ID: 946412889

View in Genome Browser
Species Human (GRCh38)
Location 2:219523883-219523905
Sequence GCTGCAGGGAGCCACCGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 1, 2: 2, 3: 35, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946412889_946412899 30 Left 946412889 2:219523883-219523905 CCATCACGGTGGCTCCCTGCAGC 0: 1
1: 1
2: 2
3: 35
4: 251
Right 946412899 2:219523936-219523958 ACCTCAGCCTCCTGAGTAGCTGG 0: 12610
1: 113153
2: 218440
3: 237917
4: 144947

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946412889 Original CRISPR GCTGCAGGGAGCCACCGTGA TGG (reversed) Intronic
900149137 1:1170673-1170695 GCTGAAGGGAGCTACCGAGGGGG + Intergenic
900274942 1:1819015-1819037 GCTGCAGGTAGGCACTGTGAAGG + Intronic
900625526 1:3606863-3606885 GCTGAGGGCAGCCACTGTGAAGG + Intronic
900764417 1:4494499-4494521 GCTGCAGGGGGCCTGCGTGGGGG - Intergenic
901482979 1:9539003-9539025 GCAGGCGTGAGCCACCGTGAGGG + Intergenic
901689432 1:10963056-10963078 GCTGCAGTGAGCCTGCGTGACGG + Intronic
902076343 1:13789930-13789952 GCTTCAGGCAGCCTCAGTGAAGG + Intronic
902169764 1:14599907-14599929 GCTGCAGGGAGCCCGTTTGAAGG + Intronic
902203489 1:14851206-14851228 ACTGCAGGGACCCACCTAGATGG - Intronic
903256948 1:22108813-22108835 GCTGCAGGGAACCACTGAGAAGG + Intergenic
903742370 1:25565716-25565738 GCTGCAGGGGGCCACAAGGATGG - Intronic
905693620 1:39959983-39960005 TCTGCCAGGAGCCACCCTGAAGG - Intronic
906201634 1:43964165-43964187 CCTGCAGGGAGACAGCGTGGGGG - Intronic
906457338 1:46008405-46008427 GCTGTAGGCAGCCACCCGGAGGG - Intronic
906493512 1:46286319-46286341 GCTGCAGGGTGCAACCGAGCTGG - Exonic
906564761 1:46790995-46791017 GCTGCAGGGGGCCATGGAGAGGG - Intronic
907239932 1:53075754-53075776 GTTGCAGGGAGACACAGTGAAGG + Intronic
907274439 1:53309558-53309580 GATCCAGAGAGCCACGGTGAGGG + Intronic
908235129 1:62141005-62141027 ACTGCAGGGAGACAGCCTGAGGG - Intronic
909677791 1:78257356-78257378 GCAGCAGGTAGCCACAGTGATGG - Intergenic
912335498 1:108858688-108858710 GCAGAAGGGAGACACTGTGATGG + Intronic
919880144 1:201895638-201895660 GCTGCAGGCAGAGACCGTGGAGG + Intergenic
920055445 1:203187455-203187477 GCTGCAGTGAGGCACCATGGAGG + Intergenic
921308108 1:213817181-213817203 GCTGGAGGGAGCCACTGCCAGGG - Intergenic
922571200 1:226635609-226635631 TCTGCAGGGAACCACAGTGAAGG + Intronic
1062997622 10:1881752-1881774 GCTGGAGGGAGCAACAGAGAAGG + Intergenic
1063068763 10:2637603-2637625 GCCGCAGGGAGCAACAGTGACGG + Intergenic
1067295133 10:44971332-44971354 GCTGCTGCGGGCCACCCTGAGGG - Intronic
1067946664 10:50693610-50693632 GCGGCTGGGAGTCACCGTGTGGG - Intergenic
