ID: 946415230

View in Genome Browser
Species Human (GRCh38)
Location 2:219536879-219536901
Sequence TGTTAGCTTCATCTTTTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 179}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946415230_946415247 23 Left 946415230 2:219536879-219536901 CCCCTCAAAAGATGAAGCTAACA 0: 1
1: 0
2: 1
3: 22
4: 179
Right 946415247 2:219536925-219536947 ACAGCCTTGGGGAGTCCGGGGGG 0: 1
1: 0
2: 2
3: 18
4: 157
946415230_946415243 19 Left 946415230 2:219536879-219536901 CCCCTCAAAAGATGAAGCTAACA 0: 1
1: 0
2: 1
3: 22
4: 179
Right 946415243 2:219536921-219536943 CCTCACAGCCTTGGGGAGTCCGG 0: 1
1: 0
2: 3
3: 29
4: 257
946415230_946415244 20 Left 946415230 2:219536879-219536901 CCCCTCAAAAGATGAAGCTAACA 0: 1
1: 0
2: 1
3: 22
4: 179
Right 946415244 2:219536922-219536944 CTCACAGCCTTGGGGAGTCCGGG 0: 1
1: 0
2: 2
3: 24
4: 232
946415230_946415237 11 Left 946415230 2:219536879-219536901 CCCCTCAAAAGATGAAGCTAACA 0: 1
1: 0
2: 1
3: 22
4: 179
Right 946415237 2:219536913-219536935 CTGCCTCCCCTCACAGCCTTGGG 0: 1
1: 0
2: 4
3: 57
4: 436
946415230_946415236 10 Left 946415230 2:219536879-219536901 CCCCTCAAAAGATGAAGCTAACA 0: 1
1: 0
2: 1
3: 22
4: 179
Right 946415236 2:219536912-219536934 ACTGCCTCCCCTCACAGCCTTGG 0: 1
1: 0
2: 0
3: 39
4: 359
946415230_946415246 22 Left 946415230 2:219536879-219536901 CCCCTCAAAAGATGAAGCTAACA 0: 1
1: 0
2: 1
3: 22
4: 179
Right 946415246 2:219536924-219536946 CACAGCCTTGGGGAGTCCGGGGG 0: 1
1: 0
2: 0
3: 19
4: 206
946415230_946415238 12 Left 946415230 2:219536879-219536901 CCCCTCAAAAGATGAAGCTAACA 0: 1
1: 0
2: 1
3: 22
4: 179
Right 946415238 2:219536914-219536936 TGCCTCCCCTCACAGCCTTGGGG 0: 1
1: 0
2: 4
3: 23
4: 275
946415230_946415245 21 Left 946415230 2:219536879-219536901 CCCCTCAAAAGATGAAGCTAACA 0: 1
1: 0
2: 1
3: 22
4: 179
Right 946415245 2:219536923-219536945 TCACAGCCTTGGGGAGTCCGGGG 0: 1
1: 0
2: 1
3: 66
4: 494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946415230 Original CRISPR TGTTAGCTTCATCTTTTGAG GGG (reversed) Intronic
902778073 1:18687254-18687276 TGTTATCTTCATTTTTATAGCGG + Intronic
904304252 1:29577331-29577353 TGTTAGATTCTTCTTTTAAGTGG - Intergenic
904438386 1:30514074-30514096 TGTTCTCTGCATCTTTTGAATGG - Intergenic
906523732 1:46481995-46482017 TGATAACTTCTTCCTTTGAGAGG + Intergenic
909830952 1:80189153-80189175 TCTTAGCTTCATCTTTGGAGAGG - Intergenic
911784167 1:101923490-101923512 TCTTAGCTTCATCTTGCTAGTGG + Intronic
915056165 1:153133372-153133394 TGTGAGATTCATCTCTGGAGTGG - Intergenic
916363814 1:164000664-164000686 GGTTTCCTTGATCTTTTGAGTGG - Intergenic
916419193 1:164620627-164620649 TGTTGACTTCAGGTTTTGAGAGG + Intronic
917351608 1:174083868-174083890 AATTAGCTTCAGATTTTGAGGGG + Intergenic
