ID: 946416407

View in Genome Browser
Species Human (GRCh38)
Location 2:219542170-219542192
Sequence TAGGACCCGCTACATCAGCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946416407_946416418 20 Left 946416407 2:219542170-219542192 CCGTGCTGATGTAGCGGGTCCTA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 946416418 2:219542213-219542235 TTATCAAAAGGACAACGGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 110
946416407_946416415 15 Left 946416407 2:219542170-219542192 CCGTGCTGATGTAGCGGGTCCTA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 946416415 2:219542208-219542230 CAAGCTTATCAAAAGGACAACGG 0: 1
1: 0
2: 1
3: 17
4: 239
946416407_946416425 29 Left 946416407 2:219542170-219542192 CCGTGCTGATGTAGCGGGTCCTA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 946416425 2:219542222-219542244 GGACAACGGGGCGGGGGGTGGGG 0: 1
1: 1
2: 4
3: 55
4: 528
946416407_946416414 8 Left 946416407 2:219542170-219542192 CCGTGCTGATGTAGCGGGTCCTA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 946416414 2:219542201-219542223 GATGGCACAAGCTTATCAAAAGG 0: 1
1: 0
2: 1
3: 3
4: 115
946416407_946416421 23 Left 946416407 2:219542170-219542192 CCGTGCTGATGTAGCGGGTCCTA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 946416421 2:219542216-219542238 TCAAAAGGACAACGGGGCGGGGG 0: 1
1: 0
2: 2
3: 4
4: 73
946416407_946416412 -10 Left 946416407 2:219542170-219542192 CCGTGCTGATGTAGCGGGTCCTA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 946416412 2:219542183-219542205 GCGGGTCCTAGGGGAGGAGATGG 0: 1
1: 0
2: 2
3: 27
4: 337
946416407_946416419 21 Left 946416407 2:219542170-219542192 CCGTGCTGATGTAGCGGGTCCTA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 946416419 2:219542214-219542236 TATCAAAAGGACAACGGGGCGGG 0: 1
1: 0
2: 2
3: 13
4: 173
946416407_946416426 30 Left 946416407 2:219542170-219542192 CCGTGCTGATGTAGCGGGTCCTA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 946416426 2:219542223-219542245 GACAACGGGGCGGGGGGTGGGGG 0: 1
1: 0
2: 7
3: 100
4: 957
946416407_946416420 22 Left 946416407 2:219542170-219542192 CCGTGCTGATGTAGCGGGTCCTA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 946416420 2:219542215-219542237 ATCAAAAGGACAACGGGGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 93
946416407_946416422 24 Left 946416407 2:219542170-219542192 CCGTGCTGATGTAGCGGGTCCTA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 946416422 2:219542217-219542239 CAAAAGGACAACGGGGCGGGGGG 0: 1
1: 0
2: 0
3: 7
4: 123
946416407_946416424 28 Left 946416407 2:219542170-219542192 CCGTGCTGATGTAGCGGGTCCTA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 946416424 2:219542221-219542243 AGGACAACGGGGCGGGGGGTGGG 0: 1
1: 0
2: 6
3: 21
4: 309
946416407_946416416 16 Left 946416407 2:219542170-219542192 CCGTGCTGATGTAGCGGGTCCTA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 946416416 2:219542209-219542231 AAGCTTATCAAAAGGACAACGGG 0: 1
1: 0
2: 0
3: 21
4: 177
946416407_946416417 17 Left 946416407 2:219542170-219542192 CCGTGCTGATGTAGCGGGTCCTA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 946416417 2:219542210-219542232 AGCTTATCAAAAGGACAACGGGG 0: 1
1: 0
2: 0
3: 6
4: 103
