ID: 946411481

View in Genome Browser
Species Human (GRCh38)
Location 2:219517325-219517347
Sequence GCCCTCTGGTACCCTGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 384}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946411466_946411481 25 Left 946411466 2:219517277-219517299 CCGGAATCCTGGGGATGGCCTGG 0: 1
1: 0
2: 0
3: 26
4: 250
Right 946411481 2:219517325-219517347 GCCCTCTGGTACCCTGGGGCTGG 0: 1
1: 0
2: 1
3: 35
4: 384
946411469_946411481 18 Left 946411469 2:219517284-219517306 CCTGGGGATGGCCTGGAGGAGTG 0: 1
1: 0
2: 3
3: 28
4: 322
Right 946411481 2:219517325-219517347 GCCCTCTGGTACCCTGGGGCTGG 0: 1
1: 0
2: 1
3: 35
4: 384
946411473_946411481 7 Left 946411473 2:219517295-219517317 CCTGGAGGAGTGTGGGTGGATTT 0: 1
1: 0
2: 0
3: 10
4: 167
Right 946411481 2:219517325-219517347 GCCCTCTGGTACCCTGGGGCTGG 0: 1
1: 0
2: 1
3: 35
4: 384
946411465_946411481 26 Left 946411465 2:219517276-219517298 CCCGGAATCCTGGGGATGGCCTG 0: 1
1: 0
2: 0
3: 22
4: 233
Right 946411481 2:219517325-219517347 GCCCTCTGGTACCCTGGGGCTGG 0: 1
1: 0
2: 1
3: 35
4: 384
946411464_946411481 27 Left 946411464 2:219517275-219517297 CCCCGGAATCCTGGGGATGGCCT 0: 1
1: 0
2: 0
3: 9
4: 128
Right 946411481 2:219517325-219517347 GCCCTCTGGTACCCTGGGGCTGG 0: 1
1: 0
2: 1
3: 35
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946411481 Original CRISPR GCCCTCTGGTACCCTGGGGC TGG Intronic
900009877 1:96384-96406 GCCCTCTGCTCACCTGGGACAGG + Intergenic
900025989 1:272968-272990 GCCCTCTGCTCACCTGGGACAGG + Intergenic
900035773 1:406825-406847 GCCCTCTGCTCACCTGGGACAGG + Intergenic
900057395 1:642575-642597 GCCCTCTGCTCACCTGGGACAGG + Intergenic
900090208 1:916998-917020 GTCCTCTGGAACCCGTGGGCAGG - Intergenic
900198402 1:1389564-1389586 GCACTCTGGGACGCTGAGGCAGG + Intronic
900639768 1:3683050-3683072 GCTGTCTGGTTCCCTGGGGCAGG - Exonic
900928729 1:5722339-5722361 GCACTCTGGGAGGCTGGGGCGGG - Intergenic
901452071 1:9341946-9341968 GCACTTTGGGACCCTGAGGCGGG - Intronic
901692883 1:10985195-10985217 GCACTCTGGAAGCCTGAGGCAGG - Intergenic
901851115 1:12016338-12016360 GCACTCTGGGAGGCTGGGGCAGG - Intergenic
902363860 1:15958306-15958328 GCCCTGTGCTCCCCTGGTGCAGG - Intronic
902420063 1:16271890-16271912 GCCCTCTGGGAGGCTGAGGCGGG + Intronic
902608719 1:17584289-17584311 GCACTTTGGGAGCCTGGGGCAGG - Intronic
903703764 1:25269985-25270007 GACATCTGGTGCCCTCGGGCAGG + Intronic
904175531 1:28625924-28625946 GCACTCTGGTAGGCTGAGGCAGG - Intronic
905022607 1:34828200-34828222 GGCCTTAGGTGCCCTGGGGCAGG - Intronic
907407706 1:54263748-54263770 CCCCACAGGTACCTTGGGGCAGG + Intronic
908207140 1:61862107-61862129 GCACTCTGGGAGGCTGGGGCAGG - Intronic
910535941 1:88297622-88297644 GCTTTATGGGACCCTGGGGCTGG + Intergenic
914711320 1:150216233-150216255 GCCCTTTGGGAGCCTGAGGCGGG - Intergenic
915536576 1:156539825-156539847 GTCCTCTGCTAACCTGGAGCAGG + Exonic
915605147 1:156945723-156945745 TCCCTCTGGTTGCATGGGGCTGG - Intronic
917064188 1:171073896-171073918 GCCCTCTGGGAGGCTGAGGCAGG + Intergenic
920052695 1:203173220-203173242 GCTCCCTGGTTCCCTGGGGAAGG + Intronic
920283999 1:204866535-204866557 GCCCTACAGCACCCTGGGGCTGG + Intronic
922583114 1:226713212-226713234 GCCGTCTGGGAACCGGGGGCGGG - Intronic
924339503 1:243015155-243015177 GCCCTCTGCTCACCTGGGACAGG + Intergenic
924869022 1:248020027-248020049 GCACTCTGGGAGCCTGAGGCAGG - Intronic
1063154629 10:3367715-3367737 GCACTTTGGTAGCCTGAGGCAGG - Intergenic
1063377142 10:5561232-5561254 GGCCTGTGTTACCCTTGGGCAGG - Intergenic
1063473894 10:6311500-6311522 GCACTCTGGGAAGCTGGGGCAGG + Intergenic
1063671470 10:8103179-8103201 TCCCTCTGCCTCCCTGGGGCTGG - Intergenic
1064432666 10:15284659-15284681 GCACTCTGGGAGCCTGAGGCGGG - Intronic
1066060860 10:31722460-31722482 ACAATCTGGTGCCCTGGGGCGGG - Intergenic
1066426491 10:35312129-35312151 GCCCTTTGGGACGCTGAGGCAGG + Intronic