919084701 1:192908408-192908430 TCTCAGCTTCCTCTTTTGTGTGG - Intergenic
924642401 1:245846768-245846790 GGTTAGCATCATCTTTCTAGGGG - Intronic
1062973630 10:1666670-1666692 TTTTAGCTTCATTTTTTTTGAGG + Intronic
1067489277 10:46682847-46682869 TATTATCCTCATCTTTTTAGAGG + Intergenic
1067605394 10:47657538-47657560 TATTATCCTCATCTTTTTAGAGG - Intergenic
1067908395 10:50318477-50318499 AGTTAGGTCCATCTTTTGGGGGG + Intronic
1071620953 10:87118933-87118955 TATTATCCTCATCTTTTTAGAGG - Intronic
1073874854 10:107910682-107910704 TGGAAGCTTCATCTTATGAAAGG - Intergenic
1074474863 10:113762233-113762255 TGTTAACTTAATCTTTTTAATGG + Intronic
1075466371 10:122654310-122654332 TGTTAACTTCACCTTCTTAGAGG - Intergenic
1078027191 11:7708129-7708151 TGTTACTTTCATCTCTTAAGGGG + Intergenic
1078161106 11:8840333-8840355 TCTTAGCTTCACCTTTTTTGTGG - Intronic
1078953070 11:16157286-16157308 TTTTAGCCTCCTCTTTTGAGGGG + Intronic
1080396230 11:31892783-31892805 TGTTTGCCTGATCTTTTGATGGG - Intronic
1084009650 11:66340415-66340437 TGTGAGCCTCATCTGTTTAGTGG + Intronic
1085634487 11:78147817-78147839 TGTCAGCTTCTTCTTTTGCAGGG - Intergenic
1089834654 11:121359373-121359395 TGTTTTCTTCCTCTTCTGAGGGG - Intergenic
1092935926 12:13364387-13364409 TGTTACCTTCATCTCTTTAGAGG + Intergenic
1093188219 12:16046265-16046287 TGTTTATTTCATGTTTTGAGTGG + Intergenic
1093803223 12:23399460-23399482 TATTAAATTCATCTTTTGACAGG + Intergenic
1100718155 12:97327522-97327544 TCTAATCTTTATCTTTTGAGAGG + Intergenic
1100937089 12:99681268-99681290 TGTTTTCTTCTTCTTTGGAGTGG - Intronic
1103279591 12:119745436-119745458 TATTACCTTCATTTTTTAAGAGG - Intronic
1105643406 13:22289756-22289778 TATTAGCTTCAGTTTTTGTGTGG + Intergenic
1108997512 13:56752908-56752930 TGTTGGCTTCATCTGTTAAAGGG + Intergenic
1112432698 13:99366088-99366110 TTTTAGATTTATCTTTTGTGGGG + Intronic
1114891755 14:26933335-26933357 TATAAGTTTCATCTTTTCAGAGG + Intergenic
1115834480 14:37383746-37383768 AATTACCTTCACCTTTTGAGAGG + Intronic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1119131808 14:72179671-72179693 TGTTAACTTCATATTTGAAGGGG + Intronic
1124068242 15:26366275-26366297 TATCAGTTTCATCTTTTGGGAGG + Intergenic
1124209161 15:27747995-27748017 GGTTACCTTCTTCTGTTGAGTGG - Intergenic
1125306516 15:38322545-38322567 TTTTATCTTCATCTATTGTGAGG - Intronic
1126990088 15:54364522-54364544 ATTTAGTATCATCTTTTGAGTGG + Intronic
1127437374 15:58971469-58971491 TTTTTCCTTCATTTTTTGAGAGG + Intronic
1127695756 15:61445270-61445292 CTTTATCTTCATATTTTGAGAGG + Intergenic
1131939922 15:97550857-97550879 TGTTTGCTTGTTTTTTTGAGAGG + Intergenic
1132048799 15:98589976-98589998 TCTTATATTCATCTTCTGAGAGG - Intergenic
