ID: 946411734

View in Genome Browser
Species Human (GRCh38)
Location 2:219518587-219518609
Sequence CTGTCTACAAGGCTGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 311}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946411734 Original CRISPR CTGTCTACAAGGCTGGGGGT GGG (reversed) Intronic
900477132 1:2881361-2881383 CTGTCTAGAGGGGTGGGGGCAGG + Intergenic
900607315 1:3529664-3529686 GTGTCTACCAGGCTGGGAGGTGG + Intronic
900991211 1:6099239-6099261 CTGCCAGCAAGGGTGGGGGTGGG - Exonic
903761261 1:25700473-25700495 CTCTCTACCAGGCTGGGAGCTGG + Intronic
904928894 1:34070692-34070714 TGGTCTGCAAGGGTGGGGGTGGG - Intronic
905307128 1:37027552-37027574 CTGTGCACAGGGCTGGGTGTAGG - Intronic
905357122 1:37392382-37392404 CTTTCTATAGGGCTTGGGGTGGG - Intergenic
905532723 1:38694868-38694890 CTGTCTACAAGCCAGGAGATAGG - Intergenic
906146586 1:43564187-43564209 CTGCCTGGAAGCCTGGGGGTGGG + Intronic
906273790 1:44501195-44501217 TTTTCTACATTGCTGGGGGTGGG + Intronic
906324972 1:44839820-44839842 GAGTCTGCAGGGCTGGGGGTAGG + Intronic
906722970 1:48022785-48022807 GTGTCTACAAGCCCAGGGGTTGG + Intergenic
907287156 1:53389345-53389367 CTGGATCCCAGGCTGGGGGTGGG + Intergenic
907871376 1:58446521-58446543 CAGTCAAAAGGGCTGGGGGTGGG + Intronic
907901654 1:58746967-58746989 GTGTTTACAAGGATGTGGGTGGG - Intergenic
908130277 1:61068290-61068312 CTGTCATCCAGGCTGGGGATCGG + Intronic
909701948 1:78534989-78535011 CTCTTTCCAAGGCTGGGGTTAGG + Intronic
909729319 1:78873667-78873689 CTGTAAACAAGACTGGGTGTGGG - Intergenic
910849013 1:91632814-91632836 CTCTCTGCAAGGCTGGGTGATGG + Intergenic
911761190 1:101619213-101619235 CTGTCCACAAGCCTGGGGTCTGG + Intergenic
913533395 1:119749021-119749043 CTGGAGCCAAGGCTGGGGGTAGG + Intronic
917107656 1:171509595-171509617 CTGTATACAAATCTGGGGGCAGG - Intronic
917512212 1:175678122-175678144 TTGTGTACCAGGCTGGGGCTGGG - Intronic
917718877 1:177766203-177766225 CTGTCTTCTATGCTGGTGGTGGG - Intergenic
918918583 1:190674718-190674740 CTGCTTCCAAGGCTGGGAGTTGG + Intergenic
919065770 1:192691420-192691442 CTGTATATAAAACTGGGGGTTGG - Intergenic
919083262 1:192891517-192891539 AGGTCTTGAAGGCTGGGGGTTGG - Intergenic
920180259 1:204128043-204128065 CTGGCCACATGGCTGGGGTTGGG + Intergenic
920412413 1:205772818-205772840 TTGTCTCCAAGACTGGGGGTGGG + Intronic
920444307 1:206003771-206003793 CTTCCTACCAGGCTGGTGGTAGG - Intergenic
921325823 1:213985565-213985587 CTGCCGCCGAGGCTGGGGGTGGG + Intronic
922064263 1:222121386-222121408 CTGTTTACAAGTCTGTAGGTGGG + Intergenic
922561250 1:226571192-226571214 CTGTCTCCCAGGCTGGAGGACGG - Intronic
923016858 1:230133481-230133503 CTGTCGACCAGGCTGGAGGCTGG + Intronic
923081593 1:230661964-230661986 CTATCTCCAAGGGTGGGGGTAGG - Intronic
923709857 1:236378496-236378518 GTGTCTCCAATTCTGGGGGTAGG + Intronic
924665300 1:246064757-246064779 CGGTCTAGAAGGCCGGGGGATGG - Intronic
924771583 1:247085174-247085196 CTGTGTGCCAGGCTGGAGGTGGG - Intergenic