1066500676 10:35991382-35991404 GCCCTCTGGGAGGCTGAGGCAGG - Intergenic
1067347585 10:45447662-45447684 TCCTTCTGGTTCCCTGGAGCTGG + Intergenic
1067508766 10:46877931-46877953 TCCCTCTGGGATCCTGGGCCAGG + Intergenic
1067653483 10:48173919-48173941 TCCCTCTGGGATCCTGGGCCAGG - Intronic
1067683465 10:48454269-48454291 GCCCTCTGGTCTGTTGGGGCTGG - Intronic
1068588810 10:58832412-58832434 GCACTCTGGTAGGCTGAGGCAGG + Intergenic
1068726297 10:60306974-60306996 GCTCTCTGGGAGCCTGAGGCGGG - Intronic
1069940001 10:71948825-71948847 AACCTCTGGTTCCCTAGGGCAGG + Intergenic
1070117575 10:73543610-73543632 GCACTTTGGGAGCCTGGGGCGGG - Intronic
1070403929 10:76077921-76077943 GCCCTCTGGTATACTTGGCCTGG + Intronic
1071071948 10:81704772-81704794 GAGCACTGGTACCCTGGGCCTGG - Intergenic
1071553099 10:86582404-86582426 GCACTTTGGAAGCCTGGGGCAGG - Intergenic
1072175354 10:92915293-92915315 GCACTCTGGGAGGCTGGGGCAGG + Intronic
1072721164 10:97781823-97781845 GTCCTCAGGACCCCTGGGGCTGG + Intergenic
1074523830 10:114247873-114247895 GCTCTCTGCCACCATGGGGCAGG + Intronic
1075163095 10:120041871-120041893 GCCCCCTTGCAGCCTGGGGCAGG + Intergenic
1075704805 10:124494308-124494330 TCCCTCAGCTACCCTGGGGCCGG - Intronic
1076738533 10:132469297-132469319 GTCCTCTGGTGCCCCGGGGCAGG - Intergenic
1076740104 10:132478652-132478674 GTCCTCTGGGCCCCAGGGGCAGG - Intergenic
1076865326 10:133163801-133163823 GCCCTCTGAGACCCAGGGACTGG + Intronic
1076909487 10:133379854-133379876 GCCCTGTGGTCCCCCAGGGCAGG - Intronic
1077194047 11:1270500-1270522 TCCCTCTGGAACCCTGGTCCTGG + Intergenic
1077306055 11:1869127-1869149 GCCCACTTGGAGCCTGGGGCAGG - Intronic
1077489602 11:2854651-2854673 TCTCTCAGGTGCCCTGGGGCAGG + Intergenic
1077696039 11:4393555-4393577 GGGCTCTGCAACCCTGGGGCAGG + Intronic
1078217615 11:9324901-9324923 GCCCTTTGGGAGCCTGAGGCGGG + Intergenic
1078315333 11:10289441-10289463 GCCCCCTCGTAGCCTGGAGCAGG + Intronic
1078744160 11:14095605-14095627 GCCTTCTCCTGCCCTGGGGCTGG - Intronic
1078753967 11:14191192-14191214 TGCCTCTGGTGGCCTGGGGCAGG + Intronic
1079137287 11:17783109-17783131 GGCCTCTGGTCCCCTGTGGCTGG + Intergenic
1079716135 11:23748151-23748173 GCCCTTTGGGAGCCTGAGGCGGG + Intergenic
1083176677 11:60954506-60954528 GCCCCCTGGTACCTTGGAGATGG - Intergenic
1083426137 11:62587425-62587447 GCACTTTGGTAGGCTGGGGCGGG - Intronic
1083674776 11:64319186-64319208 GCCCTCAAGTACTCTGGGGATGG + Intronic
1083706138 11:64517696-64517718 GCACTTTGGAAGCCTGGGGCAGG + Intergenic
1083957795 11:65995547-65995569 GCCCTCTGGGAGGCTGAGGCGGG + Intergenic
1084181513 11:67449055-67449077 GCACTTTGGGACCCTGAGGCAGG - Intergenic
1085383538 11:76141941-76141963 GGACTGTGGTACCCGGGGGCAGG - Exonic
1086670619 11:89542055-89542077 GCCCTCTGGGAGGCTGAGGCAGG - Intergenic
1089707079 11:120286129-120286151 GCCCTCTGGTAGGCCGAGGCAGG - Intronic
1089817559 11:121189885-121189907 ACACTCTTCTACCCTGGGGCAGG + Intronic
1089822674 11:121242009-121242031 GGCCTCTGGTTCCATGGAGCAGG - Intergenic
1089922784 11:122226709-122226731 GCACTGTGGTATCCTGGAGCTGG - Intergenic
1090213307 11:124938320-124938342 TTCCTCTGCTACCCTGGGGGCGG + Intergenic
1090840995 11:130487392-130487414 GCCGGCTGCTACCCCGGGGCAGG + Intergenic
1091263015 11:134248797-134248819 GCCCACTCTTACCCTGGGTCAGG + Exonic
1093457760 12:19381279-19381301 GACCTCTGGAGCCTTGGGGCAGG + Intergenic
1094323046 12:29206448-29206470 GCCCTGTGGTACCATGGGGCAGG - Intronic
1095169766 12:39020245-39020267 GCCCTCTGGGAGCCAGGGCCTGG - Intergenic
1096801109 12:54111148-54111170 GCACTTTGGAAGCCTGGGGCAGG - Intergenic
1096842273 12:54386686-54386708 AGCCTCTGGTGCTCTGGGGCAGG - Intronic
1097039145 12:56144061-56144083 TCCTTCTGGGCCCCTGGGGCGGG + Intronic
1097897835 12:64843239-64843261 GCACTCTGGGAGGCTGGGGCGGG - Intronic
1098301090 12:69054966-69054988 TGGCTCTGGTACCCTAGGGCAGG - Intergenic
1098465828 12:70784351-70784373 GCCCCCTGGCAGCCTGGGGTGGG + Intronic