1133836926 16:9375810-9375832 TGTTAGCTTTAACATATGAGTGG + Intergenic
1134537615 16:15039118-15039140 AATTAGCTTCTTCTTTTGATGGG - Intronic
1135042987 16:19132217-19132239 AGTTAATTTCATCTTTTGAGTGG - Intronic
1135309497 16:21394392-21394414 TGTAATCATCATATTTTGAGGGG + Intergenic
1136306241 16:29373516-29373538 TGTAATCATCATATTTTGAGGGG + Intergenic
1137390829 16:48080173-48080195 TATAAGCTTCCTCTTTGGAGGGG - Intergenic
1137921364 16:52491779-52491801 TGTTATCTCCATCCTTAGAGAGG + Intronic
1139227605 16:65248334-65248356 TGTTTGCTTCATCTGTAAAGTGG + Intergenic
1141576226 16:84965073-84965095 TATTAAGTTCATGTTTTGAGCGG - Intergenic
1143803279 17:9403161-9403183 TGTCAGTTTCGTCTTTTGATTGG - Intronic
1144043578 17:11434426-11434448 TGTTATTTTCATATTTGGAGTGG + Intronic
1147597271 17:41725164-41725186 AGATAGCGACATCTTTTGAGGGG + Intronic
1151275573 17:73031594-73031616 TGTTGGCTTCACCCTTGGAGCGG - Exonic
1153762963 18:8349541-8349563 TGTCAGCTTCATCCTATGATAGG - Intronic
1155866128 18:30967261-30967283 TGCTATCATCATCTTTTGTGTGG + Intergenic
1157801146 18:50622353-50622375 TGTTAGCTTCCTCTGATGTGTGG + Intronic
1162617467 19:11813951-11813973 TGTTAGCTTCCTCATTCAAGGGG - Intergenic
1163316410 19:16543101-16543123 GGTTAGCTTCATTATTTTAGAGG - Intronic
926817360 2:16813225-16813247 TGTTAGCTTCATGTTTCCTGTGG + Intergenic
927186478 2:20485943-20485965 TGCGAGCTTCCTCTTTTAAGGGG + Intergenic
933532879 2:83532876-83532898 TGTTAGCTTGATCTCCTGAGAGG + Intergenic
934999034 2:98993235-98993257 TGTTTGCTTGATATTTTGATTGG - Intergenic
935237027 2:101148119-101148141 TTGTAGCTCCCTCTTTTGAGGGG - Intronic
937729793 2:125214807-125214829 TGTAACCTTCTTCTGTTGAGAGG + Intergenic
939695535 2:145318961-145318983 TGTTTTCTGCATCTTTTGAGAGG - Intergenic
940173481 2:150853161-150853183 TGTTAGCATCCTCCTTTGGGTGG - Intergenic
941056366 2:160793915-160793937 TTTAATCTTCATTTTTTGAGAGG - Intergenic
941713017 2:168734482-168734504 TGTTAGCTTCCTATTTATAGTGG - Intronic
945926441 2:215810400-215810422 TCTTAGGTTGATCTTTTCAGAGG - Intergenic
946415230 2:219536879-219536901 TGTTAGCTTCATCTTTTGAGGGG - Intronic
947737629 2:232464787-232464809 TGGTGGCCTCATCTTTTGACAGG - Intergenic
1169107910 20:3013042-3013064 TGTAAGGTTCTTCTTTTGAGGGG - Intronic
1169622017 20:7517930-7517952 TGTTTGCTTCAGTTTTTGAGGGG - Intergenic
1169913690 20:10667364-10667386 TGTTAGCATTATTTTTGGAGAGG + Intronic
1170107293 20:12765319-12765341 TGTTAGATTCATATTCTGCGTGG - Intergenic
1170140120 20:13117569-13117591 TGTGAGCTTCATCTATGTAGAGG - Exonic
1170258010 20:14368190-14368212 TGTTAATTTCTTCTTTTGATGGG + Intronic
1173133163 20:40413245-40413267 TTTTAGCTTCATCTTTCAACTGG - Intergenic
1174834521 20:53843854-53843876 ATTTAGCATCATCTTTTTAGGGG - Intergenic