1063382451 10:5594344-5594366 CTGTCTGCAAGGCAGAGGGAGGG - Intergenic
1063414023 10:5858605-5858627 CTCACTACAATGCTGGGAGTGGG - Intergenic
1063662110 10:8042108-8042130 AGGGCTACAAGGCTGGTGGTAGG + Intergenic
1066398245 10:35047866-35047888 CTGTCTACTAGGCTGGAGTGCGG - Intronic
1067469074 10:46523306-46523328 CTGTTCACAGGGGTGGGGGTGGG - Intergenic
1067698435 10:48551963-48551985 CTGGCTGAAAGGCTGGGGGTGGG + Intronic
1069559951 10:69422386-69422408 CTCTCTGCAAGGCTGGGTCTTGG - Intergenic
1069603497 10:69724856-69724878 CTGTCCACAAGAATGGTGGTGGG + Intergenic
1070381870 10:75888173-75888195 GTGGCTACAGGGCTGGGGCTGGG - Intronic
1072719854 10:97773543-97773565 CTATCTGCAAGGCATGGGGTAGG + Intergenic
1073347663 10:102796442-102796464 CTGTCTACAGGGCTAGAGGCTGG - Intronic
1073814979 10:107196518-107196540 CTGTCTACAAGGCAGGAAGCAGG + Intergenic
1074376232 10:112942970-112942992 CTGTCAACAAGGCTGGAGTGCGG - Intergenic
1074611391 10:115025442-115025464 CTGGCTGCAGGGGTGGGGGTTGG - Intergenic
1075227371 10:120641839-120641861 CTGTCTGCAAGGCCTGGGTTGGG + Intergenic
1075763278 10:124872655-124872677 CTGTCAACAAAGCTGGGACTTGG + Intergenic
1076285201 10:129288916-129288938 CTGTCTCAAAGCCTGAGGGTTGG - Intergenic
1076662882 10:132067258-132067280 CCTTCTCCAAGGCTGAGGGTGGG + Intergenic
1076769964 10:132657483-132657505 CAGACTACAGAGCTGGGGGTGGG - Intronic
1076771622 10:132669214-132669236 CTGTCTCCAAGGCTGGAGTGCGG - Intronic
1078016198 11:7617245-7617267 CTGGCTGCAGGGCTGGGGCTCGG - Intronic
1078559901 11:12362375-12362397 CTGTTTTCAAGGCTGGGGAAGGG + Intergenic
1078582214 11:12547346-12547368 CAGTCTACAAGGCTGGGTTCTGG - Intergenic
1080683627 11:34497676-34497698 CTTTCCACAAGGCAAGGGGTCGG - Intronic
1081454400 11:43206940-43206962 CTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1081805649 11:45888727-45888749 CTGTCGCCCAGGCTGGAGGTTGG + Intronic
1082093178 11:48105973-48105995 CTGTTTTCAAGGGTGAGGGTGGG - Intronic
1083738432 11:64694850-64694872 CTGGCTCCTGGGCTGGGGGTGGG - Intronic
1083923440 11:65792485-65792507 GTGCCCACAGGGCTGGGGGTGGG - Intronic
1084208543 11:67610330-67610352 CTGACTCCTGGGCTGGGGGTGGG + Intronic
1087002871 11:93439018-93439040 CTGTCAACAAGCCTGGAAGTGGG - Intergenic
1088322533 11:108568514-108568536 CTGTGACCAAGACTGGGGGTTGG - Intronic
1090226742 11:125076354-125076376 ATGTCTAAAATGATGGGGGTAGG - Intronic
1091770054 12:3145700-3145722 CTGTCCAGATGGCTGGGGGAAGG + Intronic
1093027461 12:14258053-14258075 CTGTCTGCAATGTTGGGGGAGGG + Intergenic
1094058020 12:26286135-26286157 GTCTCTAGCAGGCTGGGGGTTGG + Intronic
1094446171 12:30532966-30532988 CTGTCTACAAGGCTGATGCACGG + Intergenic
1096237702 12:49940857-49940879 CTGTCTTCAAGGCAGGTGGCAGG + Intergenic
1096412024 12:51383910-51383932 CTTTCTCCAAGGCTGGTGGAGGG - Intronic
1096984509 12:55747378-55747400 CTTTCTCCCAGGGTGGGGGTGGG + Intronic
1097724397 12:63058334-63058356 ATGTCTAAAAGGCTGGTGGGAGG + Intergenic
