTGGAAGAGATGG + Intronic
963398997 3:144773239-144773261 CACTGAGTATGGAGAAGAGTGGG - Intergenic
963464918 3:145667233-145667255 CATTGAGCAGGGTGAGGAGGAGG + Intergenic
964255757 3:154772711-154772733 CAGCTTTCAGGGAGAAGAGTGGG - Intergenic
965941039 3:174182035-174182057 CATTGTGCAGCAAAATGAGTAGG + Intronic
966679807 3:182629860-182629882 GAGTGTGAAGGCAGAAGAGTTGG + Intergenic
968344955 3:197995092-197995114 CATTGAGCAGGAGGAAGAGGAGG - Intronic
969928027 4:10603618-10603640 AATTGGGCAGGGGGAAAAGTGGG + Intronic
970597397 4:17612952-17612974 TATTGTGCAGAGAGAAGAGCTGG - Intergenic
970870034 4:20805573-20805595 CATTCAGCATAGAGAAGAGTTGG + Intronic
971056493 4:22919229-22919251 CATAGTGGAGGGTGGAGAGTGGG - Intergenic
971232776 4:24813393-24813415 TATTGGGCAAGGAGAAGAGTGGG - Intronic
971381603 4:26103644-26103666 CTGTGTGCAGAGAGAAGAGGTGG - Intergenic
971703197 4:30007252-30007274 CCTGTTGCAGGGAGGAGAGTGGG + Intergenic
972285907 4:37648117-37648139 CATTGTCCAGGTAAATGAGTAGG - Intronic
972365156 4:38367704-38367726 CAATGACCAGGGAGAAGAGAAGG + Intergenic
972789667 4:42358919-42358941 CATTCTGGAGGGAAAAGTGTAGG + Intergenic
973631733 4:52826137-52826159 CATGGTGCAGGAAGACGGGTAGG + Intergenic
980060569 4:128124655-128124677 GATTGTACAGGGACAAGAGTGGG + Intronic
984368919 4:178835787-178835809 CATTGAGCAGGCTGAGGAGTTGG - Intergenic
986301153 5:6479305-6479327 AACTGTGCAGGGAAAAGAGCTGG + Intronic
986333428 5:6734832-6734854 CCTTGCACAGGGAGAAGAGGGGG - Intronic
986435438 5:7725693-7725715 CTTTGTGCAGAGATATGAGTAGG - Intronic
988088421 5:26502842-26502864 CATATTGGAGGGTGAAGAGTGGG + Intergenic
993681573 5:90884921-90884943 CATTGTACAGGAATGAGAGTAGG - Intronic
995022715 5:107383986-107384008 CATGTTGCAGGAAGAAGAGAAGG - Intronic
996417198 5:123223060-123223082 CAGTGTGCAAGGAGCAGAGGGGG - Intergenic
997727971 5:136138257-136138279 GATTATGCAGTGAGAAGTGTTGG + Intronic
997771822 5:136562123-136562145 CATTGGGTAAGGAGAAGAATTGG + Intergenic
998177591 5:139911432-139911454 CATGGGGCTGGGAGAAGAGCTGG - Intronic
998669489 5:144337796-144337818 CATAGTGAAGGGAGAAGAGTGGG + Intronic
999106359 5:149074817-149074839 CATCTAGCAGGGAGAAGTGTAGG + Intergenic
999232415 5:150069602-150069624 TAGAGTGCAGGGACAAGAGTGGG + Intronic
1000217085 5:159170163-159170185 CATTTTTCAGGAAGAAGAGTGGG - Intronic
1000380114 5:160621344-160621366 CAGTGTGTAGGGAGTAGAGTTGG + Intronic
1000456920 5:161460888-161460910 CATTGTGCAGAGAGCAGAGAAGG + Intronic
1001248590 5:170125593-170125615 CAAAGTGCTTGGAGAAGAGTAGG + Intergenic
1002181867 5:177434881-177434903 CCCTGTGCAGAGAGAAGAGCAGG - Exonic
1004478855 6:15999923-15999945 CATTGTGCTGAAAGAGGAGTGGG + Intergenic
1006445949 6:34079893-34079915 TGTTGTGCAGGGAATAGAGTGGG - Intronic
1007695845 6:43733961-43733983 CAGAGAGAAGGGAGAAGAGTGGG - Intergenic
1008715597 6:54285621-54285643 CAGTGTGCAGGTAGACTAGTTGG - Intergenic