1100588496 12:96001341-96001363 GGTCTCTGGGACCCTGTGGCAGG - Intronic
1102128051 12:110501817-110501839 GGCCTCTGGCCCCTTGGGGCCGG + Intronic
1102290828 12:111698242-111698264 GCACTTTGGAACCCTGAGGCAGG - Intronic
1102959898 12:117085556-117085578 GCCCCTTGGTGTCCTGGGGCTGG - Intronic
1103173412 12:118841900-118841922 TCCCTCTGCTGGCCTGGGGCTGG - Intergenic
1103533699 12:121620303-121620325 CCCCTCTAGGATCCTGGGGCAGG + Intergenic
1103723237 12:122985790-122985812 TCCCTCTGCCATCCTGGGGCTGG + Exonic
1104175969 12:126333052-126333074 GCCCTTAGGGACCCTGGCGCTGG + Intergenic
1104599488 12:130142825-130142847 ACCCTCAGCTACCCTGGGCCGGG + Intergenic
1104860463 12:131920856-131920878 GCACTCTGTTGTCCTGGGGCCGG + Intronic
1104974997 12:132548343-132548365 GCCCTCTGCTGCCCAGGAGCTGG - Intronic
1106366645 13:29087810-29087832 GCACTCTGGTAGGCTGAGGCAGG + Intronic
1106476984 13:30107540-30107562 GCCCTCTGCTGCCCTGGGAAGGG - Intergenic
1107465663 13:40647649-40647671 GCACTCTGGGACGCTGAGGCTGG - Intronic
1107705648 13:43101272-43101294 GCACTCTGGGAGGCTGGGGCAGG - Intronic
1107853271 13:44591426-44591448 GCCCCCTCGAAGCCTGGGGCAGG - Intergenic
1107964399 13:45586440-45586462 TCACTCTGGGACCCTGGGGGTGG - Intronic
1112560122 13:100505616-100505638 GCACTCTGGGAACCTGGGGCGGG + Intronic
1112771516 13:102799406-102799428 GCCTCCTGTTACCCTGGGGCCGG - Exonic
1113439101 13:110314016-110314038 GCAGCCTGGTATCCTGGGGCGGG + Intronic
1114401833 14:22417328-22417350 GCCCTGTAGTTCCCTGGGTCTGG + Intergenic
1117136519 14:52739886-52739908 GCCCTTTGGAAGGCTGGGGCAGG - Intronic
1118760953 14:68879897-68879919 GCCCTCCAGGGCCCTGGGGCAGG + Intronic
1119030063 14:71185227-71185249 GCCCTTTGGGACGCTGAGGCGGG - Intergenic
1119349232 14:73950388-73950410 GCCCGCTGGTGTCCTGGCGCAGG + Exonic
1120711550 14:87798207-87798229 GCACTCTGGTACCATGAAGCTGG + Intergenic
1121446571 14:93982642-93982664 GCTCTCTGGTGCCCTTTGGCTGG + Intergenic
1122157014 14:99755889-99755911 GCCCTGTGCTACCCTGGGCCAGG - Intronic
1122791300 14:104185250-104185272 GCCCCCAGGCACCGTGGGGCGGG - Intergenic
1122988317 14:105223620-105223642 GCTCACTGGTGGCCTGGGGCAGG + Intronic
1123549813 15:21368830-21368852 GTCCTCTGGTGCCCTAGGTCGGG - Intergenic
1123931280 15:25172876-25172898 GTGCTCTGGTTCCCTGGAGCAGG + Intergenic
1123931709 15:25175166-25175188 GCACTCTGGTTCCCTGGGGTGGG + Intergenic
1123934963 15:25189667-25189689 GCATTCTGGTTCCCTGGGGGTGG + Intergenic
1123936768 15:25197828-25197850 GCACTCTGGTTCCCTGTGGTAGG + Intergenic
1123940392 15:25213900-25213922 GCACTCTGGTTCCCTGGGCCAGG + Intergenic
1123942332 15:25222601-25222623 GTGCTCTGGTACCCTGGGGATGG + Intergenic
1123947861 15:25247598-25247620 GGGCTCTGGTTCCCTGGGGGTGG + Intergenic
1125019481 15:34970358-34970380 GCACTTTGGGACCCTGAGGCAGG - Intergenic
1125539137 15:40459648-40459670 GCCCTCAGGAAGCATGGGGCAGG - Exonic
1125610967 15:40969949-40969971 GCCCTCTGGCACCCTTGTGTAGG + Intergenic
1125887368 15:43238742-43238764 GCTCTCTGGCTCCCTGGGGTAGG + Intronic
1127116426 15:55732429-55732451 GCACTCTGGAAGCCTGAGGCAGG - Intronic
1127501760 15:59560282-59560304 GCACTCTGGAACGCTGAGGCAGG - Intergenic
1127785342 15:62350565-62350587 GCCCTTTGCTCCCCTGCGGCAGG + Intergenic
1128138516 15:65282253-65282275 GCCCTCTGGGAGGCTGGGGCGGG - Intronic
1128281532 15:66398538-66398560 GCCCTTTGGGAGGCTGGGGCAGG + Intronic
1128504533 15:68257199-68257221 GCACGCGGGTACTCTGGGGCTGG - Intronic
1128528896 15:68431155-68431177 GCCCTAGGGTACCCTGGCCCCGG - Intronic
1130094357 15:80844867-80844889 GCCCATGGGCACCCTGGGGCTGG - Intronic
1130560156 15:84951710-84951732 GTTCTCTGGTAACATGGGGCTGG + Intergenic
1130979824 15:88804609-88804631 GCCCTTTCCAACCCTGGGGCTGG + Intronic
1131971224 15:97894858-97894880 GCACTCTGGTAGGCTGAGGCAGG + Intergenic
1132609879 16:810344-810366 CCCCTCTGGTTCCCTGAGGAGGG + Intronic
