ID: 946413126

View in Genome Browser
Species Human (GRCh38)
Location 2:219525675-219525697
Sequence GAGGCTTTGAACCTGGATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946413119_946413126 7 Left 946413119 2:219525645-219525667 CCTCTGCACCTGGAAAGGATAGG 0: 1
1: 0
2: 1
3: 35
4: 376
Right 946413126 2:219525675-219525697 GAGGCTTTGAACCTGGATACTGG 0: 1
1: 0
2: 0
3: 22
4: 156
946413115_946413126 18 Left 946413115 2:219525634-219525656 CCATCTTCCTTCCTCTGCACCTG 0: 1
1: 1
2: 10
3: 133
4: 1058
Right 946413126 2:219525675-219525697 GAGGCTTTGAACCTGGATACTGG 0: 1
1: 0
2: 0
3: 22
4: 156
946413118_946413126 11 Left 946413118 2:219525641-219525663 CCTTCCTCTGCACCTGGAAAGGA 0: 1
1: 0
2: 2
3: 46
4: 304
Right 946413126 2:219525675-219525697 GAGGCTTTGAACCTGGATACTGG 0: 1
1: 0
2: 0
3: 22
4: 156
946413123_946413126 -1 Left 946413123 2:219525653-219525675 CCTGGAAAGGATAGGGAAGGAAG 0: 1
1: 0
2: 3
3: 53
4: 465
Right 946413126 2:219525675-219525697 GAGGCTTTGAACCTGGATACTGG 0: 1
1: 0
2: 0
3: 22
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946413126 Original CRISPR GAGGCTTTGAACCTGGATAC TGG Intronic
901184324 1:7362705-7362727 GAGGCAGTGAACTTGGATAGAGG + Intronic
903268604 1:22173890-22173912 GAGGGTCTGAACTTGGATGCCGG + Intergenic
904912665 1:33947119-33947141 GAGGCTCTGAACCTGGCTGGAGG + Intronic
906505121 1:46373289-46373311 GCAGCTTTGAAACTGGATAATGG - Intergenic
907707389 1:56844653-56844675 GAGCCTGTGATCCTGGATGCAGG + Intergenic
909206242 1:72761329-72761351 GTGGCTTTGAAACTGGCTAATGG - Intergenic
909527778 1:76645955-76645977 GTGGCTTTGGAACTGGATAATGG - Intergenic
910010193 1:82452242-82452264 GTGGCTTTGGAACTGGATAATGG - Intergenic
911228467 1:95333910-95333932 GTGGCTTTGAAACTGGGTAAAGG - Intergenic
911643981 1:100319472-100319494 GCAGCTTTGAAACTGGATAATGG + Intergenic
916275079 1:162985184-162985206 GAGGCCTTGAAAGAGGATACAGG + Intergenic
916451305 1:164922991-164923013 GAGGCTTGGAAGCTGGAAATAGG + Intergenic
916582659 1:166122617-166122639 GAGGATTTGAACCCAGATTCAGG - Intronic
920360834 1:205415041-205415063 AAGGCTTTGAGCCTGGACAGTGG + Intronic
924875965 1:248105027-248105049 GAGGCTTAAAACCTGGACAATGG - Intergenic
1062978629 10:1703390-1703412 AAGGCTTGGAGCCTGGATGCTGG + Intronic
1063076316 10:2720456-2720478 AAGGCTTTGCTCCTTGATACTGG - Intergenic
1063771715 10:9211078-9211100 CAGGCCTTGAGCCTGCATACTGG + Intergenic
1065118531 10:22505842-22505864 GAGGCTTTGCACTTGGAATCTGG + Intergenic
1065241794 10:23712679-23712701 GAGCCTTTGAACCTGTTTATGGG + Intronic
1068682771 10:59838156-59838178 GAGGCATTGACCCAGAATACTGG - Intronic
1069118302 10:64535895-64535917 GAGGCCTTTAACCTTGATCCTGG + Intergenic
1073683622 10:105730208-105730230 GAGGCTTTGAACTGGGAAAAAGG - Intergenic