1010325017 6:74554489-74554511 CATAGAGCAGAGAGAAGTGTGGG + Intergenic
1011409687 6:87055089-87055111 CATTATGCAGGGAGGAGAATGGG - Intergenic
1012369497 6:98486053-98486075 GATTGTGAAGGGAGATGAGGAGG - Intergenic
1013731848 6:113177369-113177391 AATTGTGCAGGGATAAAATTTGG + Intergenic
1014248539 6:119093184-119093206 CTTTGTGGAGGGAGTACAGTAGG + Intronic
1014253270 6:119136867-119136889 CATGGTGCTGGGAGAAGTCTGGG + Intronic
1016013589 6:139162775-139162797 CAGTGTGCAGGGATAAGGTTGGG + Intronic
1016174661 6:141065790-141065812 CAGTGTGTTGGAAGAAGAGTAGG + Intergenic
1016531714 6:145065682-145065704 CTCTGTGCAGGGAAAAGAGGAGG + Intergenic
1016925649 6:149344541-149344563 CAGTGTGCATAGAGAATAGTTGG + Intronic
1017499159 6:155007195-155007217 CATCATGCAGGGAAAAGAGACGG - Intronic
1017893150 6:158655906-158655928 CATTGGGCAGAAGGAAGAGTGGG + Intronic
1019049727 6:169173746-169173768 CACTGTGCAGGGAGAAGACGTGG - Intergenic
1019304261 7:325416-325438 CATCGTGGAAGGAGAAGGGTGGG - Intergenic
1019849207 7:3537827-3537849 CAGTGTTCAGGAAGCAGAGTTGG + Intronic
1020988269 7:15163419-15163441 CATATTGGATGGAGAAGAGTTGG - Intergenic
1022746538 7:33178488-33178510 CACGGTGCAGGGAGAGAAGTTGG - Intronic
1023214631 7:37848666-37848688 CATTGTGTGGGCAGAAGAGGTGG + Exonic
1024397885 7:48889932-48889954 CCTTGTGCAGGGGGAGGAGCTGG + Intergenic
1024516787 7:50266177-50266199 CTTGGGGCAGGAAGAAGAGTTGG - Intergenic
1026491011 7:70863476-70863498 CAGGGAGCAGGGAGAAGAGAAGG + Intergenic
1026504978 7:70974643-70974665 CAGAGTGCAGTGAGAAGAGACGG + Intergenic
1028240786 7:88418189-88418211 CACTGAGGCGGGAGAAGAGTAGG - Intergenic
1028278643 7:88892691-88892713 CATTTTGGAGGGAGATGAGAGGG - Intronic
1029996571 7:105013388-105013410 CAATGTGCGGGGAGGGGAGTGGG - Intergenic
1030681353 7:112437703-112437725 CATTCTGCAGGGATGAAAGTGGG + Intronic
1030838969 7:114324145-114324167 CATTGTACTGGGAGAATAGGAGG - Intronic
1032154255 7:129455239-129455261 CATTATGCATGGAGAAGCCTAGG - Exonic
1032931192 7:136673530-136673552 TATTGTGCAATGTGAAGAGTGGG + Intergenic
1034432041 7:151045930-151045952 CACTGTGCAGGGAGAAAGGAGGG - Intronic
1034530831 7:151695512-151695534 CATTGTGCAGGAAGCTGTGTTGG + Intronic
1035343429 7:158180337-158180359 CATGGTACTGGTAGAAGAGTAGG - Intronic
1035793178 8:2326215-2326237 CACTGGGCAGGGAGAGGAGGTGG + Intergenic
1035799626 8:2395490-2395512 CACTGGGCAGGGAGAGGAGGTGG - Intergenic
1035817137 8:2553482-2553504 CATTTTGGAGGGTGGAGAGTGGG - Intergenic
1036567261 8:9948212-9948234 AATTGTCCAAGGAGAAGAGCAGG - Intergenic
1038193371 8:25344154-25344176 TATTCTGCTGGGAGAGGAGTGGG + Intronic
1038473388 8:27844148-27844170 CATTCTCCAGGGAGGAGAGAGGG - Intergenic
1038767037 8:30438331-30438353 CATTGTACAGGGAGGACAGAAGG - Intronic
1038974993 8:32685440-32685462 GAGTGTGGAGGGAAAAGAGTTGG - Intronic
1041415427 8:57602772-57602794 TACTGTGAAGGGAGAAGAGAGGG + Intergenic