1133167487 16:3958293-3958315 GCACTCTGGTAGCCTGAGGCGGG + Intronic
1133449698 16:5893558-5893580 GCCCTTTGGTAGGCTGAGGCGGG + Intergenic
1133649283 16:7795462-7795484 GCCCTCTGGGAGGCTGAGGCAGG + Intergenic
1133975304 16:10596163-10596185 CACCCCTGGTTCCCTGGGGCTGG + Intergenic
1134131646 16:11654363-11654385 GCCCACTGCTCCCCTGGGGTGGG + Intergenic
1134753056 16:16641747-16641769 GCACTTTGGTAGCCTGAGGCAGG - Intergenic
1134877538 16:17715420-17715442 GCCCTCTGGGAGGCTGAGGCAGG - Intergenic
1134993001 16:18717329-18717351 GCACTTTGGTAGCCTGAGGCAGG + Intergenic
1136318420 16:29467066-29467088 GCCCTCTTGGACCCCGGGACCGG - Exonic
1136432995 16:30206415-30206437 GCCCTCTTGGACCCCGGGACCGG - Exonic
1136668865 16:31838082-31838104 GCACTTTGGGAGCCTGGGGCGGG + Intergenic
1137279776 16:46965975-46965997 GCCCTTTGGGAGGCTGGGGCAGG + Intronic
1137510291 16:49093756-49093778 TCTCTCTGGTTTCCTGGGGCTGG - Intergenic
1138192861 16:55030866-55030888 GCTCTCTGGTTCCCAGGGTCTGG - Intergenic
1138202976 16:55103824-55103846 GCCCTCGGGTCATCTGGGGCTGG + Intergenic
1138348640 16:56334952-56334974 GCCCGCAGGTTCCCTGGGGCAGG - Intronic
1138462315 16:57157690-57157712 GCCCTCTGGGAGGCTGAGGCGGG - Intronic
1139098490 16:63735003-63735025 GCACTCTGGGAGGCTGGGGCAGG - Intergenic
1139649277 16:68354129-68354151 GCACTCTGGGAACCTGAGGCTGG + Intronic
1141202434 16:81908314-81908336 GTTATCTGGTACCCTGGGTCAGG + Intronic
1141644371 16:85359355-85359377 GGACTCTGGTTTCCTGGGGCAGG - Exonic
1141644910 16:85362099-85362121 GCCATGAGGAACCCTGGGGCTGG + Intergenic
1141838926 16:86561549-86561571 GCCCTCTGCTAAGCTGGGGTTGG + Intergenic
1142022288 16:87791434-87791456 GCCCTCTGTTCCCCTGGCCCAGG + Intergenic
1142251848 16:88995582-88995604 GCCCTCTTCTTCCCAGGGGCTGG - Intergenic
1142454453 16:90210520-90210542 GCCCTCTGCTCACCTGGGACAGG - Intergenic
1143307590 17:5959851-5959873 GGCTGCTGGTACCCTGGGGTGGG + Intronic
1143559441 17:7683955-7683977 GCACTTTGGTACGCTGAGGCAGG - Intronic
1143627853 17:8121502-8121524 TCCCTCTGCTGCCCTCGGGCTGG + Exonic
1143814978 17:9505692-9505714 GCCCTCTGGGAGGCTGAGGCGGG + Intronic
1144149403 17:12428798-12428820 GTCCTCTGGTCCCCTGTGGAAGG - Intergenic
1144664190 17:17091012-17091034 GCCCTGTGTTCCCCTGTGGCCGG - Intronic
1145247659 17:21280161-21280183 GCCCTCTGGTGACCAGGGCCCGG - Intergenic
1145263726 17:21369497-21369519 GGCCTCTGGCCCTCTGGGGCAGG - Intergenic
1146143386 17:30388708-30388730 GCCCCCTGGGAGCCTGTGGCGGG + Intronic
1147653072 17:42072867-42072889 GCCCTCAGGTACGCTGGGCCTGG - Intergenic
1147806852 17:43137938-43137960 GCCCTTTGGGAGGCTGGGGCGGG + Intergenic
1148374218 17:47127645-47127667 GCCCTTTGGGAGGCTGGGGCGGG - Intronic
1148736706 17:49869259-49869281 GCCCTCTGGGCTCCTGGGCCTGG + Intergenic
1151191797 17:72404116-72404138 GCCCTTTGGTTCCCTGGGACAGG + Intergenic
1151554824 17:74841503-74841525 GGGCTCTGGAATCCTGGGGCAGG - Intergenic
1151732538 17:75919992-75920014 GCACACAGGTACCCTGGCGCTGG - Exonic
1152235546 17:79136486-79136508 GAGGTCTGGTAGCCTGGGGCCGG - Intronic
1152265048 17:79289241-79289263 GCCATCTGGAGCCCTGTGGCTGG + Intronic
1152540538 17:80972197-80972219 GCCCTGTGCTGCCCTGGGGCTGG - Intergenic
1152758435 17:82096828-82096850 GCCCCCTGGTGCCCTAGGGATGG - Intronic
1153708178 18:7768890-7768912 GCACTCTGGGAGGCTGGGGCGGG - Intronic
1153893588 18:9539853-9539875 GCCTTCTGGTACCCAGGCTCTGG - Intergenic
1156687371 18:39666436-39666458 GCCCTTTGGGACACCGGGGCAGG - Intergenic
1158277413 18:55782979-55783001 GCACTCTGGGAGGCTGGGGCAGG - Intergenic
1159389623 18:67772908-67772930 GCTTTCTGGAACCCTGGTGCTGG - Intergenic
1159600895 18:70427682-70427704 GCCCTCTGGGAGGCTGGGACAGG + Intergenic
1160739679 19:680105-680127 GCCCTCGGGTTCCCAGGGGCAGG - Intronic
1161308644 19:3581370-3581392 GCCCTTTGGGAGGCTGGGGCAGG - Intergenic
1162032961 19:7925243-7925265 GCCCTCTGAGACCCCGGCGCAGG + Exonic
