ID: 946416664

View in Genome Browser
Species Human (GRCh38)
Location 2:219543442-219543464
Sequence AGGTGACGCTGAGCAGGCTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946416656_946416664 2 Left 946416656 2:219543417-219543439 CCTGGGCCGCACGGCTCCTCCAC 0: 1
1: 1
2: 3
3: 17
4: 227
Right 946416664 2:219543442-219543464 AGGTGACGCTGAGCAGGCTCAGG 0: 1
1: 1
2: 1
3: 19
4: 193
946416654_946416664 17 Left 946416654 2:219543402-219543424 CCAGGTTGGGGCGGGCCTGGGCC 0: 1
1: 1
2: 2
3: 52
4: 370
Right 946416664 2:219543442-219543464 AGGTGACGCTGAGCAGGCTCAGG 0: 1
1: 1
2: 1
3: 19
4: 193
946416658_946416664 -4 Left 946416658 2:219543423-219543445 CCGCACGGCTCCTCCACCCAGGT 0: 1
1: 0
2: 1
3: 23
4: 234
Right 946416664 2:219543442-219543464 AGGTGACGCTGAGCAGGCTCAGG 0: 1
1: 1
2: 1
3: 19
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946416664 Original CRISPR AGGTGACGCTGAGCAGGCTC AGG Exonic
900102602 1:968237-968259 AGCTGCCCCTGAGCAGGCCCAGG - Intronic
900189368 1:1346771-1346793 TGGGGACGCTGAGGAGGCCCTGG - Intronic
900322037 1:2089538-2089560 AGAAGACTCTGAGAAGGCTCTGG - Intronic
900351192 1:2235463-2235485 AGGTGACCCTCAGGAAGCTCTGG + Intronic
901803039 1:11720262-11720284 AGGTGACTCTTAGCATGTTCAGG - Exonic
902289295 1:15426289-15426311 ACTTGACCCTGTGCAGGCTCTGG + Intronic
903461960 1:23526501-23526523 AGGTGTGGCTGGGGAGGCTCTGG - Intronic
904442781 1:30542551-30542573 AGGTGAGCCTGTGCAGGCTAGGG + Intergenic
905667107 1:39769795-39769817 AGCTGACGCTGAGGGAGCTCTGG - Exonic
906661817 1:47588311-47588333 TGGAGCCGCTGAGCAGGCTCCGG - Intergenic
907425350 1:54375905-54375927 AGGTGGTGCTGACCAGGCTCTGG + Intronic
907502138 1:54888311-54888333 AGGTGGCCCTGAGCTGGCTTCGG - Intergenic
908581937 1:65525620-65525642 AGGTGGGGCTGAGCAGGAGCAGG - Intronic
909415519 1:75401757-75401779 AGGTGATACTCAGCAGCCTCAGG - Intronic
910875635 1:91875320-91875342 AGGTGACACTGTGGAGGCTGTGG + Intronic
910923262 1:92372357-92372379 ATGTGCCACTGAGCAGGCTTAGG - Intronic
920262363 1:204697925-204697947 AGGTGAAGCTGATTAGGCTTAGG - Intergenic
921219643 1:212964136-212964158 AGGTGACTCTGAGTAGCATCTGG + Intronic
921322975 1:213961200-213961222 TGGTCACTCTGAGCAGGCTAGGG + Intergenic
924374405 1:243390443-243390465 AGGTGGAGCAGAGCAGGCTCAGG - Intronic
1065815032 10:29475560-29475582 AGGTGACGCCAGGCAGGGTCAGG + Intronic
1067057000 10:43058238-43058260 AGGTGATGGTGAGCAGGTTTTGG - Intergenic
1067692203 10:48509102-48509124 AACTGTAGCTGAGCAGGCTCTGG + Intronic
1068244746 10:54350280-54350302 AGGGGAGGATGGGCAGGCTCAGG + Intronic
1069718118 10:70533748-70533770 AGGTGGAGCTGATCAGGCTGTGG + Intronic