1079879225 11:25903655-25903677 AAGGCTTTGGAACTGGATAATGG + Intergenic
1080313678 11:30924364-30924386 GAGGCCCTGAACCTAAATACTGG - Intronic
1085883849 11:80499351-80499373 GCAGCTTTGAAACTGGATAATGG + Intergenic
1086373404 11:86176856-86176878 GTGGCTTTGGACCAGGAGACAGG - Intergenic
1087418318 11:97887250-97887272 GGGGCTTTAAACCTGGACATCGG + Intergenic
1088431427 11:109763569-109763591 CAGGATTTGAACTTTGATACTGG - Intergenic
1089620308 11:119718316-119718338 GAGGCATTGATCCTGGGTCCAGG - Intronic
1091926775 12:4357762-4357784 CAGGCCTTGAACCTGAATCCAGG - Intergenic
1092743432 12:11651157-11651179 AAGGCTTTCTACCTGGGTACTGG - Intronic
1093419083 12:18953794-18953816 AGGGCTTTGAAACTGGAGACAGG + Intergenic
1099343400 12:81467826-81467848 CAGGCTTTAACCCTGGATTCTGG - Intronic
1099598091 12:84694375-84694397 GAGGCTGTGAACCTGGAAAGTGG + Intergenic
1101748734 12:107565102-107565124 GAGGCTGGGAAGCTGGAAACAGG + Intronic
1102772858 12:115493753-115493775 GAGGCTTTGAATCATGATACTGG + Intergenic
1104168170 12:126254022-126254044 AAGGCTTTCAGCCTGGATCCAGG - Intergenic
1104804693 12:131578009-131578031 GAGCCTTTGAGCCTGGCTTCTGG + Intergenic
1106449001 13:29862884-29862906 GAGGGTGTGAACCTGGATGTAGG - Intergenic
1107058382 13:36130845-36130867 GGGGCTTTAAACCTGGAGTCAGG - Intronic
1108436809 13:50409043-50409065 GAACCTTGGAACCTGGCTACAGG - Intronic
1110847216 13:80203577-80203599 GATGCTTTGAACTTGTCTACTGG - Intergenic
1111360331 13:87167586-87167608 GAGGCTTTGGAACTGGGTAATGG + Intergenic
1116216756 14:42026300-42026322 GTGGCTTTGAACCTGGGTAATGG - Intergenic
1116364239 14:44040075-44040097 GTGGCTTTGGAACTGGATAATGG + Intergenic
1116498767 14:45594725-45594747 AAGGCTTTGAATCTTGAAACTGG + Intergenic
1117172537 14:53114962-53114984 GAGGCTAAGAACCTTGATAAAGG + Intronic
1117211871 14:53509255-53509277 TGGGCTGTGAACCTGGACACGGG + Intergenic
1118312318 14:64703290-64703312 GTGACTTTGAAACTGGATCCTGG - Intergenic
1120994806 14:90408997-90409019 GAGGCTTTAGACCTGGCTTCTGG + Intergenic
1121226941 14:92328094-92328116 GAGGCCTGGCACCTGGATCCAGG - Intronic
1122285204 14:100647316-100647338 GTGGCTTTGAAACTGGGTAATGG + Intergenic
1123020930 14:105397635-105397657 GAGGCACTGAACCAGGACACTGG - Exonic
1124461413 15:29895714-29895736 GTGGCTTTGGAACTGGATAATGG - Intronic
1125793428 15:42386924-42386946 GAGCCTTTGAAGCTGGAGACAGG - Intronic
1134292020 16:12909446-12909468 GAGGCTTTGAAGCAAGATACCGG + Intronic
1136094878 16:27948171-27948193 GTGGCTCTGAACCTGGGTAGGGG - Intronic
1140887003 16:79253181-79253203 GATGCTTAGAACTTGGATCCTGG + Intergenic
1145415023 17:22707835-22707857 GAGGCTGTGACCCTGGCCACAGG - Intergenic
1151384269 17:73745573-73745595 GTGGCTTTGAAGCTGGACACAGG + Intergenic
1153017227 18:595070-595092 TTGGCTTTGAGCCTGGATCCTGG - Intergenic