1162122308 19:8478804-8478826 GCCCTCTGGCTCCCTAGGCCTGG + Intronic
1162424859 19:10588686-10588708 GCCCTTTGGGACGCTGAGGCGGG - Intergenic
1162517735 19:11159404-11159426 GCACTCTGGTAGGCTGAGGCAGG + Intergenic
1162984864 19:14263219-14263241 GCACTCTGGGAGCCTGAGGCAGG + Intergenic
1163462644 19:17448277-17448299 GTCCTCTGGCAGCCCGGGGCCGG + Exonic
1165076730 19:33283488-33283510 GACCCCTGGTAGCCTGAGGCCGG + Intergenic
1165926932 19:39332412-39332434 GCCCTTTGGGAGCCTGAGGCGGG - Intronic
1166845996 19:45728887-45728909 GCACTTTGGGACGCTGGGGCGGG + Intronic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
926055392 2:9771294-9771316 CCCGTCTGGGACCCTGGGGTGGG - Intergenic
926109665 2:10173812-10173834 GCCCTCTGGAGCCCTTGGCCTGG + Intronic
926120852 2:10240573-10240595 GCCCTCTGCTTCCCTGAGGTAGG - Intergenic
926958747 2:18331638-18331660 GCACTTTGGTACCCTGAGGTGGG - Intronic
927791291 2:26011805-26011827 GCCCTCTGGGAGGCTGAGGCAGG - Intergenic
927902297 2:26829284-26829306 ACCCTCTGGCATCCTGGGGCAGG - Intergenic
927958053 2:27222305-27222327 GACCTCTGGTACCAGGGGGCGGG - Exonic
929427646 2:41860193-41860215 GCACTTTGGGACCCTGAGGCAGG + Intergenic
929459656 2:42093501-42093523 GCACTCTGGGAGCCTGAGGCAGG + Intergenic
930015907 2:46970438-46970460 GCCCTCTGGAGGCTTGGGGCTGG + Intronic
931221816 2:60295341-60295363 GCCCTCTGGTAGGCAGGGTCGGG + Intergenic
933307540 2:80620438-80620460 CCTCTTTAGTACCCTGGGGCTGG + Intronic
933798185 2:85937851-85937873 GCCCTTTGGGACACTGAGGCAGG + Intergenic
934552196 2:95269352-95269374 GTGCTCTGGTTCCCTGTGGCAGG - Intergenic
936080102 2:109427213-109427235 GCACTTTGGTAGCCTGAGGCAGG - Intronic
939248731 2:139659794-139659816 GCACTTTGGTAGGCTGGGGCTGG + Intergenic
939959596 2:148554632-148554654 GCCACATGGTAGCCTGGGGCAGG - Intergenic
941324180 2:164092705-164092727 GCACTTTGGTACGCTGAGGCAGG + Intergenic
943547665 2:189300938-189300960 GCCCTTTGGGAGGCTGGGGCAGG + Intergenic
944413637 2:199463689-199463711 GCCCGGTGGTACCCTGGGCCAGG - Intronic
945395650 2:209312634-209312656 GCCCTCTGGGAGACTGAGGCAGG + Intergenic
945881994 2:215334440-215334462 GCCCTCTGGGAGGCTGAGGCAGG - Intronic
945915455 2:215699179-215699201 GCACTTTGGGAGCCTGGGGCAGG - Intergenic
946368509 2:219266117-219266139 GCCCTCAGCAACCCTAGGGCAGG + Intronic
946411481 2:219517325-219517347 GCCCTCTGGTACCCTGGGGCTGG + Intronic
947466414 2:230351891-230351913 GCACTCTGGGACGCTGGCGCGGG - Intronic
948466093 2:238152240-238152262 CCCCTCTGGTCCCCAGGGGCGGG - Exonic
948615415 2:239195397-239195419 GCCCTCAGGAGCCCTGGGGTGGG - Intronic
948712273 2:239832734-239832756 GCCTCGTGTTACCCTGGGGCAGG + Intergenic
949085911 2:242155175-242155197 GCCCTCTGCTCACCTGGGACAGG - Intergenic
1169128546 20:3149451-3149473 GCCCACGGGTACCCTGGGTTGGG - Intronic
1169619848 20:7493210-7493232 GCACTCTGGTAGGCTGAGGCAGG + Intergenic
1171457569 20:25280665-25280687 GCCCTGTGGGTCCCTGGGCCGGG + Intronic
1172439856 20:34957734-34957756 GCACTCTGGGAGGCTGGGGCGGG - Intergenic
1172461446 20:35122033-35122055 GCACTCTGGAAGCCTGAGGCAGG - Intronic
1172684752 20:36745585-36745607 GCCCTCTGCTGCTCTGGGGCCGG + Intronic
1172790134 20:37498103-37498125 GCCCTCTCATACCCTCTGGCTGG + Intronic
1172939698 20:38645936-38645958 GCCCTGTGGGACGCTGGGCCAGG + Intronic
1173269726 20:41522092-41522114 GCACTTTGGTAGGCTGGGGCAGG + Intronic
1173488462 20:43458536-43458558 GCCCTTGGGGACCCTGGGGGCGG + Intronic
1174069056 20:47887326-47887348 TCCCTCAGGTGCACTGGGGCGGG - Intergenic
1174132935 20:48358871-48358893 GCTCTCTTGGGCCCTGGGGCAGG - Intergenic
1175370808 20:58489288-58489310 GCACTCTGGTAGGCTGAGGCAGG + Intronic
1175416623 20:58805404-58805426 CTCCTCAGGCACCCTGGGGCTGG + Intergenic
1175918627 20:62439516-62439538 GCCCACAGGCACCCTGAGGCTGG + Intergenic
1175974428 20:62703274-62703296 ACCCTCTGAGACCCTGGGTCTGG + Intergenic
1176407471 21:6429078-6429100 GCACTCTGGGATGCTGGGGCAGG + Intergenic