1068618905 10:59155655-59155677 GTTGCAGTGAGCAACCCTGAAGG - Intergenic
1070088622 10:73261186-73261208 GCTGCAGTGAGCCCCTGTGATGG - Intronic
1070881971 10:79858603-79858625 GCGGCTGGGAGTCACCGTGTGGG - Intergenic
1070916594 10:80158998-80159020 GCTGATGGGTGACACCGTGAAGG - Intronic
1072577073 10:96710025-96710047 GCTGTGGGGAGCCACCTAGAAGG - Intronic
1074885036 10:117686606-117686628 GCTGCTGGGAGCCACAAAGATGG - Intergenic
1076932989 10:133546205-133546227 GCCACATGGAGCCACAGTGATGG - Intronic
1077287563 11:1774420-1774442 GCTGCAGGGAGGCCCAGGGAGGG + Intergenic
1077386465 11:2271594-2271616 GATGGAGGGAGCCACGGTGGGGG - Intergenic
1078470295 11:11580970-11580992 GCTTCAGGGTGGCACCGTGGAGG - Intronic
1078605897 11:12775314-12775336 GCTGCGGAGGGCCACTGTGAGGG - Intronic
1082725891 11:56736317-56736339 GCTGCAAGGAGCAACAGAGATGG - Intergenic
1084087461 11:66861145-66861167 GCTGCAGGGAGGCAGCCGGATGG + Intronic
1084516828 11:69642075-69642097 GCTGCCGGGAGCCCGCGGGAGGG + Intronic
1089566437 11:119374175-119374197 GCTGCATGGTCCCACAGTGAGGG + Intronic
1089879876 11:121763167-121763189 TCTGCTGGGAGCCACAGAGAAGG + Intergenic
1090658664 11:128864997-128865019 GCTGCAGGGTGCCACGATGAAGG - Intronic
1090805598 11:130200154-130200176 GCAGCAGGGAGCCTCCTTGCTGG + Intronic
1090834328 11:130443041-130443063 GCTTCAGGAAGCCCCCGGGAAGG - Intergenic
1091838299 12:3601458-3601480 GCTGCAGAAAGACACCGTGGAGG + Intergenic
1093009742 12:14093920-14093942 GCTGCAGTGAGCCATGGTCATGG + Intergenic
1094432086 12:30380460-30380482 GCAGCAGGCACCCACAGTGATGG + Intergenic
1095219272 12:39589449-39589471 CTTGCAGTGAGCCACCGAGATGG - Intronic
1097111634 12:56662939-56662961 GCAGGTGGGAGCCACCGTGCCGG + Intergenic
1097276379 12:57816169-57816191 GGTGCAGGGATGCACCATGAGGG - Exonic
1098271989 12:68778055-68778077 GCTGCAATGAGCCACCGTGATGG + Exonic
1100115087 12:91294491-91294513 GCTAAATGGAGCCACAGTGATGG - Intergenic
1101883969 12:108645724-108645746 TATGCAGGGAGCCAGGGTGAGGG - Exonic
1102198915 12:111044099-111044121 GCCGGAGGGAGCCAGTGTGAAGG - Intronic
1102915663 12:116750117-116750139 GCAGCAGGGAGCCCCCGCGGTGG - Exonic
1104751961 12:131245515-131245537 GCTGCAGGGGCCCAGGGTGAGGG + Intergenic
1104860117 12:131919190-131919212 GCTGCAGGAAGCGGCCGTCAGGG - Exonic
1105781015 13:23705267-23705289 GCTGCAGGGGCCAGCCGTGATGG - Intergenic
1106707505 13:32297462-32297484 CCAGCAGAGAACCACCGTGATGG + Exonic
1109968742 13:69737512-69737534 GCTGACTGGAGCCACAGTGATGG - Intronic
1111046478 13:82820467-82820489 GTTGCAGGGAACCACTGTGCTGG - Intergenic
1113195837 13:107804475-107804497 ACTGCAGGGAGCTAGAGTGAGGG - Intronic