1098334554 12:69389516-69389538 CTGTCTTAATGGGTGGGGGTGGG - Intronic
1098468940 12:70822113-70822135 CTGTATACAAGGCATGGTGTTGG + Intronic
1099025469 12:77459688-77459710 CTGTGGACGAGGCTGGGGGAGGG + Intergenic
1100860743 12:98803697-98803719 CTGGGAACAGGGCTGGGGGTGGG + Intronic
1101857731 12:108457875-108457897 CTGCCTTCTGGGCTGGGGGTGGG - Intergenic
1102927039 12:116834153-116834175 CTGTCTCCCAGGCTGGAGTTCGG + Intronic
1103804263 12:123560184-123560206 CTGTCTCCCAGGCTGGGGTGTGG + Intergenic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1105940104 13:25140401-25140423 CTGGCCACAAGGCTGGGGATGGG + Intergenic
1106118356 13:26836955-26836977 CTGTCTACAAGGCAAGGGAGAGG - Intergenic
1106187108 13:27419252-27419274 CTTTCCACATGGCTGGGGGGTGG + Intergenic
1106865015 13:33954666-33954688 CTGTCTACAAACCAGGAGGTGGG - Intronic
1111503306 13:89154063-89154085 CTGTCTCCCAGGCTGGGGTGCGG - Intergenic
1111644602 13:91015421-91015443 CTGTCACCCAGGCTGGGGTTTGG - Intergenic
1112062702 13:95756851-95756873 CTGTGCACAGGGCTGGGGTTGGG + Intronic
1112570761 13:100590830-100590852 GTGTCAGCAAGTCTGGGGGTGGG + Intergenic
1112837449 13:103533424-103533446 CTCTCTCCAAGGCTGGGGTTAGG + Intergenic
1113062894 13:106343023-106343045 CTGTCTCCGAGGCTGGACGTAGG - Intergenic
1114130413 14:19785523-19785545 CTGTTTTCAAGACTGGTGGTGGG + Intronic
1115807494 14:37068087-37068109 CTGTGTTCAAGTCCGGGGGTTGG - Intronic
1116612444 14:47093062-47093084 CTATCTATCAGGCTGGGGTTGGG + Intronic
1117312464 14:54541695-54541717 ATGACTGCAAGGCTGGGAGTTGG + Intergenic
1119126270 14:72130054-72130076 CTGACTACAAATGTGGGGGTTGG + Intronic
1120526743 14:85585134-85585156 CTACCTACAAGGTTGGAGGTGGG + Intronic
1121369485 14:93344015-93344037 CTGTCTCCTGGGGTGGGGGTGGG + Intronic
1122055766 14:99097271-99097293 CTGTCTAGAAGGTTGAGGGAGGG + Intergenic
1122153498 14:99737217-99737239 CTGTCTCCAAGGCTGCAGGAAGG - Intergenic
1122214616 14:100194614-100194636 CTGTCTTCAAGGTTGGAGGCTGG + Intergenic
1122556972 14:102585738-102585760 CTGGCTGCAAGGCTGGAGTTAGG + Intergenic
1122774546 14:104111491-104111513 CTGTATGCCAGCCTGGGGGTGGG - Exonic
1123704583 15:22941724-22941746 CTGTGTGCAAAGCTGGGGGAAGG - Intronic
1123798585 15:23798249-23798271 CTATTTTCAAGGCTGGGGCTGGG + Intergenic
1124023018 15:25941105-25941127 CTGTCTACAAGCCAGGGAGAAGG - Intergenic
1124876398 15:33599016-33599038 CTGTCTCCCAGGCTGGAGTTCGG - Intronic
1125973104 15:43928283-43928305 CTTTCTCCAAGGCTGGGGTGGGG + Intronic
1128467891 15:67928154-67928176 CTGCCGAGAGGGCTGGGGGTGGG + Intergenic
1128471927 15:67961730-67961752 CTGTCTTCCATGCTGGGGGATGG + Intergenic
1128542230 15:68544088-68544110 CTGTCTACAGAGCTTGGGGAAGG - Intergenic
1128997341 15:72306662-72306684 CAGTGTACCAGGCTGTGGGTGGG + Intronic
1129061946 15:72867353-72867375 TTGTTTCCAAGGGTGGGGGTGGG - Intergenic
1129754198 15:78086433-78086455 CTTTCTACATGGCTGCTGGTTGG - Intronic
1132547173 16:538666-538688 CTGTCCCCAAGGCTGTGGGGAGG + Intronic