1070145427 10:73770423-73770445 AGGAGACGCTGAAAAGGCTCTGG - Exonic
1070555881 10:77527484-77527506 AAGTGACCCTGAGTTGGCTCTGG - Intronic
1071541218 10:86485955-86485977 TGTTGAAGCTGAGCAGGTTCTGG - Intronic
1072562220 10:96586854-96586876 AGGAGTCGGTGAGCCGGCTCCGG - Exonic
1076188448 10:128466638-128466660 GGGAGAAGCTGAGCTGGCTCTGG + Intergenic
1076844378 10:133061830-133061852 GGGTGACCCTGGGCAGGCCCAGG - Intergenic
1077051174 11:567796-567818 AGGTGGCCCTGGGCAGGCACAGG - Intergenic
1077164727 11:1129901-1129923 AGGTGGAGCTGGGCAGGCTTAGG + Intergenic
1078019091 11:7640533-7640555 AGCTGAGGCTGAGGAGCCTCAGG - Intronic
1078670865 11:13364012-13364034 AGGTAATGCTGGGCAGGGTCAGG - Intronic
1078766723 11:14305519-14305541 AGGTCAGGCTGAGAAGGCTGGGG - Intronic
1083680446 11:64349305-64349327 AGGGCAAGCAGAGCAGGCTCAGG - Intronic
1084652519 11:70497562-70497584 ACGTGATGCTGACCAGGCACAGG + Intronic
1085514986 11:77106662-77106684 GGGTGACTGTGTGCAGGCTCCGG - Intronic
1093517028 12:19999929-19999951 AGGTGATCCTGAGCATGCTATGG + Intergenic
1100390083 12:94140348-94140370 AGCAGACGCTGGGCATGCTCTGG + Intergenic
1101315673 12:103626891-103626913 AGGAGGCACTGAGCAGGCTGGGG - Intronic
1102217159 12:111169655-111169677 ACGTGACGCGAAGCAGGCTGCGG - Intronic
1103031083 12:117613460-117613482 AGGTGCCACTGATCAGCCTCGGG - Intronic
1103413622 12:120729819-120729841 AGGTGACTGTGTCCAGGCTCTGG + Intronic
1103719629 12:122966316-122966338 AGGGGGCGCGCAGCAGGCTCGGG + Intronic
1104609806 12:130218860-130218882 AGGTGAGGCTGAGCTTGCACGGG + Intergenic
1104720443 12:131042333-131042355 GGGTAGCGCTGGGCAGGCTCCGG - Intronic
1104744759 12:131203890-131203912 GGGTGACACTGAGCAGGGACAGG - Intergenic
1104900719 12:132188322-132188344 AGGTGCCGTTCTGCAGGCTCTGG - Intergenic
1110946751 13:81430839-81430861 AGCTGAGGCTGAGCAGTCTTAGG + Intergenic
1112261617 13:97882683-97882705 GGAGGACGCTGAGCAGGGTCAGG - Intergenic
1113510859 13:110853800-110853822 AGGAGACACTGGGGAGGCTCGGG + Intergenic
1113782172 13:112982983-112983005 TGGTGACGCTCAGGAGGCGCTGG + Intronic
1113891475 13:113737830-113737852 AGGTGCACCTGAGCAGGCGCAGG + Intergenic
1117491069 14:56248728-56248750 GGGTGACTCTAATCAGGCTCAGG + Intronic
1120855250 14:89206269-89206291 ATGTGTCCCTGACCAGGCTCTGG - Intronic
1122024950 14:98869011-98869033 AAGTGAGGCTGAGCAGCCCCGGG + Intergenic
1122112781 14:99513703-99513725 AGGTGGGGCTGAGCAGCCCCTGG + Exonic
1122882010 14:104694411-104694433 AAGAGACGCTGAGCAGGGGCTGG + Intronic
1124645330 15:31434354-31434376 AGGTGGCATTGAGCTGGCTCTGG + Intronic
1125313010 15:38401158-38401180 AGGTGTCCCTGATAAGGCTCTGG + Intergenic
1128379415 15:67101038-67101060 AGGTGAGGCTCAGGAGGCTCTGG + Intronic