1113933596 13:113981584-113981606 GCTGCAGGGAGCTCCCGGGTGGG - Intronic
1116677100 14:47920084-47920106 GCAGCAGGCAGCCACAGTGATGG + Intergenic
1117324091 14:54653034-54653056 GCAGCAGGGAGCACCCGAGAGGG - Intronic
1120889331 14:89477664-89477686 GCTGAAGGGAACCAACTTGAAGG + Intronic
1121414284 14:93768282-93768304 GCAGCAGGGGGCCACGGAGAAGG + Intronic
1121508426 14:94493931-94493953 GCTGCAGAGGGCCTCAGTGAGGG + Intronic
1122134327 14:99624215-99624237 GCTCCAGGGAGCCACAGCCAGGG - Intergenic
1122647627 14:103205952-103205974 GCTGGAGGGAGCTAGAGTGAAGG + Intergenic
1123030138 14:105447709-105447731 GCTGCAGGGAGCAGGCGTCATGG + Intronic
1123734901 15:23175838-23175860 GCAGGAGGGAGCCACCGCGCCGG - Intergenic
1124285406 15:28397142-28397164 GCAGGAGGGAGCCACCGCGCCGG - Intergenic
1124297291 15:28514500-28514522 GCAGGAGGGAGCCACCGCGCCGG + Intergenic
1124328071 15:28784003-28784025 GCAGGAGGGAGCCACCGCGCCGG + Intergenic
1124700003 15:31904429-31904451 GCTGCAGAGAGGCACAGTGGAGG - Intergenic
1127786761 15:62362437-62362459 GCTGCTGAGAACCACAGTGAGGG + Intergenic
1128490954 15:68143750-68143772 GTTGCATGGAGCCACCCTTAGGG + Intronic
1128741797 15:70088946-70088968 GATGCAGGGAGCCACCGGGTGGG + Intronic
1128856678 15:71023838-71023860 GCAGCAGGCAGCCTCAGTGATGG - Intronic
1129000740 15:72331518-72331540 GCTGCAGTGAGCTATTGTGATGG - Intronic
1129120561 15:73393951-73393973 GCTGCAGGGAGGCACAGAGGTGG + Intergenic
1129567033 15:76633793-76633815 GCTGACTGGAGCCACAGTGATGG + Intronic
1130337160 15:82966191-82966213 GCTGAAGGGAGCCATTGTGCTGG + Intronic
1130411076 15:83649264-83649286 GCCACAGGGAGCCACCTTGGAGG + Intergenic
1130650294 15:85758656-85758678 ACTGCTGAGAGCCACCGTGCTGG + Intergenic
1132038309 15:98504557-98504579 GCTTCTGGGAGGCACCTTGAAGG - Intronic
1132237174 15:100230886-100230908 GCTGCTGGGAGACAGAGTGATGG - Intronic
1132810394 16:1794176-1794198 GCTGTAGGGAACCCCCGGGAGGG - Intronic
1132842964 16:1987186-1987208 ACTGCTGGGAGCCGCCGTGTGGG + Exonic
1132975720 16:2710192-2710214 GCTCCAGGAAGCCAGCGTGGGGG + Intergenic
1132988112 16:2778433-2778455 GCTGCAGTGAACCGCAGTGAAGG - Intergenic
1135303355 16:21349514-21349536 GCAGCAGGGAGCCCCCAGGATGG + Intergenic
1135403487 16:22182133-22182155 GCTGCTGGGAGCCATCTGGAAGG + Intronic
1136300100 16:29328708-29328730 GCAGCAGGGAGCCCCCAGGATGG + Intergenic
1137687098 16:50393709-50393731 CCTCCAGTGAGCCACCGTGGGGG - Intergenic
1138266494 16:55663577-55663599 GCTGGAGGGACCCAAGGTGAAGG - Intronic
1139521580 16:67485760-67485782 GCTGCAGTGAGCCATGGTGGTGG + Intergenic
1139546366 16:67651735-67651757 GCTGCAGGGATCCAGCTGGAGGG + Exonic