1175535684 20:59709605-59709627 TGTTACCTTCATCTTAGGAAGGG + Intronic
1176410938 21:6449145-6449167 TCTCAGCTTCATGGTTTGAGGGG + Intergenic
1176699022 21:10020492-10020514 TCTTGGCTTCATCTTTTGTGTGG - Intergenic
1179686431 21:43057467-43057489 TCTCAGCTTCATGGTTTGAGGGG + Intronic
1182833615 22:33323645-33323667 TGTTCCCTTCTTTTTTTGAGTGG - Intronic
1183267851 22:36840366-36840388 TGTTTGCTGAATCTTCTGAGGGG + Intergenic
949684262 3:6549775-6549797 TTTTAGCTTCGTCTTATGGGAGG - Intergenic
951211562 3:19981133-19981155 TGCTAAATTCATTTTTTGAGGGG - Intronic
951782622 3:26381123-26381145 AGTTAGCATCATCTTTTAATTGG - Intergenic
951792729 3:26504345-26504367 TGGAAGCTTCCTCTTTTCAGGGG + Intergenic
952485841 3:33808627-33808649 TGCTAGCATCATCTCTTGACTGG + Intronic
952861089 3:37812786-37812808 TGCTTGCTTCACCATTTGAGGGG - Intronic
952984776 3:38769599-38769621 AGCTAGTTTGATCTTTTGAGGGG + Intronic
953140298 3:40223514-40223536 AGTTAGCTTGTTCTTTTGGGAGG + Intronic
955633782 3:61003535-61003557 TCATAGCTTCAGCTTTTAAGGGG - Intronic
955659449 3:61281104-61281126 TGATAGCTTGTTCTTTTGTGGGG - Intergenic
956776133 3:72567065-72567087 TGGTAGGTTCATCTTTTGAAGGG + Intergenic
957522254 3:81333507-81333529 TGCTAGCTGCATTTTTGGAGTGG + Intergenic
957955502 3:87181174-87181196 TTTAAGCTTCATCTTTTTAAAGG - Intergenic
957985123 3:87564628-87564650 TGTCAGCTTCAACATTTGAGTGG + Intergenic
959244268 3:103844500-103844522 TTTTAACTTCATATTTTGTGGGG + Intergenic
959483576 3:106902320-106902342 TGGTAGCTTCTTCTGTGGAGTGG - Intergenic
959741225 3:109722312-109722334 TTTTAGGTTTATCTTTTTAGAGG + Intergenic
959785531 3:110293696-110293718 TGTTCTCTTCAGTTTTTGAGTGG - Intergenic
963019040 3:140854368-140854390 TGTTACCTTCATCCTGTGAGAGG - Intergenic
963209347 3:142671982-142672004 TGTTACCTTCACTTTTTGAAAGG + Intronic
963920867 3:150903432-150903454 TGTTTGCTTTGTCTTTTGTGGGG - Intronic
965062248 3:163799230-163799252 TGTTTGCTTCTACTTTTGACAGG - Intergenic
967376404 3:188808360-188808382 TGTTACCTTCAGTTTTAGAGAGG + Intronic
967662573 3:192131157-192131179 TGTTTGTTTCTTGTTTTGAGGGG - Intergenic
969141651 4:5079615-5079637 TGGAAACTCCATCTTTTGAGAGG + Intronic
971073098 4:23116958-23116980 AGATACCTTCATCTTCTGAGTGG + Intergenic
972018593 4:34279796-34279818 AGCTAGCTTGATCTTTTGGGGGG + Intergenic
977392836 4:96433923-96433945 TGTTAGCCTCATATTTTAATGGG - Intergenic
977546358 4:98385426-98385448 TTTTAGCCTCAGCTTTTGAAAGG - Intronic
978199646 4:106010891-106010913 TGTTAGATTTATGTTTTCAGGGG + Intergenic
978205886 4:106080874-106080896 TGTGAATTTCTTCTTTTGAGAGG - Intronic
978285959 4:107076765-107076787 TTTTTGCTTCATCTTTTATGTGG - Intronic
978323186 4:107521046-107521068 TGTGTGCTTCTTCCTTTGAGAGG - Intergenic