946416407_946416423 27 Left 946416407 2:219542170-219542192 CCGTGCTGATGTAGCGGGTCCTA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 946416423 2:219542220-219542242 AAGGACAACGGGGCGGGGGGTGG 0: 1
1: 0
2: 0
3: 37
4: 534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946416407 Original CRISPR TAGGACCCGCTACATCAGCA CGG (reversed) Exonic
901044769 1:6389363-6389385 AAGGTCCCCCTCCATCAGCATGG + Intronic
920293357 1:204939821-204939843 AAGGTACCCCTACATCAGCAAGG - Intronic
1063851883 10:10201353-10201375 CAGGAGCCCCTTCATCAGCAAGG + Intergenic
1067840759 10:49677220-49677242 TTGTACCCTCTACATCTGCAAGG - Intergenic
1090438687 11:126708672-126708694 GAGGTCCCGGTCCATCAGCAAGG - Intronic
1100336431 12:93634470-93634492 CAGGACCTGCTACATTAGTAAGG - Intergenic
1116639150 14:47438713-47438735 TAGGACCTGATTCATTAGCATGG + Intronic
1116712614 14:48387664-48387686 TAGGACCAGCTTCATGGGCATGG + Intergenic
1120915128 14:89703748-89703770 TAGGACCAGCTGCAGCAGCAAGG - Intergenic
1124905743 15:33867045-33867067 TAGGCCCCTCTACATCAGATGGG + Intronic
1138224443 16:55280826-55280848 TGGGAACCGCTCCAGCAGCAGGG - Intergenic
1139570380 16:67807928-67807950 TATGACCAGCTCCATCAGCCTGG + Intronic
1156828080 18:41457344-41457366 TAGGACCCCTTTCATCACCAAGG + Intergenic
930852075 2:55972229-55972251 TATGACCAGCTACAGAAGCAGGG - Intergenic
937925084 2:127162024-127162046 TACGACCAGCAAGATCAGCAGGG - Intergenic
938276843 2:130033967-130033989 TAGGACCCACTGCCCCAGCAGGG + Intergenic
938327813 2:130424748-130424770 TAGGACCCACTGCCCCAGCAGGG + Intergenic
938362133 2:130696730-130696752 TAGGACCCACTGCCCCAGCAGGG - Intergenic
938438542 2:131303429-131303451 TAGGACCCGCTGCCCCAGTAGGG - Intronic
946416407 2:219542170-219542192 TAGGACCCGCTACATCAGCACGG - Exonic
1175435685 20:58945944-58945966 TAGGAACCTCGACATCACCATGG + Intergenic
1178319353 21:31593318-31593340 TGGGTCCCGCTACAGCAGGATGG + Intergenic
949627229 3:5880545-5880567 CAGGACCAGCTACATTTGCAAGG + Intergenic
957974627 3:87427415-87427437 CAGGACTCACTACATCAGGATGG + Intergenic
963342716 3:144056515-144056537 TCGGACCCGCTGAATCAGAATGG + Intergenic
963559852 3:146850226-146850248 TAGAAGCCACTACATCAGCTTGG + Intergenic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
974373752 4:61049844-61049866 TAGGATCAGCCACAGCAGCAGGG - Intergenic
975277839 4:72522409-72522431 TAGCACCCACTACATCATCCTGG + Intronic
984957831 4:185063355-185063377 CTGGAGCCGCCACATCAGCATGG + Intergenic
1011354189 6:86456952-86456974 TAGCAGCTGCTTCATCAGCATGG - Intergenic
1012662980 6:101927041-101927063 TAGGAGCAACTACATCAGAAAGG + Intronic
1020161713 7:5778168-5778190 TAAGGCCCGCTATGTCAGCAAGG - Intronic
1034644587 7:152633836-152633858 TGGGAGCCGCCACAGCAGCAGGG - Intergenic
1037036602 8:14176999-14177021 CAGGACACGTTACATCACCAAGG + Intronic
1038825013 8:30990340-30990362 TAGGACCAGCTACAGGAGGAGGG + Intergenic
1052642432 9:31186124-31186146 TAGGAGCCACTTCCTCAGCAAGG + Intergenic
1054716070 9:68559004-68559026 GAGGACCAGCTACAGCAGGAAGG - Intergenic
1057048301 9:91902695-91902717 AAGAAACCGCTTCATCAGCATGG + Intronic
1058074815 9:100639966-100639988 TAGCATCAGCTCCATCAGCAAGG - Intergenic
1194965496 X:100284270-100284292 CAGGCCCTGCTGCATCAGCATGG - Intergenic