1177456952 21:21352366-21352388 GCCCTCTGGGAGTCTGAGGCAGG - Intronic
1179148204 21:38787583-38787605 CCCCTCTGGGCCCCTGGGGGAGG + Intergenic
1179574943 21:42302112-42302134 GGCCTCAGGCACACTGGGGCAGG - Intergenic
1179682975 21:43037481-43037503 GCACTCTGGGATGCTGGGGCAGG + Intergenic
1179886045 21:44314646-44314668 GCCCTCTGGTTCCCTTGGGGTGG + Intronic
1180061294 21:45386306-45386328 GCCCTCTCCCACCCTGGGGTCGG - Intergenic
1180179113 21:46110064-46110086 GTCCTCTCGCAGCCTGGGGCAGG + Intronic
1180190241 21:46159458-46159480 GCCCTCAATCACCCTGGGGCAGG + Intergenic
1180995062 22:19961487-19961509 GTCCTCTGGTGCCCTGAGGCTGG + Intronic
1183333966 22:37236271-37236293 TCCCTCTGGTCCTCTGGGGAGGG - Intronic
1183361403 22:37385010-37385032 GCCCCTTGGGACCCTGGGGGAGG - Intronic
1183490195 22:38111816-38111838 GCCCTCAGGGAGGCTGGGGCTGG + Exonic
1184446551 22:44550858-44550880 GCCCTCCTGAAGCCTGGGGCAGG + Intergenic
1184504132 22:44890948-44890970 GGCCTCTGATACCCCTGGGCTGG - Intronic
1184710978 22:46249400-46249422 GCACTCTGGTAGCCAGAGGCGGG + Intronic
1185079727 22:48702922-48702944 GCCCGCTGGTGCCCTCGGGAGGG + Intronic
1185128440 22:49024524-49024546 GCCCTCGGGTGCCCTGGGGTGGG + Intergenic
950297890 3:11847742-11847764 ACCCTCTAGTGCCCTGTGGCAGG + Intergenic
950425686 3:12923718-12923740 GGCCTCACGTTCCCTGGGGCTGG - Intronic
955701195 3:61683978-61684000 GCCCTACGGTACCATGGAGCTGG - Intronic
955816943 3:62853712-62853734 GCCCTTTGGGAGCCTGAGGCAGG + Intronic
957415024 3:79890577-79890599 GCCCTCTGGAAGGCTGAGGCAGG - Intergenic
961145772 3:124592052-124592074 GCACTCTGGGACGCTGAGGCAGG + Intronic
961712027 3:128835130-128835152 GACCTCGGGTACCCTGTGGGTGG + Intergenic
965528785 3:169749773-169749795 GCACTCTGGTAGACTGAGGCGGG + Intergenic
968010495 3:195271103-195271125 GCCCTCGGGTACCCGGACGCCGG + Exonic
968240460 3:197078063-197078085 GCCCTTTGGTAGGCTGAGGCAGG + Intronic
969400526 4:6952437-6952459 CCCCTCTGGTCCCCTGGGCCAGG + Intronic
969531366 4:7732900-7732922 ACCCTCTGGAGCCATGGGGCTGG - Intronic
970364208 4:15341975-15341997 GCCCTCTGGGGCCCTGGGGTGGG - Intronic
970595104 4:17593043-17593065 GCACTCTGGGAGGCTGGGGCAGG - Intronic
972072461 4:35038530-35038552 GCCCCCTCGCAGCCTGGGGCAGG - Intergenic
972682178 4:41316775-41316797 GCACTCTGGGAGGCTGGGGCAGG + Intergenic
972785372 4:42321589-42321611 GCCCTTTGGGACCCTGGGTTGGG - Intergenic
976167344 4:82269918-82269940 GCCCTCTGGGAGGCTGAGGCAGG + Intergenic
978279045 4:106987688-106987710 GTTCTCTGAAACCCTGGGGCTGG + Intronic
978620717 4:110632651-110632673 ACCCTCTGGCAACCCGGGGCAGG + Intronic
978856282 4:113398248-113398270 GCTCTCTGGACCCCTTGGGCTGG + Intergenic
979237617 4:118420074-118420096 GCCCTCTGCTCACCTGGGACAGG - Intergenic
979297769 4:119052563-119052585 GCCTTCTGGCCCCCTGGGGTTGG - Intronic
979300872 4:119085814-119085836 GCCCTTTGGGAGCCTGAGGCAGG + Intergenic
981093329 4:140755809-140755831 GCCGCCCGGTCCCCTGGGGCTGG - Intronic
981753826 4:148119545-148119567 GCACTTTGGGACCCTGAGGCTGG + Intronic
982159018 4:152548616-152548638 GAGATCTGGTACCCTGGGTCAGG + Intergenic
982710721 4:158756177-158756199 GCACTTTGGGAGCCTGGGGCAGG - Intergenic
983576933 4:169270714-169270736 GCCCTCGGGTCCCCGTGGGCCGG - Intronic
983994824 4:174169166-174169188 GCCCTTTGGGACGCTGAGGCAGG - Intergenic
984459745 4:180018988-180019010 GCACTTTGGGACCCTGAGGCAGG - Intergenic
984962510 4:185111426-185111448 GCCCTCTGCTATCCTGGTCCTGG - Intergenic
987323540 5:16792509-16792531 CCCCTCTGAAACCCTGGGGCAGG - Intronic
987601318 5:20075256-20075278 GCACTCTGGTAGTCTGAGGCGGG + Intronic
988288296 5:29250721-29250743 GCCCTTTGGGAGCCTGAGGCGGG + Intergenic
988561047 5:32281653-32281675 GCACTCTGGGAGGCTGGGGCGGG + Intronic
990403699 5:55466454-55466476 GCACTCTGGGAACCTGAGGCAGG + Intronic
990590107 5:57253868-57253890 GCCCTCTGGGAGGCTGAGGCAGG - Intronic