979330854 4:119420315-119420337 TTTTAGTTTAAACTTTTGAGTGG - Intergenic
980371485 4:131879816-131879838 TCTTGGCTTCATCTTTTGTGTGG - Intergenic
981264040 4:142759648-142759670 TGTTATATTCAACTTTTCAGGGG - Intronic
981350407 4:143722867-143722889 TGATAGTTTCCTCTTGTGAGGGG + Intergenic
982377359 4:154707981-154708003 TGTCAGCTTCATCTTTTTGTCGG - Intronic
982423895 4:155233983-155234005 AGTTAGCTTCCTCCTTTCAGAGG + Intergenic
983857596 4:172664673-172664695 TCTCAGCTTCATCTTTTAAAAGG + Intronic
985961156 5:3304416-3304438 TGTTACCTTCATCTGGTGTGGGG + Intergenic
987767894 5:22258454-22258476 TGTTATCTTATTCTTTTAAGAGG - Intronic
989026886 5:37078051-37078073 TTTTATCTTCAGCTTTTAAGGGG + Intergenic
990417682 5:55601675-55601697 TGGTTTCTTCATCTTTAGAGGGG - Intergenic
994324490 5:98434158-98434180 TGTTACCTACATATTTGGAGTGG - Intergenic
995218397 5:109621153-109621175 TGATAGATGCATCTTTTCAGGGG + Intergenic
995842247 5:116453865-116453887 TGTTTGCTTCACATTTTGATAGG - Intronic
997074777 5:130660423-130660445 TTTTATCTTCGTCTTTTGTGAGG + Intergenic
998880875 5:146643520-146643542 TCTTAGCTTCCACTTATGAGTGG - Intronic
999074023 5:148777821-148777843 TGTAAGCTTCATATTTGGTGTGG - Intergenic
1001016530 5:168146716-168146738 TGTTAGCATCATCATTTCACAGG + Intronic
1002375465 5:178785714-178785736 TGTTTGTTTGATTTTTTGAGAGG - Intergenic
1003132983 6:3411481-3411503 TGTTTCCATCATCCTTTGAGGGG + Intronic
1003684806 6:8291819-8291841 TTTTAGCTGTATCTTTTGATGGG + Intergenic
1006842938 6:37042192-37042214 TGTTAGCATCCTCCTTTGAGAGG + Intergenic
1010041150 6:71385679-71385701 TGTCAGCTTCCTCTTCTGTGTGG - Intergenic
1010515335 6:76766690-76766712 TCTTAGCTCTATATTTTGAGAGG + Intergenic
1013336863 6:109172351-109172373 TATCAGCTCCATCTTTGGAGGGG - Intergenic
1013981513 6:116135179-116135201 TGTTAGCATCTTCTCTTGAATGG + Intronic
1014834164 6:126140524-126140546 TGTTAGCTTAATGTATTCAGTGG + Intergenic
1016406648 6:143738393-143738415 TTTTAGGTTGATCTTTTCAGGGG - Intronic
1016788029 6:148034924-148034946 TGTTTGCTTCACCCTGTGAGTGG + Intergenic
1017724301 6:157266179-157266201 TATTAACCACATCTTTTGAGAGG - Intergenic
1018441396 6:163816754-163816776 TGTGAGCTTCATCTATTGCCAGG - Intergenic
1019881920 7:3869097-3869119 TGTTAGTTTCCTCTTTTTTGGGG - Intronic
1020209480 7:6147876-6147898 TGTTACCTTTATCATGTGAGAGG - Exonic
1020841983 7:13229335-13229357 TGTTCCCTTCATCATTTAAGGGG + Intergenic
1021057782 7:16072166-16072188 TTTTTGCTTCACCCTTTGAGCGG - Intergenic
1021453886 7:20808105-20808127 TGTTATTTTTATTTTTTGAGAGG - Intergenic
1022717370 7:32910748-32910770 TTTTAGATTCATCTTGTAAGTGG + Intergenic
1022764312 7:33393634-33393656 TGTTTTCTTCATCTTTGGAAAGG - Intronic