1129874698 15:78966021-78966043 CAGAGATGCTGAGCAGGCTCTGG + Intronic
1131645362 15:94336420-94336442 AGGTGAAGAAGAGCAGGATCTGG + Intronic
1132296528 15:100738776-100738798 CTGTGACCCTGGGCAGGCTCTGG + Intergenic
1132896609 16:2232277-2232299 AGGGGAGGGTGAGCAGGCCCAGG + Exonic
1132947015 16:2537583-2537605 AGTTTACGCAGAGCCGGCTCCGG + Intergenic
1136562535 16:31048716-31048738 AGGAGACACACAGCAGGCTCTGG - Intergenic
1136612054 16:31372240-31372262 CGGTGACGCTGAGCAGGCTCTGG + Intronic
1137381261 16:48001813-48001835 AAGTGCTGCTGGGCAGGCTCAGG + Intergenic
1138685539 16:58722130-58722152 CGGGTAAGCTGAGCAGGCTCTGG - Exonic
1139641328 16:68293853-68293875 AGGTGATGCTGACCATGCTGGGG + Intronic
1140504833 16:75464671-75464693 AGGTGACGCTGAGGCGGCGAGGG - Exonic
1141580446 16:84994556-84994578 AGGCGGAGCTGAGCTGGCTCAGG - Intronic
1142171964 16:88627625-88627647 AGGAGACGCTGCTCACGCTCAGG - Exonic
1142187240 16:88700451-88700473 TGGTGCGGCTGAGCAGGCTGTGG - Intronic
1142282741 16:89156990-89157012 AACTGAGGCAGAGCAGGCTCAGG - Intergenic
1142344742 16:89546774-89546796 ACGTGACGCTGCCCAGGCTGCGG - Intronic
1142985371 17:3691892-3691914 AGTTGAGGTGGAGCAGGCTCAGG + Intronic
1143124582 17:4633321-4633343 AAGTGAGGGTGAGCAGGGTCAGG + Intronic
1143496692 17:7316484-7316506 GGGTGTAGCTGAGCAGGCTTTGG - Intronic
1145737675 17:27244541-27244563 AGGGGCCGCTGAGCCGGCTGGGG - Intergenic
1146259817 17:31414024-31414046 AGCTGACACAGAGCAGGCTCGGG - Intronic
1146521217 17:33527006-33527028 GGGTGATGCTGGGCTGGCTCAGG + Intronic
1146624499 17:34425138-34425160 AGGGGAAGGTGAGCAGGCTAGGG - Intergenic
1146696144 17:34910256-34910278 AGGTGACACTAAGCAGGCTCTGG + Intergenic
1147258786 17:39197021-39197043 GGGCGACGCAGAGCACGCTCGGG - Intronic
1147333037 17:39710018-39710040 AGGTGATGCTGATGAGGGTCTGG + Intronic
1147897313 17:43759020-43759042 AGGTGCCGGAGAGCAGGCTTGGG - Intergenic
1147951836 17:44111788-44111810 AGCTGAGGCTGAGCAGCCTCTGG - Intronic
1148872643 17:50667861-50667883 AGGTGACCCTGATCACCCTCTGG + Exonic
1151364034 17:73605589-73605611 AGGTGATGCTGGGCTGACTCAGG - Intronic
1152008657 17:77697504-77697526 AGGTGACGCTCAGCAGATTTGGG - Intergenic
1152728007 17:81957129-81957151 GGCTGACGCTGAGCAGACTCGGG - Intronic
1153956667 18:10102196-10102218 AGCTCACACTGAGCAGGTTCAGG + Intergenic
1154147856 18:11880904-11880926 AGGCCACGCTGAGCAGGTGCTGG - Intronic
1157799002 18:50603216-50603238 AGGTGATGCTGACCAGGGTGAGG + Intronic
1160811688 19:1015559-1015581 ACGTGACCCTCACCAGGCTCGGG - Intronic
1160832406 19:1109974-1109996 AGGTAACCCCGAGCAGGCTGTGG + Intronic
1160933242 19:1580637-1580659 AGGTGAGGCTGAGCAGCCCAGGG - Intronic