1141181378 16:81755256-81755278 GCTGCAGTGAGCCACGATGACGG - Intronic
1141799749 16:86298688-86298710 GCAGCAGGGAGCCTCCGAGGTGG + Intergenic
1142034301 16:87854152-87854174 GCTGACGGGTGCCACCGGGAGGG + Intronic
1142246624 16:88973156-88973178 GCTGCAGGCAGCCCCGGTTATGG - Intronic
1142359521 16:89619639-89619661 GCTGCAGGGAGCTACAGGGAGGG - Intronic
1143124187 17:4631165-4631187 GCTGCAGTGAGCCGTGGTGATGG + Exonic
1143386646 17:6534942-6534964 TCTGCAGGGAGACACAGAGAAGG + Intronic
1145820241 17:27827418-27827440 GCTGCAGTGAGACACAGTGGTGG + Intronic
1147209737 17:38865684-38865706 GCTGCAGTGAGCCAGGGTGACGG - Intergenic
1147438541 17:40432511-40432533 GCTGCTGGGAGCAAGCCTGATGG + Intergenic
1147978918 17:44262919-44262941 GCTGCAGGGACCCGCGGTGCGGG - Exonic
1148862060 17:50609646-50609668 GGGGCAGGGAGGCACCGGGAGGG - Intronic
1149494512 17:57108809-57108831 ACTGCTGGGAGCCATCGGGATGG + Intronic
1149830331 17:59866294-59866316 GCTGCAGTGAGCCATCATTATGG - Intronic
1150417243 17:64997436-64997458 ACTGCAGGGAGCCAGTCTGATGG - Intergenic
1150568635 17:66365338-66365360 GCTGCAGGAAGCCAGCAAGACGG - Intronic
1150794421 17:68226486-68226508 ACTGCAGGGAGCCAGTCTGATGG + Intergenic
1152608447 17:81304360-81304382 GCCTCAGGGAGCCACCCCGATGG + Intergenic
1152793883 17:82297360-82297382 GCTGCAGGGTGGCACGGTGTTGG - Intergenic
1154326435 18:13394619-13394641 CCTGCAGGGAGACTTCGTGATGG + Intronic
1157356595 18:46940961-46940983 GCTGCAGTGAGCTATTGTGATGG + Intronic
1159523395 18:69556236-69556258 GCTGCAAGGGGCCAGCGTGGAGG - Intronic
1160957819 19:1701734-1701756 GCTCCAGGGTCCCACTGTGAGGG - Intergenic
1161681967 19:5684661-5684683 GGTTCATGGAGCCACCGTGGTGG + Intronic
1161796088 19:6387559-6387581 CCTGCAGGGAGCCACGGTCATGG + Exonic
1162471051 19:10872051-10872073 CCTGCAGGGAGCGACCGTGGAGG + Intronic
1163316074 19:16541680-16541702 GCTGCTGGGTGCCACTGTAATGG - Intronic
1163449268 19:17366064-17366086 GCTGCAGGGAGCCGGGGTGGTGG - Intronic
1163475516 19:17523747-17523769 GCTGCAGGGAGACTGAGTGAGGG - Intronic
1163536628 19:17880632-17880654 GCTGCAGTGAGCCACATTCATGG + Intronic
1164989939 19:32675950-32675972 TTCGCAGGGAGCCACCGTGGAGG + Exonic
1165491329 19:36124884-36124906 GCTGCAGTGAGCCACGATCATGG - Intronic
1165844503 19:38809541-38809563 GCTGCAGTGAGCCACCATCGTGG - Intronic
1167505926 19:49871070-49871092 GCTTCAGGGAGGCTCAGTGAAGG + Intronic
1167711493 19:51114232-51114254 TTTGCAGGGAGCCACCCTGAGGG - Intergenic
1168272422 19:55257673-55257695 GCTGCAGGGGGCCACAGAGCGGG - Intronic
925145518 2:1580874-1580896 GCTGCAGGAAGCCCCCTTCACGG - Intergenic
925305102 2:2842682-2842704 GCTGCAGGGAGCCCCCACTAGGG + Intergenic