1155046158 18:22105253-22105275 GAGGCTTTGAACCTGGAAGGTGG - Intergenic
1156431941 18:37084910-37084932 TAGGCCTTGAACCTGGGTCCTGG + Intronic
1156808354 18:41215452-41215474 GAGGCATTGAATCTGGTTCCTGG - Intergenic
1159929313 18:74295259-74295281 GAGGCTTTGAACTGGGAAAAAGG - Intergenic
1161866049 19:6832884-6832906 AAGGTTTTGAAACTGGATAGAGG - Intronic
1163474234 19:17515734-17515756 GAGGCTTTGAAACAGGACAATGG + Intronic
1164202411 19:23029735-23029757 GAGGCTTTGAACTGGGAAAAAGG + Intergenic
1165211959 19:34243102-34243124 GGGGCTTTGAACCAGGGTAGAGG - Intergenic
1167178497 19:47883128-47883150 GGGGCAGTCAACCTGGATACAGG + Intronic
1167342216 19:48922586-48922608 GAGGCTGTGAAAGTGGAGACAGG - Exonic
928867717 2:35937227-35937249 TTTGCTTTGACCCTGGATACAGG - Intergenic
932925187 2:75965160-75965182 GTGGCTTTGAAACTGGGTAATGG - Intergenic
937117918 2:119422127-119422149 GTGGCTTTGGAACTGGATAAGGG - Intergenic
940064141 2:149607912-149607934 GAGACTTTGAACCTGGACTTGGG - Intergenic
941161620 2:162042129-162042151 GAGTCTTCTAACCTGGATTCAGG + Intronic
943466947 2:188239928-188239950 GAGGCCTTGAACCTTGAACCTGG + Intergenic
946332951 2:219020756-219020778 GAGGCTCTGGAACTGGATCCTGG - Intronic
946413126 2:219525675-219525697 GAGGCTTTGAACCTGGATACTGG + Intronic
946804871 2:223462121-223462143 GCAGCTTTGAAACTGGATAATGG + Intergenic
1169888211 20:10425391-10425413 GAGGCTTTGAGCATGGACTCTGG - Intronic
1170299484 20:14867296-14867318 TAGATTTTGAACCTTGATACTGG + Intronic
1173093672 20:40002442-40002464 GAGGCTTTAAACCTAGATGATGG + Intergenic
1173278234 20:41603253-41603275 GAGGCTTTGAACCTGGGAGGCGG + Intronic
1173656137 20:44701460-44701482 CAGGCTTTGAACTTGGATGTGGG + Intergenic
1175416701 20:58805864-58805886 GAGGCTGTGAACCTGGAGCTGGG - Intergenic
1176690703 21:9904767-9904789 GTGGCTTTGAAACTGGATAGTGG - Intergenic
1176721069 21:10393240-10393262 GAGTCTTTGAACCTGGAGCATGG - Intergenic
1177668041 21:24187227-24187249 GAAGATTTGAGGCTGGATACTGG + Intergenic
1179483107 21:41691131-41691153 GAGGCTTCAAACCTGGATTGAGG - Intergenic
1179560380 21:42212265-42212287 GAGGCTCTGGAACTGGATAATGG + Intronic
1180302258 22:11046030-11046052 GAGTCTTTGAACCTGGAGCATGG - Intergenic
1182345939 22:29664840-29664862 GAGGTTTAGTGCCTGGATACTGG + Intronic
950993617 3:17468975-17468997 GTGACTTTGAACCTGGAGAAGGG + Intronic
954937346 3:54338685-54338707 CAGGACTTGAACCTGGATCCAGG - Intronic
960279974 3:115770325-115770347 GAGGATTTGAACAGAGATACAGG + Intergenic
963003732 3:140706763-140706785 GTGGCTTTGAATCTGGGTAATGG - Intergenic
963146821 3:142002723-142002745 GTGGCTTTGGAACTGGATAATGG - Intronic
964827984 3:160850675-160850697 GAAGCTGTGCACATGGATACTGG + Intronic
967695386 3:192525381-192525403 AAGGCTTTGAATTTGGAAACTGG - Intronic