1160977445 19:1800281-1800303 TGGTGACGCTGAGCAGGATGAGG + Exonic
1161507108 19:4649988-4650010 AGTGGAGGCTGAGCAGGGTCTGG + Intronic
1161720135 19:5897855-5897877 TGGTGAAGCTGGGCGGGCTCTGG - Intronic
1162926837 19:13934473-13934495 AGGCGACCCTGAGCAGGGTGTGG - Intronic
1163533520 19:17864099-17864121 AAGTGACGCTGTGCAGGTGCTGG + Intronic
1165374475 19:35432084-35432106 AGGTGACTTTGAGAAGGCTGGGG + Intergenic
1165475260 19:36026671-36026693 ATGTGACGCTGCGCAGCCGCTGG - Exonic
1166047801 19:40239862-40239884 TGGTGGGGGTGAGCAGGCTCGGG - Intronic
1168452856 19:56479268-56479290 AGGTGACTCTGAGCAAGTTTTGG + Intergenic
1168591044 19:57634315-57634337 AGGTGAGGCTGAGCTGGTTCAGG + Intronic
1168651979 19:58097618-58097640 GGGGGACGCTGGGCAGGCTGTGG - Intronic
925380099 2:3418882-3418904 AGGTGAGGCAGAGGAGGGTCGGG - Intronic
927515078 2:23667608-23667630 TGGTGACGCTGAGCAGGGCCTGG - Intronic
929011087 2:37445843-37445865 AGATGAGGATGAACAGGCTCAGG - Intergenic
931823416 2:65975160-65975182 AGGTGAAGCAAAGCAGGCCCAGG + Intergenic
933644289 2:84798248-84798270 TGGTGACTCTGAGCAGGCCTAGG - Intronic
934036024 2:88088951-88088973 TGGTGAAGGTGAGCAGGCTGAGG + Intronic
936540699 2:113348488-113348510 AGGTGACTCAGAGCAGGAGCAGG - Intergenic
938427249 2:131202315-131202337 AGGTGAGGGTGAGTGGGCTCCGG + Intronic
939120367 2:138109443-138109465 AGGTGGCCCTGAGCTGGCCCAGG - Intergenic
946029378 2:216692718-216692740 AGGGGAGGATGTGCAGGCTCTGG - Intronic
946416664 2:219543442-219543464 AGGTGACGCTGAGCAGGCTCAGG + Exonic
947822586 2:233082442-233082464 TGGTGGCACTGAACAGGCTCAGG - Intronic
948405314 2:237713035-237713057 AGGCGTTTCTGAGCAGGCTCAGG + Intronic
949018021 2:241724528-241724550 TGGTGACTCTGAGCAAGTTCTGG - Intronic
949042890 2:241857685-241857707 AGGTGCCGGGGAGCAGGCCCCGG + Intronic
1170373950 20:15679543-15679565 AAGTGATGCTGTGCAGGTTCTGG + Intronic
1171186727 20:23128320-23128342 GGGAGATGCTGAGCAGGCTGAGG - Intergenic
1172952512 20:38730996-38731018 AGGAGACACTAGGCAGGCTCCGG + Intergenic
1174544830 20:51317535-51317557 AGGAGACACTGACCAAGCTCAGG - Intergenic
1175756316 20:61532693-61532715 ATGTGAGGTGGAGCAGGCTCTGG + Intronic
1175891694 20:62318613-62318635 AGGAGCAGCTGAGCAGCCTCTGG - Exonic
1175980193 20:62734978-62735000 AGGGGAGGCTGTACAGGCTCTGG - Intronic
1176257436 20:64159627-64159649 AGGTGACCCTGAGCTGCCTGGGG + Intronic
1178992558 21:37367463-37367485 AGGAGAGACTGAGCAGGCTGCGG + Intronic
1179905744 21:44422144-44422166 AGGGGACGGTGACCAGGCTAGGG - Intronic
1180701936 22:17785889-17785911 TGGTGAAGCTGAGCAGCCACAGG + Intergenic
1182699957 22:32228666-32228688 AGGGGACCCTGAGCAGCCTGGGG - Intronic