926679401 2:15652466-15652488 GCTGCAGGGAGAGACCATGGCGG - Intergenic
927940194 2:27098749-27098771 GCTCCAGGGAGCCAGCATGGCGG + Intronic
929564360 2:42975350-42975372 GGAGCAGGGAGGCCCCGTGAGGG - Intergenic
929943018 2:46349179-46349201 GCAGCTGGGGGCCAGCGTGATGG + Intronic
933695796 2:85216238-85216260 GCTGCCCGGAGCCACGGGGAAGG - Intronic
934083776 2:88492217-88492239 GCTGGAGGGAGTCAGCCTGAAGG - Intergenic
936750453 2:115635140-115635162 GCAGCAGGCAGCCACAGTGATGG + Intronic
937271450 2:120655364-120655386 GCTGCATGGTGCCACCCTGGTGG - Intergenic
938631524 2:133172959-133172981 ACAGGCGGGAGCCACCGTGACGG + Intronic
940174511 2:150863729-150863751 ACTGCAGAGAGCCTCCATGAGGG - Intergenic
940592557 2:155748392-155748414 GCAGCTGGCAGCCACAGTGAAGG - Intergenic
942304885 2:174597612-174597634 ACTGCAGGGAGCCATGGTCAGGG + Intronic
942637873 2:178028096-178028118 GCTCCAGGGATCCACCTGGAAGG - Intronic
942705674 2:178769313-178769335 GCTGCAGTGAGCCACAATCACGG - Intronic
943404811 2:187467899-187467921 GCTGGAGTGAGACACCATGAGGG + Exonic
944750735 2:202707101-202707123 GCTGCAGTGAGCCACAATCATGG - Intronic
945430259 2:209755440-209755462 GCTGCAAGCAGGCACGGTGAGGG - Intergenic
946256528 2:218446294-218446316 GCTGCAGTGAGCCAAGATGATGG - Intronic
946412889 2:219523883-219523905 GCTGCAGGGAGCCACCGTGATGG - Intronic
947678326 2:232005863-232005885 GCTGCAGTGAGCAACCCTGAAGG + Intronic
947852505 2:233299676-233299698 GCTGCAGCCAGCCGCCGAGATGG - Intergenic
948225887 2:236309170-236309192 GGAGCAGGGAGCCGCCGCGAGGG - Intergenic
948504788 2:238421515-238421537 TCTGCAGGGAGACACCGCGAGGG + Intergenic
948867237 2:240782334-240782356 GCTGCTGGGAGACACCGAGGTGG - Intronic
949051863 2:241901967-241901989 ACGGCAGGGCGCCACCGTGCTGG + Intronic
1169204711 20:3733098-3733120 GCTCCAGGGAGCCAAACTGAGGG + Intronic
1169758128 20:9065125-9065147 GCTGCAGTGAGCCAAGGTCATGG - Intergenic
1170480916 20:16764110-16764132 GCTTCAGGGACCCACAGAGATGG + Intronic
1172055126 20:32149627-32149649 GCTGCAGGAAGACACCATGGAGG + Exonic
1173119604 20:40276612-40276634 GCTGCAGGGAGCCAAAGAGCTGG - Intergenic
1173483203 20:43419581-43419603 GCTGCAGTGAGCCACAGTCATGG + Intergenic
1173971927 20:47159934-47159956 GCTGCAGGAAGCCACTGTGTGGG + Intronic
1174796459 20:53526661-53526683 GCTGCAGTGAGCCTGGGTGACGG + Intergenic
1175430508 20:58898963-58898985 GCTGCAAGGAGCAACAGCGATGG + Exonic
1180606623 22:17063891-17063913 GGACCAGGGAGCCATCGTGAGGG - Intergenic
1181134149 22:20752370-20752392 GCTGCAGGCAGCCTCCATGTGGG + Intronic
1181475837 22:23167304-23167326 GGTGCAGGGAGCGGCAGTGAAGG - Intergenic