991061074 5:62376665-62376687 GCCCTCTGGGAGGCTGAGGCGGG - Intronic
991658521 5:68927377-68927399 GCCCTCTGGGGCTCTGGGGGTGG - Intergenic
994731351 5:103495298-103495320 GCACTCTGCTACCCTTGGGAGGG - Intergenic
995663489 5:114512987-114513009 GCACTTTGGAACCCTGAGGCAGG + Intergenic
996422286 5:123276012-123276034 GACCTCTGGTAGCATGGGGGTGG - Intergenic
997129683 5:131264212-131264234 GCCCTCTCGGTCCCTTGGGCGGG + Intronic
997521134 5:134525387-134525409 GCCTGCTGGCACCCTGGGCCCGG - Intronic
998364263 5:141618733-141618755 GCCCTCTGGACCCCTGCAGCCGG - Intronic
998451689 5:142239468-142239490 ACCTCCTGGTACCCTTGGGCAGG + Intergenic
998484434 5:142489261-142489283 GCTCTCTGGGAGCCTGAGGCAGG + Intergenic
998556033 5:143124617-143124639 GCCCTCTTGGAACTTGGGGCTGG - Intronic
999269144 5:150286346-150286368 GCCCTCTGGGAACCTGTGACTGG - Intronic
999313491 5:150568966-150568988 GCTCTCTGGTCCCCTGGCCCAGG + Intergenic
999827924 5:155291974-155291996 TCCCTCTGGGCCCCAGGGGCAGG + Intergenic
1000104617 5:158047425-158047447 GCACTCTGGGAGCCTGAGGCAGG - Intergenic
1001757347 5:174180796-174180818 GCCCACTGGTCCCCAGGGGAGGG + Intronic
1002279511 5:178122275-178122297 GCCCTTCGGGACCTTGGGGCTGG - Exonic
1002738048 5:181412039-181412061 GCCCTCTGCTCACCTGGGACAGG - Intergenic
1003212508 6:4079597-4079619 GGCCTCTGGGACCCGGGGCCCGG + Exonic
1003646181 6:7914639-7914661 GCACTCTGGGAGCCTGAGGCAGG - Intronic
1003948301 6:11094573-11094595 GCCCTCGGGCATCCTGGGGAGGG + Intronic
1004647165 6:17573687-17573709 GCCCTCTGGGGCCTTGGGGTTGG - Intergenic
1004664905 6:17740835-17740857 GCACTCTGCTTCCCTGGGGCTGG - Intergenic
1006514405 6:34538078-34538100 GGCCTTCGGGACCCTGGGGCAGG - Exonic
1006597543 6:35204307-35204329 GCACTCTGGGAGCCTGAGGCAGG - Intergenic
1006761709 6:36467580-36467602 GCACTCTGGGAGGCTGGGGCGGG - Intronic
1012858887 6:104535081-104535103 GTCCTCTGGAATCCTGGGGGAGG - Intergenic
1014126607 6:117783387-117783409 GCTCTCTGTAACCCTTGGGCTGG - Intergenic
1015364843 6:132385855-132385877 GCCCTCTGGGAGGCTGAGGCGGG + Intronic
1015524149 6:134159639-134159661 GTCCCTTGGTACCCGGGGGCAGG - Intergenic
1019243149 6:170687598-170687620 GCCCTCTGCTCACCTGGGACAGG - Intergenic
1019663918 7:2241960-2241982 GCCCTCAGGTCTCCAGGGGCAGG - Intronic
1019748141 7:2712212-2712234 GTCCTCAGTTACCCAGGGGCGGG - Intronic
1019787265 7:2985043-2985065 ACCCTCTGGTAGGCTGGGCCCGG + Intronic
1019945893 7:4328980-4329002 GCCCTCTGAGAGCCTGAGGCGGG + Intergenic
1020010948 7:4805537-4805559 GCCCTCTCCTGCCCTGGGGCAGG + Intronic
1020778209 7:12483621-12483643 GCCCTTTGGAAGCCTGAGGCGGG + Intergenic
1022497120 7:30860197-30860219 GCCTTGTGGTGCCCAGGGGCGGG + Intronic
1022506514 7:30911344-30911366 CCCCTCTGGAGCCCTGGGCCCGG + Intergenic
1023950793 7:44842892-44842914 GCCCTCTGGGAGGCTGAGGCAGG + Intronic
1024443554 7:49450432-49450454 GCACTTTGGGACCCTGAGGCAGG - Intergenic
1024828012 7:53415364-53415386 GCACTCTGGGAGCCTGAGGCGGG + Intergenic
1025210653 7:57018052-57018074 TCCCTCTGCAGCCCTGGGGCTGG - Intergenic
1025661303 7:63558795-63558817 TCCCTCTGCAGCCCTGGGGCTGG + Intergenic
1026778898 7:73250144-73250166 GCCCTCTGGGAGACTGAGGCGGG + Intergenic
1026782018 7:73274624-73274646 GCACTCTGGTAGGCTGAGGCTGG - Intergenic
1026847793 7:73707365-73707387 GCCATGTGGCACCCCGGGGCGGG - Intronic
1026863828 7:73810730-73810752 GCCCTCTCGCTCCCTGGGGTGGG + Intronic
1026994005 7:74604282-74604304 GCACTCTGGGAGGCTGGGGCAGG - Intergenic
1027019759 7:74803552-74803574 GCCCTCTGGGAGACTGAGGCGGG + Intronic
1027065145 7:75117834-75117856 GCACTCTGGTAGGCTGAGGCTGG + Intronic
1027068267 7:75142389-75142411 GCCCTCTGGGAGACTGAGGCGGG - Intronic
1029408102 7:100389960-100389982 GCCCTGTGTGACCCTGAGGCCGG - Exonic
1029498440 7:100911693-100911715 GCCCTCTGGGAAGCTGAGGCTGG + Intergenic
1029611465 7:101628751-101628773 GCCCACGGGTCCCCAGGGGCTGG + Intronic