968045683 3:195622746-195622768 GAGGATATGAAGCTGGAGACTGG - Intergenic
968064396 3:195750511-195750533 GAGGATATGAAGCTGGAGACTGG - Intronic
968308973 3:197667341-197667363 GAGGATATGAAGCTGGAGACTGG + Intergenic
969929830 4:10620193-10620215 AAGGATTTGAATCTGGAAACGGG + Intronic
973208641 4:47589403-47589425 GTGGCTTTGAAACTGGATAATGG + Intronic
980354112 4:131722735-131722757 GTGGCTTTGAAACTGGATAGTGG - Intergenic
981563919 4:146077900-146077922 GAGACTTTCAACCTGAAAACTGG - Intergenic
981824391 4:148923623-148923645 GATGCTGTGAGCCTGAATACAGG + Intergenic
983986046 4:174061593-174061615 GAAGCTTTGGAACTGGATAATGG - Intergenic
984852831 4:184168836-184168858 GGGGCCTTGAACCTGGAGCCGGG + Intronic
986968826 5:13307902-13307924 GAGGCTTTGAGTCTGGTTAATGG - Intergenic
987105948 5:14639568-14639590 GTGGGTGTGGACCTGGATACAGG - Intergenic
987250197 5:16092636-16092658 GGGGCTTAAAACCTGGATAACGG + Intronic
987304194 5:16622453-16622475 GAGGCTTTGAAAATGGCTGCAGG + Intergenic
991045037 5:62213614-62213636 GAGACTTATAACCTGGATTCTGG + Intergenic
992157428 5:73969064-73969086 GAGGCTTTGAACCTCTCTACAGG + Intergenic
995135360 5:108674422-108674444 GTGGCTTTGGAATTGGATACTGG - Intergenic
995137530 5:108696105-108696127 GAGGTTTTGAACCCAGACACAGG + Intergenic
997572542 5:134942259-134942281 GAGGCTTTGGAGCTGGACATAGG + Intronic
997600100 5:135133254-135133276 GCGGCTTTGAACCTGGTGACTGG - Intronic
999771547 5:154779910-154779932 GATGCTATGAACATGGAGACAGG - Intronic
999986346 5:157008823-157008845 GCAGCTTTGAAACTGGGTACTGG - Intergenic
1000971231 5:167717055-167717077 GAGGCTGAGCACTTGGATACAGG - Intronic
1008476626 6:51941011-51941033 GAGGCTTTGAACTGGGGTAAAGG - Intronic
1009387724 6:63106679-63106701 GAGGCTTAAAACCTAGATAACGG - Intergenic
1009477580 6:64113297-64113319 TAGGCTTTGAACAGTGATACTGG + Intronic
1010311472 6:74390964-74390986 AAGGCTTTGAAACTGGGTAATGG - Intergenic
1012125373 6:95421590-95421612 GCAGCTTTGAAACTGGTTACTGG - Intergenic
1012753570 6:103193325-103193347 GTGGCTTTGAAACTGGGTAATGG - Intergenic
1014918191 6:127179817-127179839 GAGGCTTTGAGGCTGGAGAAAGG - Intronic
1018043342 6:159944424-159944446 GTGGCTTTGGAACTGGATAATGG + Intergenic
1019078053 6:169406894-169406916 GAGGTTTTGGACTTGGATAAAGG - Intergenic
1020807254 7:12805442-12805464 TAGGCTTTGAACTTGGATTTAGG + Intergenic
1020911110 7:14132669-14132691 GAGGCTGTAAAACTGGATCCTGG + Intergenic
1021062493 7:16131186-16131208 GAGACTTTGAAACTGGATAATGG + Intronic
1022125428 7:27351941-27351963 CAGGTTTTGAACCTGAGTACGGG - Intergenic
1022447497 7:30482049-30482071 GAGGCTTTGAACTGGGAAAAAGG - Intergenic
1024403482 7:48951000-48951022 GCAGCTTTGAAACTGGATAATGG - Intergenic
1029412593 7:100424820-100424842 AAGGATTTGAACCTAAATACTGG - Intronic