1181865754 22:25853591-25853613 GCTGAATGGAGCCACTGAGAGGG + Intronic
1183227874 22:36562823-36562845 GCTGCAGGGGGTCTCTGTGATGG - Intergenic
1183354427 22:37350747-37350769 GCTGTGGGCAGCCACCGAGAGGG + Intergenic
1183477928 22:38046288-38046310 GCTACAGGGAGCCACGGAGGGGG - Intergenic
1183667396 22:39253697-39253719 GCTGCAGGGAGCGACCGCGAGGG + Intergenic
1184045280 22:41969304-41969326 GCTGCAGGGAACCTCCCTGCAGG + Intergenic
1184672383 22:46021596-46021618 GCTGCTGGCTGCCACCTTGAAGG + Intergenic
1184875260 22:47270323-47270345 GCAGCAGGGAGGCACTGTTAGGG + Intergenic
1184950950 22:47842307-47842329 GCTGCAGGGCTCCACCTTCAGGG - Intergenic
1185138040 22:49084464-49084486 GGTGCAGAGAGCCACCGCCAAGG - Intergenic
1185138044 22:49084498-49084520 GGTGCAGAGCGCCACCATGAAGG - Intergenic
949564024 3:5228722-5228744 GCAGCAGGGAGCCACCTAGAGGG - Intergenic
950429923 3:12944833-12944855 GCTGCTGGGAGGCACCGTCAGGG + Intronic
950724447 3:14907450-14907472 TCTGCAGGGAGCCACCACCATGG - Intronic
950734079 3:14990664-14990686 GCTGCAGGGAGCCATTGGCATGG + Intronic
951265387 3:20559623-20559645 TTTTCAGGGAGCCACCTTGATGG - Intergenic
952694551 3:36250169-36250191 GCAGCAGGCAGCCACAGTGATGG - Intergenic
954420487 3:50416520-50416542 GCTCCAGGGTGCCCCCCTGAGGG + Intronic
954636300 3:52072726-52072748 GCTACAGGGAGCCATCGGGTAGG + Intergenic
958903129 3:99911672-99911694 TCTGCAGGGAGCGAATGTGAAGG - Intronic
961072943 3:123953268-123953290 TCTGCAGTGAGCAACCTTGAAGG + Intronic
961409997 3:126713454-126713476 CCTGCAGGGAGGCGCAGTGAAGG - Intronic
961535749 3:127569525-127569547 GCTCCAGCCAGCCACGGTGATGG - Intergenic
962410668 3:135139238-135139260 CCTGCAAGGAGCCACAGTGGAGG - Intronic
965342830 3:167511735-167511757 GCTGATTGGAGCCACAGTGATGG - Intronic
965738312 3:171846114-171846136 ACTGCAAGGAGCCAATGTGATGG - Intronic
974402395 4:61424386-61424408 GGTCCAGGGTGCCACCGTGTGGG - Intronic
974913333 4:68149285-68149307 GCAGCAGGCAGCCACAGTGATGG + Intergenic
979259215 4:118633123-118633145 GCTGAAAGAGGCCACCGTGAGGG - Intergenic
982798952 4:159678749-159678771 GCAGTAGGTAGCCACTGTGAGGG - Intergenic
983739007 4:171104238-171104260 AGTGCTGGGAGCCACCGTGCTGG + Intergenic
984019572 4:174468613-174468635 GCTGCAGGGAGGCACCCAGGCGG + Intergenic
984820259 4:183875777-183875799 GCTGCAGTGGGCCACCATCATGG - Intronic
985558587 5:570159-570181 TCTGCAGGGAGCCACCTCGTTGG + Intergenic
985631757 5:1017671-1017693 GCTGCAGGGCGGCCCCGTGGTGG - Intronic
988110465 5:26813001-26813023 GCTGACTGGAGCCACAGTGATGG - Intergenic
992036426 5:72782963-72782985 GCTGCAGAGAGCCCCCATCAAGG + Intergenic