1132840705 16:1977337-1977359 ATGTCTGCAAGGTGGGGGGTAGG - Exonic
1134003860 16:10804297-10804319 CTGTTTTCAGGGCTGGGGTTGGG + Intronic
1134327053 16:13216911-13216933 TTGTTTCCAAGGCTGGGCGTGGG - Intronic
1134680596 16:16122274-16122296 CTTTCTGCAAGGCCGGGGTTTGG - Intronic
1135988625 16:27203421-27203443 CTGTTTAAAAGGCCGGGGGATGG - Intergenic
1136145858 16:28316283-28316305 CTGTCCATAAGGTAGGGGGTGGG - Intronic
1136617220 16:31405677-31405699 CTGTCTCCCAGGCTGGGGTGCGG + Intronic
1138531343 16:57636010-57636032 CGATCTAGCAGGCTGGGGGTGGG - Intronic
1138728538 16:59167911-59167933 CTGTCAATAAGACTGTGGGTGGG + Intergenic
1139207818 16:65046220-65046242 CTGTCTATATGGCTGGTTGTCGG + Intronic
1142051337 16:87960050-87960072 CTGTCTCCCAGGGTGGGGGTAGG - Intronic
1142380672 16:89730264-89730286 CTGGGAACAAGCCTGGGGGTAGG - Intronic
1143881994 17:10036860-10036882 TTGTCCACAGGCCTGGGGGTGGG - Intronic
1145239399 17:21231264-21231286 CTGTCTCCCAGGCTGGAGGATGG - Intergenic
1145300167 17:21628949-21628971 CTGTCGCCCAGGCTGGAGGTTGG + Intergenic
1145350116 17:22074303-22074325 CTGTCGCCCAGGCTGGAGGTTGG - Intergenic
1146521019 17:33525595-33525617 ATGTCTGCAAGGCAGGAGGTAGG - Intronic
1147563093 17:41520863-41520885 CAGCCAGCAAGGCTGGGGGTGGG + Exonic
1148461217 17:47840092-47840114 CTGTGAACCAGGCTGGGGGAGGG + Intronic
1148749125 17:49934704-49934726 CTGTGCCCAAGGCTGGGGGTGGG + Intergenic
1150494198 17:65594704-65594726 GTGTCATGAAGGCTGGGGGTTGG + Intronic
1151174612 17:72276859-72276881 CTGTCTTCAAGGCTGGCCTTTGG - Intergenic
1151530731 17:74703197-74703219 CTGTGTGCAGGGCTGCGGGTGGG - Intronic
1151995201 17:77603949-77603971 CAGACTACAGGGGTGGGGGTGGG + Intergenic
1152016447 17:77754011-77754033 ATGGCTTCAGGGCTGGGGGTGGG - Intergenic
1152753256 17:82076201-82076223 CTGTCTCCCAGGCTGGAGTTCGG - Intergenic
1155225683 18:23727360-23727382 CTGTCTCCCAGGCTGGAGGGCGG + Intronic
1157125622 18:44953050-44953072 CTGTGTCCAATGCTGGGCGTCGG - Exonic
1157795780 18:50573631-50573653 CTGTGTACAGGGCTGGGTATGGG - Intronic
1158241536 18:55384137-55384159 CTGCCTAGAAGTCTGAGGGTTGG + Intronic
1159282507 18:66305017-66305039 CTGTTAACAGGGCTGGAGGTAGG - Intergenic
1160318415 18:77868689-77868711 CTGACTACAAGGCTGGGGGAAGG + Intergenic
1160823283 19:1067941-1067963 GTGTCTACAAAGCTGGGGGGGGG + Intronic
1161249710 19:3273938-3273960 GTGGCTGCCAGGCTGGGGGTTGG + Intronic
1161260837 19:3337009-3337031 CTGCCAACAGGGCTGGGGGTGGG + Intergenic
1161781914 19:6298521-6298543 CTCTCTGCAAGGCTGCGGCTTGG - Intergenic
1162389384 19:10380253-10380275 CTGTCTTCAAAGCTGGGTCTGGG - Intronic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162967808 19:14164265-14164287 CTGTGCACAGGGGTGGGGGTGGG + Intronic
1163287562 19:16358002-16358024 CTGTCCTCAAGGCTGGTGGAGGG - Intronic
1163719943 19:18894217-18894239 CTGGCTCCAAGGCAGGGGTTGGG + Intronic
1164137465 19:22427660-22427682 GTGGCTGCCAGGCTGGGGGTGGG + Intronic