1183333806 22:37235415-37235437 AGGTGACATTGAGCAGGGGCTGG - Intronic
1184171310 22:42761381-42761403 GGGTGGCACTGAGCAGGCTCAGG - Intergenic
1184773623 22:46612433-46612455 TGGTGGTGTTGAGCAGGCTCAGG + Intronic
950424789 3:12919329-12919351 AAGGGGCGCTGAGCAGGCTGGGG - Intronic
950538021 3:13592874-13592896 AGGTGTGGCTGAGCTCGCTCAGG + Intronic
951306521 3:21069610-21069632 AGGTGAGGCAGAACAGGCTTAGG + Intergenic
951889797 3:27557745-27557767 AGGCCATGCTGAGCAGTCTCTGG + Intergenic
954426446 3:50445861-50445883 AGGTGCTCCTGAGCAGGCTCTGG + Intronic
956163969 3:66382554-66382576 GAGTAAAGCTGAGCAGGCTCTGG - Intronic
957740008 3:84253227-84253249 TGGTGACCCTGTGCAGGCCCAGG + Intergenic
960449719 3:117791325-117791347 AGGAGAAGCTGAGGAGGCTGTGG - Intergenic
967845777 3:194041505-194041527 AGCTGACGCTGAACCGGCTGTGG - Intergenic
969583222 4:8077442-8077464 AGGTGGCACTGGGCAGGCCCTGG + Intronic
969676579 4:8617717-8617739 AGGTCACGCTGAGCAGGACCAGG - Intronic
971303020 4:25457285-25457307 AGGAGAGGCTTAGCAGGGTCCGG - Intergenic
971657160 4:29363562-29363584 AGGTGAAGAGGAGCAGGCTATGG + Intergenic
974496997 4:62644291-62644313 ATGGGAAGCTGAGCAGGCTAAGG - Intergenic
985387983 4:189466220-189466242 AGGTGAAGCTAAGCAGCCTGGGG + Intergenic
985388218 4:189467207-189467229 AGGTGAAGCTAAGCAGCCTGGGG + Intergenic
985474408 5:71280-71302 AGGTGTCACTGAGTGGGCTCTGG - Intergenic
985653340 5:1117163-1117185 AGGGGCCACTGAGCAGGCTGGGG + Intergenic
985888220 5:2696611-2696633 AGGGGAGGGTGAGCAGACTCAGG - Intergenic
987438385 5:17925821-17925843 AGGTGATGCGGAGCAGGCCCAGG + Intergenic
987946416 5:24614914-24614936 AGATGACGATGTACAGGCTCTGG + Intronic
990989327 5:61669833-61669855 AGGAGAGGGAGAGCAGGCTCTGG - Intronic
991050400 5:62266745-62266767 GGGTGACGCTGACCAAGTTCTGG + Intergenic
991663005 5:68969416-68969438 AGTGGACCCTGAGCAGGCTGGGG - Intergenic
994218126 5:97161698-97161720 AGGTAAAGCTGAGCAGGATAAGG + Exonic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
1002201837 5:177533164-177533186 AGGTGCTTCTGAGCAGACTCTGG + Intronic
1002522200 5:179798144-179798166 AGGTGAGGCTGGGCAGGGCCAGG - Exonic
1002534499 5:179868837-179868859 AGGGCAGGCTGAGGAGGCTCAGG + Intronic
1005391623 6:25339765-25339787 AGGTCACACTGAGCAGGGTTGGG - Intronic
1006576280 6:35048831-35048853 TGGTGAGGCTGAGGAGGCTGCGG + Intronic
1008590700 6:52990785-52990807 AAGTGAAGTTGAGCAGGTTCAGG + Intronic
1013171175 6:107637488-107637510 AGGTGACTGTGAGAAGGCTGAGG - Intronic
1013290364 6:108714168-108714190 AGCTGAGGCTGAGCAGTCACTGG - Intergenic
1015580038 6:134714383-134714405 AGGTGTCCATGAGTAGGCTCTGG - Intergenic