1029671168 7:102032173-102032195 GCCCTCTGGGAGGCTGAGGCGGG - Intronic
1029701333 7:102248652-102248674 GCCCTCGGGGACCCCGGGCCCGG + Exonic
1030471226 7:109964857-109964879 GCACTCTGGGAGGCTGGGGCAGG - Intergenic
1031923873 7:127620237-127620259 GCCCTCTGGTCCCTTGAGGAAGG - Intergenic
1032122105 7:129164280-129164302 GCCCTCAGGTACCAGTGGGCAGG - Intronic
1034273269 7:149813378-149813400 TCCCTTTGGCCCCCTGGGGCAGG - Intergenic
1034298535 7:149995099-149995121 GCCCTCTGGGAGGCTGAGGCGGG - Intergenic
1034513599 7:151555630-151555652 GCACTCTGGTAGGCTGAGGCAGG + Intergenic
1034528056 7:151678549-151678571 GCCCTCTGGAAGCCCCGGGCTGG + Intronic
1034807480 7:154101679-154101701 GCCCTCTGGGAGGCTGAGGCGGG + Intronic
1035336234 7:158128783-158128805 GCACTCTCCTACCCCGGGGCAGG + Intronic
1035504973 8:120565-120587 GCCCTCTGCTCACCTGGGACAGG + Intergenic
1038321278 8:26529561-26529583 GCCCTTTGGTAGGCTGAGGCAGG - Intronic
1045057518 8:98382414-98382436 GCCTTCTGGGACCCTGGGCTGGG - Intergenic
1046465312 8:114594231-114594253 GCCCTTTGGGAGCCTGAGGCGGG + Intergenic
1047737674 8:127780877-127780899 TCCCTCTGTCACCCAGGGGCTGG + Intergenic
1048205736 8:132413988-132414010 CCGCTCTGGAAACCTGGGGCGGG - Intronic
1048473515 8:134723475-134723497 GCCCGCTGGAACCCAGGGCCAGG + Intergenic
1049193371 8:141301494-141301516 GCACTCTGGGAGCCTGAGGCAGG + Intronic
1049205990 8:141363830-141363852 GCCATCTGCTGCCCTGGGGCCGG - Intronic
1049317892 8:141979332-141979354 GCCCTTGTGTACCCTGGGGTGGG + Intergenic
1049658366 8:143808789-143808811 GCCCTGTGGCTCCCGGGGGCTGG - Exonic
1049843019 8:144786385-144786407 GCACTCTGGGAGGCTGGGGCGGG + Intronic
1051615927 9:19006797-19006819 GCCCTCTGGGAGGCTGAGGCAGG + Intronic
1055769600 9:79703247-79703269 GCCCTTTGTTACCCTGGGTTAGG + Intronic
1056685118 9:88752737-88752759 CCCCTCTTGTCCCCTGGGCCAGG - Intergenic
1057689307 9:97269089-97269111 GCCCTTTGGTAGACTGAGGCAGG - Intergenic
1057711717 9:97451536-97451558 GCACTTTGGGAGCCTGGGGCAGG - Intronic
1057820857 9:98329486-98329508 GTCCTCTTGGACCCTTGGGCTGG + Intronic
1058160431 9:101564483-101564505 GCCCTATGGTCCCCTGGTGCTGG - Intergenic
1060184904 9:121558339-121558361 GCACCCTCGTCCCCTGGGGCTGG + Intergenic
1060877849 9:127096080-127096102 CCCATCTGCTACCCTGGGGTGGG - Intronic
1061849047 9:133403842-133403864 GCGCCCTGGGCCCCTGGGGCTGG + Intronic
1061911273 9:133726459-133726481 GCTCTATGGAACTCTGGGGCTGG - Intronic
1061940834 9:133882981-133883003 GGCCTCTGGCACCCTGGGTTCGG + Intronic
1062109356 9:134773556-134773578 GGCCTCTGGAACCCTGGAGCAGG - Intronic
1062710304 9:137971791-137971813 GCTTTCTGGAACCCAGGGGCTGG - Intronic
1203603338 Un_KI270748v1:36822-36844 GCCCTCTGCTCACCTGGGACAGG - Intergenic
1185470643 X:380537-380559 GCACTCTGGGAGGCTGGGGCGGG + Intronic
1185614954 X:1415185-1415207 GCCCTCTGGGAGGCTGAGGCGGG - Intronic
1186435405 X:9538839-9538861 GCACTCTGGCACCCTGGCACTGG - Intronic
1188111230 X:26197882-26197904 TCCCTGTGGTAACCTGAGGCTGG - Intergenic
1190292235 X:49000739-49000761 GCCCTATAGGACCCTGAGGCTGG + Intronic
1193468862 X:81875980-81876002 GCCCCCTCATAGCCTGGGGCAGG + Intergenic
1194692851 X:97009050-97009072 GCCATCTGGGACCCAGGGCCTGG + Intronic
1197249957 X:124205249-124205271 GCCCTCTGGGAGGCTGAGGCGGG - Intronic
1198150518 X:133903940-133903962 GCCCACAGGTACCCTGGCTCAGG + Intronic
1198195461 X:134356183-134356205 GCACTTTGGCAGCCTGGGGCAGG + Intergenic
1201417523 Y:13762200-13762222 GCACTCTGGGAGGCTGGGGCTGG + Intergenic
1201457533 Y:14186365-14186387 GCCCTCTGGGAGCCCAGGGCAGG + Intergenic
1202018294 Y:20435049-20435071 GCCCTCTTGCAGCCTGGGGCAGG + Intergenic
1202069823 Y:20979347-20979369 GCACTGTGGGACCCTGAGGCAGG - Intergenic
1202115808 Y:21468135-21468157 GGCGTCTGGTAGCCTGGGGCTGG + Intergenic
1202385407 Y:24321877-24321899 GCCCTCTGCTCACCTGGGACAGG - Intergenic
1202485379 Y:25348251-25348273 GCCCTCTGCTCACCTGGGACAGG + Intergenic