1165507523 19:36243734-36243756 ATGTCACCCAGGCTGGGGGTGGG + Intronic
925870663 2:8267134-8267156 CTGTCTTCAAGTCTGAGGGAGGG + Intergenic
926232699 2:11016966-11016988 CTGTCTCCACGGCTCTGGGTGGG - Intergenic
927379965 2:22468008-22468030 CTGTCAAAAAGGCTGGGTGGGGG + Intergenic
927416752 2:22888239-22888261 CTGTCTAAAAGGCTTGGGTCAGG - Intergenic
927911150 2:26900867-26900889 CTGTCTACCAGCCTCGCGGTGGG + Intronic
927945130 2:27131018-27131040 CTGGCCACAAGGCTGAGGGGAGG + Exonic
930533837 2:52622699-52622721 CTGAATACAAGGCAGTGGGTAGG - Intergenic
932711152 2:74064434-74064456 CTGTCTCCCAGGCTGGAGTTCGG + Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933018518 2:77162254-77162276 GTGGCAGCAAGGCTGGGGGTGGG + Intronic
934560466 2:95310538-95310560 CTGTGGTCAAGGGTGGGGGTGGG + Intronic
935734941 2:106098994-106099016 CTGTGTACAAGGCTGGGCTTTGG + Intronic
936650263 2:114417857-114417879 GTATCTTCAATGCTGGGGGTGGG - Intergenic
937231148 2:120398883-120398905 CTGCCAGCTAGGCTGGGGGTGGG - Intergenic
937511286 2:122598335-122598357 CTGTCTAGAAGGTAGGGGGTGGG - Intergenic
937976100 2:127582960-127582982 CTGTGATGAAGGCTGGGGGTCGG + Intronic
938961829 2:136351054-136351076 CTGACTACAAGTATGGGTGTGGG + Intergenic
939001069 2:136735287-136735309 CTATCTAGAAGTATGGGGGTGGG + Intergenic
942521787 2:176811756-176811778 CTGTTTACAAGGATTGGGTTGGG + Intergenic
942620445 2:177839372-177839394 CTGGCTACAAAGCAGGGGATAGG - Intronic
946411734 2:219518587-219518609 CTGTCTACAAGGCTGGGGGTGGG - Intronic
947546115 2:231011584-231011606 CTGTCCTCAAGGGTGGGGGTGGG - Intronic
948498369 2:238370573-238370595 ATGTACACTAGGCTGGGGGTGGG - Intronic
1168962247 20:1877493-1877515 CTGTGTACCAGGCTAGGGGCGGG - Intergenic
1169281166 20:4268060-4268082 CTGTCTACAAGTCAGGAGGCAGG - Intergenic
1169788949 20:9389304-9389326 CTGGTTACAAGGCCGGGGGAAGG - Intronic
1171560386 20:26119304-26119326 CTGTCGCCCAGGCTGGAGGTTGG - Intergenic
1173341692 20:42158009-42158031 AAGTCTCCAAGGCTGGGGGCTGG - Intronic
1174494003 20:50926061-50926083 CTGTCTCCCAGGCTGGGGTGCGG - Intronic
1174548083 20:51341612-51341634 CTTTCTACAAGACTAGAGGTCGG + Intergenic
1175280548 20:57801294-57801316 CTGTTTACAAAGCAGGGGGCGGG + Intergenic
1175497293 20:59423739-59423761 TTGTCTACGAGACTGGGGGAGGG - Intergenic
1175775635 20:61651841-61651863 CTGTCTTTGAGGCTGTGGGTGGG + Intronic
1175936652 20:62517340-62517362 CGGTCTAGAAGGTCGGGGGTCGG - Intergenic
1176650782 21:9545097-9545119 CTGTCACCCAGGCTGGAGGTTGG + Intergenic
1179644434 21:42766966-42766988 CAGTGTGTAAGGCTGGGGGTGGG - Intronic
1180147237 21:45928349-45928371 CTGGCTGCAAGGCCAGGGGTTGG + Intronic
1180728603 22:17964347-17964369 CTGTGTACATGGCTGGGAGACGG - Intronic
1181592115 22:23891932-23891954 CTGGCTCCAGGGTTGGGGGTTGG - Intronic
1181911257 22:26239974-26239996 CCCTCAACAAGGCTGGGGCTGGG + Intronic
1182578983 22:31292419-31292441 CTGACTGCAAGGCTGGGACTGGG - Exonic
1182740175 22:32561827-32561849 CTGCCTCCAAGGCTTGGGGGAGG + Intronic