1041464172 8:58142494-58142516 GTTTGTGCAGGGAGAACAGGTGG - Intronic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1044847850 8:96399353-96399375 CCTTAGGCAGGGAGAAAAGTGGG + Intergenic
1046164542 8:110414725-110414747 CATTGTCCAGTGACAAGAGAAGG - Intergenic
1047313890 8:123714827-123714849 CATTATGCATAGGGAAGAGTGGG + Intronic
1048646353 8:136425581-136425603 GAGTGTGCAGGGAGAAGAGCTGG - Intergenic
1048869710 8:138787145-138787167 GATGGGTCAGGGAGAAGAGTGGG + Intronic
1049593578 8:143473428-143473450 CCTAGTGCAGGGAGAGGCGTGGG - Intronic
1049651027 8:143769871-143769893 AATTCTGCAGGGAAAACAGTAGG - Intergenic
1049809510 8:144558697-144558719 CTTTTTGCAGGGAGCAGAGTAGG - Intronic
1050361967 9:4838626-4838648 CATTGGGGAAGGGGAAGAGTGGG + Intronic
1051497330 9:17737977-17737999 CATAGTTGAGAGAGAAGAGTAGG - Intronic
1051650854 9:19322789-19322811 TTTTGTGCAGGGAGCAGAGAGGG - Intronic
1052296268 9:26899011-26899033 CACTCTGTAGGGAGAATAGTGGG - Intergenic
1054852388 9:69861358-69861380 CCTTCTGCAGGGTGAAGAGTGGG + Intronic
1056187741 9:84152355-84152377 CAATTTGCAGGAAGAAGAGGAGG + Intergenic
1056606483 9:88089922-88089944 GACTGTGCAGGGAGAGGACTGGG + Intergenic
1056797132 9:89666385-89666407 CAATGTGCAGGGAGCAGGGCTGG + Intergenic
1057183014 9:93039970-93039992 GAGTGTGCAGGAAGAAGGGTGGG + Intergenic
1057958460 9:99431955-99431977 CAGTGAACAGGCAGAAGAGTCGG + Intergenic
1058506022 9:105667019-105667041 CATTGTGGAGGGTGAAGGGAAGG - Intergenic
1058565725 9:106283054-106283076 GAGTGTGCAGGGGGAAGGGTAGG + Intergenic
1058647874 9:107147353-107147375 CATTGTGCAGGGCCCAGAGCGGG + Intergenic
1059250267 9:112881954-112881976 GATGGAGAAGGGAGAAGAGTGGG + Intronic
1060101228 9:120842747-120842769 CGTTAAGCAGGGAGAAGAGCGGG + Exonic
1060707368 9:125816292-125816314 CATTGAGAAGGGGGAAGAGCCGG - Intronic
1186939166 X:14485918-14485940 CATGGGGCAGGGAGAAGAGCAGG - Intergenic
1186963547 X:14762810-14762832 CCTGATACAGGGAGAAGAGTTGG - Intergenic
1188580034 X:31700366-31700388 CAATGTGTATGGAGAGGAGTTGG + Intronic
1188615335 X:32151304-32151326 CTTTTTCCAGGGACAAGAGTGGG + Intronic
1188874529 X:35413802-35413824 CATTGTGAATGGAGCAGATTTGG - Intergenic
1190450161 X:50571448-50571470 CAGTGTGCAGGCAAAAGAGGTGG + Intergenic
1191218615 X:57960682-57960704 TGTTGTGCAGGGATATGAGTGGG + Intergenic
1192226343 X:69230800-69230822 CAGTGTGAAGGCAGTAGAGTGGG - Intergenic
1194822102 X:98522605-98522627 CAGGGTGCAGGGAGAAGGCTTGG + Intergenic
1195432323 X:104803222-104803244 TATAGTTCAGGCAGAAGAGTTGG - Intronic
1198379122 X:136067696-136067718 CATGGTGCAGAGAGAGGAGCTGG + Intergenic
1199845604 X:151690812-151690834 AAATGTGGAGGGACAAGAGTAGG - Intergenic
1201622836 Y:15979604-15979626 CATTGTACTGGGACAAGAGGAGG + Intergenic
1201769884 Y:17609692-17609714 TATTGTTCAGGGATAGGAGTGGG - Intergenic
1201831670 Y:18296295-18296317 TATTGTTCAGGGATAGGAGTGGG + Intergenic