1019662941 7:2235319-2235341 GGGTCACGCTGAGAAGGGTCAGG + Exonic
1020606330 7:10341895-10341917 ACTTGACTGTGAGCAGGCTCTGG - Intergenic
1023035312 7:36126441-36126463 AGGTGTCAGTGAGCAGGCTGTGG + Intergenic
1024983741 7:55178541-55178563 AGGCCACCCTGAGCAGGGTCAGG - Intronic
1027131496 7:75594345-75594367 AGGTGACCCTGAACAGGGCCAGG - Intronic
1030304584 7:108004990-108005012 AGAGGACGCTGAGCAGGGACAGG - Intergenic
1032784993 7:135193745-135193767 GGGTGAGGCTGGGCAGGCTGTGG + Intronic
1034140135 7:148807965-148807987 AGGGGAGGCTGGTCAGGCTCTGG - Intronic
1034738989 7:153455994-153456016 AGGTGAGGTTGAGGAGGCTGAGG + Intergenic
1034850559 7:154489529-154489551 TTGTGATGCTGAGCAGGTTCTGG + Intronic
1036207336 8:6814979-6815001 GGGTGACAGAGAGCAGGCTCTGG + Intronic
1036560854 8:9899277-9899299 AGGAGAAGATGAGCAGGCGCTGG - Intergenic
1040275353 8:46011019-46011041 AGGTGACGTTGAGGCAGCTCAGG - Intergenic
1041118213 8:54560967-54560989 AGGTGCCACTTTGCAGGCTCAGG + Intergenic
1041719498 8:60963481-60963503 AGGTGACTCTGAACAGGCCGGGG - Intergenic
1042614563 8:70634098-70634120 AGGTGACGACAAGCAGGCTTCGG + Intronic
1043395487 8:79831801-79831823 AGGTGACACTGCACAGGCACGGG + Intergenic
1047976117 8:130132499-130132521 AGGTAAGGCTGAGCTGGCTCAGG - Intronic
1049391640 8:142374764-142374786 AGGAGGCTCTGAGAAGGCTCTGG + Intronic
1049570976 8:143370175-143370197 AGGTGACGCTTTTCAGGCTGGGG + Intronic
1051138756 9:13954419-13954441 AGAGGACGCTGACTAGGCTCTGG + Intergenic
1052866842 9:33469192-33469214 AGGGGATGGTGAGCAGGCCCTGG - Exonic
1053076627 9:35139326-35139348 AGGTGACCATGAGCAGCCACGGG - Intergenic
1056269437 9:84932359-84932381 AGGTGAAGCTGAACAAGCTCTGG + Intronic
1057726648 9:97572799-97572821 GGGTGACACGGAGCTGGCTCAGG + Intronic
1058120236 9:101130297-101130319 AGATGACGCTGAGCAGATTGGGG + Intronic
1058720772 9:107761487-107761509 GGGAGAGGCTGAGCAGGCTCCGG + Intergenic
1059460158 9:114424493-114424515 AGGTGACCCTGAGCAGCCTGGGG - Exonic
1060784450 9:126439169-126439191 TGATGCCTCTGAGCAGGCTCTGG + Intronic
1060797122 9:126520202-126520224 AGGTGACCCACAGCAGGCTGTGG - Intergenic
1061019974 9:128008084-128008106 AGGAGAGACAGAGCAGGCTCCGG + Intergenic
1061208588 9:129178010-129178032 GGGAGATGCTGATCAGGCTCTGG + Exonic
1062166349 9:135109519-135109541 AGGGTGCTCTGAGCAGGCTCCGG - Intronic
1062351514 9:136141961-136141983 AGCTGAGGGTGAGCAGCCTCCGG - Intergenic
1186059842 X:5692481-5692503 AGGTGACGCTGAACCAGGTCTGG + Intergenic
1191254000 X:58272028-58272050 GGGTGAGGTTGAGCAGGCTGGGG - Intergenic
1196611117 X:117715941-117715963 AGGTGACGGGGAGAAGGATCTGG - Intergenic
1200127391 X:153822529-153822551 AGGCGAGGCTGAGCAGCCTGGGG - Intronic