1182844372 22:33418397-33418419 CTGGATACTAGGATGGGGGTGGG + Intronic
1184045852 22:41971781-41971803 CTGGGTACAAGGCTGCTGGTGGG - Intergenic
1184120139 22:42444671-42444693 CTGTCAGGAAGGCTGGGGGAGGG - Intergenic
949310220 3:2689196-2689218 CTGTGTACAATGCTAGGGGTTGG - Intronic
949394239 3:3597689-3597711 CTGTCTCCCAGGCTGGAGGGCGG - Intergenic
949430515 3:3970758-3970780 CTGTCCTCAAAGCTGGGTGTGGG + Intronic
949555815 3:5151718-5151740 CTATCTCCAAGGGGGGGGGTGGG - Intronic
952481220 3:33763684-33763706 AAGTCTACAAGGGTGGGGATGGG + Intergenic
952688719 3:36178790-36178812 CTGTCTGCAAGCAAGGGGGTTGG - Intergenic
953329821 3:42043501-42043523 CTGCTCACAGGGCTGGGGGTAGG - Intronic
954249896 3:49359096-49359118 CTCTCTCCAGGGCTGGGGGTAGG - Intergenic
954643772 3:52118167-52118189 CATGCTACAAGGCTGGGGGAAGG - Intronic
954934470 3:54313746-54313768 AGGACGACAAGGCTGGGGGTGGG - Intronic
956519992 3:70093618-70093640 CTGGATACAAGGGTGGGGTTTGG + Intergenic
957391475 3:79577873-79577895 CTGTCTTCCAGGCTGGAGGGCGG - Intronic
957667626 3:83254054-83254076 CTGTCTCCCAGGCTGGAGGAGGG - Intergenic
959592774 3:108098023-108098045 CTGTTTACAAGGTTGTGAGTGGG + Intergenic
961044535 3:123699627-123699649 CTGTCTACAGGCTTGGAGGTGGG - Intronic
961097702 3:124172035-124172057 CTGGCTACATGGCTTTGGGTAGG + Intronic
962437504 3:135380526-135380548 CCATCAACAAGGCTAGGGGTGGG - Intergenic
967824833 3:193869759-193869781 GTGTCTGCAGGGCTGGGGGCGGG - Intergenic
968130960 3:196192569-196192591 CTGTCCACCAGGCTGGAGGCGGG - Intergenic
968945529 4:3661573-3661595 CTGAGGACAAGGCTGGTGGTGGG - Intergenic
969933822 4:10661018-10661040 CTGACTACACAGCTGGGTGTAGG + Intronic
971217861 4:24678120-24678142 ATGTCTACAGGGCTGGGGTGGGG - Intergenic
972274124 4:37541276-37541298 CTCCCAACAAGGTTGGGGGTGGG - Intronic
973636173 4:52863186-52863208 CTGTTTTCCAGGCAGGGGGTGGG + Intronic
974320741 4:60346092-60346114 ACTTATACAAGGCTGGGGGTTGG - Intergenic
974956353 4:68645945-68645967 ATGGCAACAAGGCTGGGGGAGGG - Intronic
977628246 4:99212634-99212656 CATTTTAAAAGGCTGGGGGTGGG - Intronic
984041132 4:174735226-174735248 GTGTCAACAAGCCTGTGGGTAGG + Intronic
985814619 5:2117392-2117414 CTGTCTGCAAACCTGGGGGAAGG - Intergenic
987287857 5:16476747-16476769 CTGTCAATAGGGTTGGGGGTGGG + Intronic
987916426 5:24220705-24220727 CTGGCTACAAGGCTGAGTCTGGG + Intergenic
992177793 5:74167439-74167461 CTGAATAAAAGGCTGAGGGTGGG + Intergenic
992314395 5:75537260-75537282 CAGTCTAGAAGCATGGGGGTGGG + Intronic
992366833 5:76100947-76100969 ACGTCCCCAAGGCTGGGGGTTGG + Intronic
994016741 5:94975452-94975474 CTGTCTACAAGCCAGGAGGCAGG + Intronic
998686496 5:144533202-144533224 GTGTCTATAAAGGTGGGGGTGGG - Intergenic
1000482659 5:161798503-161798525 GTGTCTACAAGTCTGATGGTAGG - Intergenic
1002410376 5:179070012-179070034 CGGTCTGCAAAACTGGGGGTTGG - Intronic
1002429894 5:179197215-179197237 CTGTCTACAAGGAGTGCGGTGGG + Intronic