1023810902 7:43910954-43910976 TGTTAGCTTCATATTTTTTGGGG - Intronic
1024888664 7:54176319-54176341 TTTTGGCTTCATCTTTAGAGAGG + Intergenic
1024920836 7:54553124-54553146 AGTTAGCTTTATCTTGTGATAGG - Intronic
1027521364 7:79212885-79212907 TGTTTTCTTCCTCTCTTGAGGGG + Intronic
1028217344 7:88150717-88150739 TGGTAGATTCATATTTTCAGGGG + Intronic
1028554790 7:92110949-92110971 TGATTTCTTCATCTTTTTAGTGG - Intergenic
1030632123 7:111907479-111907501 CGTAAGCTTCATAATTTGAGAGG + Intronic
1031356026 7:120788030-120788052 TGTTAGCTTGCTCTTTTAAGTGG + Exonic
1032431272 7:131864018-131864040 TGTTACCTTCATCATGGGAGAGG - Intergenic
1032769190 7:135031877-135031899 TCTTAGTCTCATCTTTTGACTGG + Intronic
1034046217 7:147930564-147930586 TGTTTGCTTCATATATTTAGAGG - Intronic
1037210429 8:16379441-16379463 TCTTAGCTTCATCTTTAAAATGG + Intronic
1039314197 8:36353657-36353679 TGTTAGATCCATATTTTCAGTGG + Intergenic
1040481044 8:47827100-47827122 TGTGATCTTCATATTTTGATAGG - Intronic
1042081444 8:65058337-65058359 TATCAGCGTCATTTTTTGAGTGG - Intergenic
1042573352 8:70191522-70191544 TGTAAGGTTCATCTCTTCAGAGG - Intronic
1042811187 8:72827010-72827032 TATTATCGTCATCTTTTGACTGG + Intronic
1044746786 8:95378444-95378466 TGTAGGTTTCATCTTTGGAGAGG + Intergenic
1046105094 8:109655549-109655571 TCTTAGCTTCATTATTTTAGTGG + Intronic
1046651561 8:116841589-116841611 TGTTAGCTTCATCTCATATGAGG + Intronic
1048028200 8:130606073-130606095 TGTTGGCTTCATCTTTAGGCCGG + Intergenic
1050651276 9:7779507-7779529 TCTGAACTTCATCTATTGAGAGG - Intergenic
1051714955 9:19972948-19972970 TGTTAAGCTCATCTTTTGGGGGG + Intergenic
1053636128 9:40006691-40006713 TCTTGGCTTCATCTTTTGTGTGG - Intergenic
1053769858 9:41457960-41457982 TCTTGGCTTCATCTTTTGTGTGG + Intergenic
1054317002 9:63603786-63603808 TCTTGGCTTCATCTTTTGTGTGG - Intergenic
1054548533 9:66369436-66369458 TCTTGGCTTCATCTTTTGTGTGG + Intergenic
1055507317 9:76961673-76961695 TGTTAGCTTCACCGTCTAAGTGG - Intergenic
1057975069 9:99596739-99596761 TGTTAGCTTCTTCTTGAGGGAGG - Intergenic
1058555574 9:106163287-106163309 TGTGAGCATCATCTTTGGGGAGG - Intergenic
1061694394 9:132360857-132360879 TTTTTGCTTCATTTTTTGAGGGG + Intergenic
1186839072 X:13467054-13467076 TTTTGGGTTCATCTTTGGAGTGG - Intergenic
1187293883 X:17980709-17980731 TGGTAGCTTCACCTTTAAAGAGG + Intergenic
1190339389 X:49284930-49284952 TCCTAGCTCCATCTTTTGAAAGG - Intronic
1191812543 X:65204664-65204686 TGGTAGCCTTACCTTTTGAGAGG + Intergenic
1192250370 X:69408167-69408189 TCTTAGCTTACTGTTTTGAGGGG + Intergenic
1192727844 X:73770383-73770405 TGTGAGATTCACATTTTGAGTGG - Intergenic
1195126968 X:101817541-101817563 TGATAGTTTCATTTTTTGTGCGG + Intergenic
1199063137 X:143382957-143382979 TGTTTTCTTGATCTTTTGAATGG + Intergenic