1029610915 7:101626124-101626146 CAGGCTTTGAACCCAGATCCGGG - Intronic
1029692428 7:102191138-102191160 GAGGCTTTGCAGCTGGAGAGGGG - Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1030456345 7:109779533-109779555 GAGTTTTTGTACCTGGATAATGG - Intergenic
1033199351 7:139355218-139355240 GAGGCCTTGAACCTGTATTATGG + Intronic
1035766072 8:2106405-2106427 GAGGCCTGGAAGTTGGATACTGG + Intronic
1036068459 8:5411590-5411612 GAGGCTTTGGACCTGCAAGCAGG - Intergenic
1037742638 8:21619754-21619776 GTGGCTTGGAACGTGGATCCAGG - Intergenic
1044047989 8:87462103-87462125 GAGGCTTTGAAGATGGAGAAAGG + Intronic
1045875864 8:106979930-106979952 GAGGCATTTAACCTTGATACTGG + Intergenic
1047644871 8:126859772-126859794 GAGGCATTGAACCTGGGAGCTGG + Intergenic
1049401727 8:142430779-142430801 GAGGCATTGGAGCTGGGTACTGG + Intergenic
1049759076 8:144323768-144323790 CACACTTTGAACCTGGAGACAGG - Intronic
1050909772 9:11054274-11054296 CAGGCTTTGAGCAGGGATACAGG + Intergenic
1053627434 9:39889281-39889303 GTGGCTTTGAAACTGGATAGTGG - Intergenic
1053778557 9:41576740-41576762 GTGGCTTTGAAACTGGATAGTGG + Intergenic
1054166519 9:61786984-61787006 GTGGCTTTGAAACTGGATAGTGG + Intergenic
1054216453 9:62361422-62361444 GTGGCTTTGAAACTGGATAGTGG + Intergenic
1054671029 9:67793921-67793943 GTGGCTTTGAAACTGGATAGTGG - Intergenic
1055344576 9:75321795-75321817 GAGGCTTAAAACCTGGATGATGG - Intergenic
1055570271 9:77609484-77609506 GTGGCTTTGAAACTGGATAATGG - Intronic
1056545446 9:87609124-87609146 GTGGCTTTGAACTGGGACACCGG + Intronic
1056546597 9:87618992-87619014 GAGCCTTTGAACCTGTGTCCAGG + Intronic
1057147420 9:92767675-92767697 GGCGCTTTGAACTTGGAAACAGG + Intergenic
1058288673 9:103210750-103210772 GAGACTTTGGAACTGGATAACGG - Intergenic
1058945307 9:109850132-109850154 GAGGCTTTGGAGATGGATGCAGG + Intronic
1060033366 9:120234374-120234396 GAGGCTTTGAACATTGATGGAGG + Intergenic
1060857945 9:126930113-126930135 GAGCCATTGAGCCTGGCTACTGG + Intronic
1062170717 9:135133308-135133330 GGGGCTTGGAACCAGGATTCGGG + Intergenic
1188090182 X:25954164-25954186 TAGGCTTTGAACTAGGATACAGG - Intergenic
1188156903 X:26751317-26751339 GGGGCTTTTAACCTTGATTCAGG - Intergenic
1192329614 X:70164668-70164690 GAGGCTTTTAGGGTGGATACAGG + Intronic
1192341618 X:70268026-70268048 GAGGCCTTGAACCTGAGAACTGG - Intergenic
1193518048 X:82494478-82494500 GTGGCTTTGAAACTAGATAATGG - Intergenic
1194108138 X:89797482-89797504 GTGGCTTTGAAGCTGGGTAATGG + Intergenic
1196251072 X:113460563-113460585 GTGGCTTTGAAACTGAATAATGG - Intergenic
1198632279 X:138654004-138654026 GAAGCTTTGAATTTGCATACTGG + Intronic
1199614176 X:149642475-149642497 GATGCTTTGTCCCTGGAGACAGG - Intergenic
1200460794 Y:3452211-3452233 GTGGCTTTGAAGCTGGGTAATGG + Intergenic