1002502917 5:179658725-179658747 CTGCCAGCAAGGCTGGGGGAGGG - Intergenic
1002603975 5:180371128-180371150 CTGGCTGCAAGGATGGGTGTTGG + Intergenic
1004608092 6:17212762-17212784 ATGACTTCCAGGCTGGGGGTGGG - Intergenic
1006143739 6:31946062-31946084 TTGTATAAAAGGCTGGGGGCTGG + Exonic
1006801540 6:36763045-36763067 ATGTGTGCAAGGCTGGGGCTGGG - Intronic
1006809570 6:36811155-36811177 GGGGCTAGAAGGCTGGGGGTGGG - Intronic
1007036063 6:38674854-38674876 CTGTCTACAAGTCAGGAAGTGGG + Intergenic
1007479895 6:42142765-42142787 CCGTCTCCCAGGCTGGGCGTGGG - Intergenic
1007738583 6:43997578-43997600 CTTTGGACTAGGCTGGGGGTGGG - Intergenic
1009975744 6:70668423-70668445 CCCTCCACAGGGCTGGGGGTAGG + Intronic
1010222274 6:73458247-73458269 CTGTCTAGAAGGCTGTGGACAGG - Intergenic
1011833794 6:91404906-91404928 AAGTCTACAAGGCTCTGGGTTGG - Intergenic
1013481139 6:110553805-110553827 CTGTGTAGAAGGATGGGGCTGGG - Intergenic
1014028264 6:116673151-116673173 CTGCCTCCAAGGCAGGAGGTTGG + Intergenic
1015286728 6:131493673-131493695 CTGTCTGCAAAGGTGGGAGTTGG + Intergenic
1019335406 7:480402-480424 CTCTCTCCTAAGCTGGGGGTGGG - Intergenic
1019359297 7:596490-596512 CTCTCAGCAGGGCTGGGGGTGGG - Intronic
1019514807 7:1434951-1434973 CTGTCACCAAGGCTGAGGGGGGG + Intronic
1019629614 7:2041355-2041377 CTGTCTCCTAGTCTGGGGCTGGG + Intronic
1019709465 7:2511681-2511703 CTGAAGACAAGGCTGGGGCTGGG - Intergenic
1020103981 7:5412537-5412559 CTGTCTCCCAGGCTGGGGTGCGG - Intronic
1021792305 7:24217865-24217887 GTGACTCCAAGGCTGGGGGCTGG - Intergenic
1021841159 7:24722949-24722971 CTGTCTCCAAGGCTAGGATTCGG + Intronic
1022501170 7:30883220-30883242 CTGCCTTCATGGTTGGGGGTGGG + Intronic
1025277455 7:57596047-57596069 CTGTCGCCCAGGCTGGAGGTTGG + Intergenic
1026448711 7:70508260-70508282 CTGTCAAAAAGGAGGGGGGTAGG + Intronic
1027415765 7:77972927-77972949 CTGTCACCCAGGCTGGAGGTTGG + Intergenic
1029926739 7:104327334-104327356 CTGGTTTCATGGCTGGGGGTGGG + Intergenic
1030653284 7:112138884-112138906 CTGTCTACAAGCCAGGAAGTGGG + Intronic
1032077827 7:128844406-128844428 TTGTCTCCAAGGCAGGTGGTGGG - Intronic
1032806765 7:135362950-135362972 CTGTCTGAAAGCCTGGGGGTGGG + Exonic
1034879851 7:154755247-154755269 CTGTCTATAAGGCCCAGGGTCGG - Intronic
1034919997 7:155071711-155071733 TTTTCTACAAGTGTGGGGGTGGG - Intronic
1035250613 7:157594552-157594574 CTCTCTGCCAGGCTCGGGGTTGG + Intronic
1035488921 7:159254994-159255016 ATTTCAACAAGGCTGTGGGTGGG + Intergenic
1035566145 8:642813-642835 ATGTCTACAGGACTGGGGGCTGG + Intronic
1035716037 8:1755613-1755635 CTGCCCAGAGGGCTGGGGGTTGG + Intergenic
1037322317 8:17655692-17655714 CTGTCTCCCAGGCTGGAGGCTGG - Intronic
1037837165 8:22221151-22221173 ATGTCCACCAGGCTGGGTGTGGG + Exonic
1037996223 8:23354276-23354298 CTGTCTGCAAGGTTGTGGGCTGG - Intronic
1039444543 8:37620698-37620720 GTGTCTTGATGGCTGGGGGTGGG - Intergenic
1041131752 8:54709233-54709255 CTGTCAACAAGGCTGGTTCTTGG - Intergenic