992571655 5:78065381-78065403 GCAGCAGGCAGCCACAGTGATGG - Intronic
992626143 5:78637480-78637502 GCTGTTGGGAGCCACTGTGCAGG - Intronic
992919014 5:81493344-81493366 GCTGCAGGGAGCCATGATCATGG - Intronic
995264218 5:110139184-110139206 GCCCCTGGGAGCCACAGTGATGG + Intergenic
996004661 5:118405715-118405737 GCAGCAGGCTGCCACAGTGATGG + Intergenic
996004679 5:118405833-118405855 GCTGCAGGCAGCTGCAGTGATGG + Intergenic
997119144 5:131156411-131156433 GCTGCAGGGAGCCATGATCATGG + Intergenic
997474873 5:134137034-134137056 GCTGCAGGGAGTCACTGCCAGGG - Intronic
999224658 5:150011077-150011099 TCTTCAGGGAGCCAGTGTGATGG - Intronic
1001482135 5:172095779-172095801 GGCACAGGGAGCCACCGGGATGG + Intronic
1002653530 5:180723216-180723238 GCTGCAAGAAGCCACCAGGATGG + Intergenic
1002799075 6:504054-504076 GCTGCATGGAGCCAGCGAGCCGG - Intronic
1004121014 6:12822277-12822299 GCTACAGAGAGCCACCTGGAAGG + Intronic
1004459204 6:15820025-15820047 GTTGCAGGGAGCTAACTTGAAGG + Intergenic
1004731999 6:18367403-18367425 CTTGCAGGGGGCCTCCGTGATGG + Intergenic
1005465148 6:26105406-26105428 GGTGCAGGAAGCCATCTTGAGGG + Intergenic
1008924559 6:56878282-56878304 GCTTCAAGGAGACACCTTGAAGG + Intronic
1010810461 6:80293537-80293559 GATGGAAGGGGCCACCGTGAAGG + Intronic
1012050687 6:94339859-94339881 TTTGCAGGGAGCAACCATGAGGG - Intergenic
1012231776 6:96768547-96768569 GCTGATTGGAGCCACAGTGATGG - Intergenic
1015256405 6:131183793-131183815 GCTGCAGAGAGCCACTCTGGAGG + Intronic
1018276100 6:162133208-162133230 GCTGCCTGGAGGCACCATGAGGG + Intronic
1018474655 6:164128791-164128813 GCAGCAGGGAGCAACTGTGGTGG + Intergenic
1019094032 6:169564458-169564480 GCTGCCCTGTGCCACCGTGATGG - Intronic
1019603499 7:1897090-1897112 GCTGCACGGGGGCACCGTGCCGG - Intronic
1022842984 7:34182276-34182298 GCTGCAGAGAGCCACCATGGGGG + Intergenic
1023833858 7:44057227-44057249 CCTGGAGGTAGCCACCGTGGAGG + Intronic
1024159155 7:46656616-46656638 GCTGCATGCAGCCAACTTGATGG + Intergenic
1024667216 7:51559153-51559175 GATGGAAGGAGCCACTGTGAAGG - Intergenic
1025061373 7:55811426-55811448 GCTGCAGGGAGCGATGGAGATGG + Intronic
1025188248 7:56877414-56877436 GCTGCAAGAAGCCACACTGAAGG - Intergenic
1025683678 7:63699506-63699528 GCTGCAAGAAGCCACACTGAAGG + Intergenic
1028776943 7:94688121-94688143 ACTGCAGAGAGCCCCCATGAGGG - Intergenic
1032268022 7:130381874-130381896 GCTGCAGGGAGCGGCCGCTAGGG - Intronic
1034267957 7:149790261-149790283 GCTGCAGGGAGCGTCCGCGCTGG - Intergenic
1034676554 7:152896373-152896395 GATGAAGGCAGCCACGGTGACGG - Intergenic
1034863085 7:154616775-154616797 CCTCCAGGGAACCACAGTGACGG + Intronic
1034870311 7:154677722-154677744 GCAGCACAGAGCCAGCGTGAGGG + Intronic