1041748783 8:61236912-61236934 CTGCCTACAATGCTGGTGGATGG + Intronic
1042311069 8:67379926-67379948 CTGTCTCCCAGGCTGGAGGGCGG + Intergenic
1042373249 8:68017276-68017298 CTTCTTAAAAGGCTGGGGGTGGG + Intronic
1043606153 8:82003025-82003047 CTGTCTCCCAGGCTGGAGGCTGG + Intergenic
1043911908 8:85873963-85873985 GTGGCAACAAGGCTGGGGGAGGG - Intergenic
1045395172 8:101753635-101753657 CAGTCTGCAAGGGTAGGGGTGGG + Intronic
1046522356 8:115341909-115341931 CTGTCTCCCAGGCTGGAGGCTGG + Intergenic
1049347910 8:142148534-142148556 TTGCTTCCAAGGCTGGGGGTGGG + Intergenic
1049387910 8:142353608-142353630 CTCTCTGCAGGGCTGGGGGTGGG + Intronic
1049624375 8:143613494-143613516 CTGGCTCCAGTGCTGGGGGTTGG - Intronic
1049676371 8:143891085-143891107 CTGGCTGCACAGCTGGGGGTCGG - Intergenic
1049840835 8:144770628-144770650 CTGTCTCCCACACTGGGGGTTGG - Intergenic
1051381568 9:16464055-16464077 CTGTCTCCTAGGCTGGAGTTCGG - Intronic
1053284826 9:36843354-36843376 CTATTTGCAAGGCTGTGGGTTGG + Intronic
1054931596 9:70641050-70641072 ATGTCTGGAAGGATGGGGGTGGG - Intronic
1055967850 9:81882717-81882739 CTGTTTACAAAGATGTGGGTGGG - Intergenic
1057131063 9:92655050-92655072 CTGTCTCCAGTGCTGGGTGTGGG - Intronic
1057186557 9:93060354-93060376 CTGTCCACAAGCTTGGGGGCAGG - Intronic
1057508469 9:95656975-95656997 CTGTCACCAAGGCTGGGGTGTGG + Intergenic
1058138547 9:101334395-101334417 CTGTTGAAAAGGCTAGGGGTTGG - Intergenic
1059100790 9:111469886-111469908 CTGTAAAAAAGGCTGGGGATGGG - Intronic
1059583795 9:115583070-115583092 CTGTTGACGAGGCAGGGGGTTGG - Intergenic
1060162654 9:121380128-121380150 TTTTCTACATGGCTGGGGTTTGG - Intergenic
1061003632 9:127916452-127916474 CTGTCTCCAGGGCTGGGGCTGGG + Exonic
1061313062 9:129776786-129776808 CTGGCTCCAGGGGTGGGGGTGGG - Intergenic
1061339030 9:129963908-129963930 CTGTGAAAAAGGCTGGGGCTGGG - Intronic
1061963559 9:134000272-134000294 CTGTCTAGCAGGGTAGGGGTGGG - Intergenic
1062401721 9:136375732-136375754 CTCTCTTGCAGGCTGGGGGTGGG + Exonic
1062474290 9:136719753-136719775 CTGTCTGCCAGGCTGGGGCTGGG - Intronic
1203628517 Un_KI270750v1:48647-48669 CTGTCACCCAGGCTGGAGGTTGG + Intergenic
1188171968 X:26938589-26938611 CTGTTTGGAGGGCTGGGGGTGGG + Intergenic
1189244239 X:39550916-39550938 CTGTCTGCCAGACTGGGTGTTGG - Intergenic
1191080430 X:56504681-56504703 AAGTCTACCAGGCTGGGGGCTGG - Intergenic
1191932016 X:66383970-66383992 ATGTCTACATGGCTGGGGAAAGG - Intergenic
1192332681 X:70190459-70190481 CAGTCAACAAGCCTGGGTGTGGG - Intronic
1194116826 X:89910988-89911010 CTGTCTCCCAGGCTGGAGGGCGG + Intergenic
1195706077 X:107738824-107738846 ATGGCAACAAGGGTGGGGGTGGG - Intronic
1195875612 X:109537187-109537209 CTGCTAACCAGGCTGGGGGTGGG - Intronic
1196117811 X:112016129-112016151 TTCTCTACAAAGATGGGGGTGGG + Intronic
1199953924 X:152727448-152727470 GTGTCTCAAAGGTTGGGGGTAGG - Intergenic
1200469621 Y:3568156-3568178 CTGTCTCCCAGGCTGGAGGGCGG + Intergenic
1200751977 Y:6954381-6954403 GTGGCTGCAAGGCTGGGGGAGGG - Intronic