1035608694 8:946853-946875 GCTGCTGGCAGCCACCGTCAGGG - Intergenic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1037920000 8:22799133-22799155 TTTGCAGGGAGACACAGTGAAGG + Intronic
1038339317 8:26671130-26671152 GCTGCAGGGAGCGAGCTTGCAGG + Intergenic
1038361686 8:26885842-26885864 ACTGCAGGGAGATACAGTGATGG + Intergenic
1041077259 8:54180033-54180055 TCTTCAGTGAACCACCGTGAGGG + Intergenic
1042840164 8:73115608-73115630 ACTGGTGTGAGCCACCGTGATGG + Intronic
1043926324 8:86040943-86040965 ACTGCAGGCAGCCACCTTGCAGG + Intronic
1045488786 8:102654644-102654666 GCTGCCGGAAGCCACGGGGAGGG - Intronic
1047217140 8:122885405-122885427 AATGCAGGGAGCCATCGGGACGG + Intronic
1049162022 8:141103755-141103777 GCTGCAGGGGCCCAGCCTGATGG - Intergenic
1049583942 8:143424436-143424458 GGTCCTTGGAGCCACCGTGAGGG - Intronic
1049673212 8:143878659-143878681 CCAGCAGGGAGTCACCGCGAAGG + Intergenic
1049673733 8:143880631-143880653 GCTCCATGGAGTCACCGTGCTGG + Intergenic
1049690875 8:143958302-143958324 GCTGCTGGGAGTCCCAGTGAGGG + Intronic
1049774654 8:144398742-144398764 GCTGCAGGGAGGCCCTGGGATGG - Intronic
1049867460 8:144948062-144948084 GGTGCAGGGAGTCAACGTGATGG + Intronic
1053013772 9:34650216-34650238 GCTGCAGTGAGCCATCATCATGG + Intronic
1053253034 9:36591028-36591050 GCTGCAGTGAGCCACGTTAATGG + Intronic
1053422082 9:37986140-37986162 GATGCAAGGAGACACCTTGAGGG + Intronic
1055427738 9:76213533-76213555 GCTGCAGTAAGCCAGGGTGAGGG - Intronic
1057114522 9:92507924-92507946 GCTGCAAGCAGGCACGGTGAAGG - Intronic
1059262732 9:112993979-112994001 GCAGCAGGAAGCCACAGTGATGG + Intergenic
1061152585 9:128837350-128837372 GTTGCAGGGATCCAATGTGATGG - Intronic
1061402370 9:130375554-130375576 GATGGTGGGAGCCACTGTGATGG - Intronic
1062621365 9:137423786-137423808 GCGGCAGGGCGACCCCGTGACGG - Intronic
1186741051 X:12518118-12518140 GCAGCAGGCAGCCACAGTGATGG + Intronic
1189088435 X:38051577-38051599 ACTGCAGTGAGCCACAGGGAAGG + Intronic
1189303011 X:39966461-39966483 GCTGCAGTGAGCCCTCGTGTTGG + Intergenic
1190960375 X:55240946-55240968 GCTGACTGGAGCCACAGTGATGG - Intronic
1191768876 X:64733313-64733335 GCAGCAGGCAGCCACAGTGATGG + Intergenic
1193164373 X:78264337-78264359 GCAGCAGGCAGCCACAGTGATGG + Intergenic
1195812629 X:108851342-108851364 GCTGCAGGGAGCCACAGTGATGG - Intergenic
1198158638 X:133985833-133985855 GCTGCCGGGAGCCACCGCGCGGG - Intronic
1198448340 X:136740684-136740706 GCTACAAGGAGTCACAGTGAGGG + Intronic
1199319637 X:146423020-146423042 ACTTCAGTGAGCCACAGTGAGGG + Intergenic
1202598558 Y:26569190-26569212 ACTGGCGGGAGCCACCATGATGG + Intergenic