ID: 946416673

View in Genome Browser
Species Human (GRCh38)
Location 2:219543482-219543504
Sequence GCCCACGGCCACGGGCCCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946416659_946416673 26 Left 946416659 2:219543433-219543455 CCTCCACCCAGGTGACGCTGAGC 0: 1
1: 0
2: 1
3: 25
4: 181
Right 946416673 2:219543482-219543504 GCCCACGGCCACGGGCCCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 254
946416662_946416673 20 Left 946416662 2:219543439-219543461 CCCAGGTGACGCTGAGCAGGCTC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 946416673 2:219543482-219543504 GCCCACGGCCACGGGCCCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 254
946416663_946416673 19 Left 946416663 2:219543440-219543462 CCAGGTGACGCTGAGCAGGCTCA 0: 1
1: 0
2: 1
3: 15
4: 151
Right 946416673 2:219543482-219543504 GCCCACGGCCACGGGCCCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 254
946416660_946416673 23 Left 946416660 2:219543436-219543458 CCACCCAGGTGACGCTGAGCAGG 0: 1
1: 0
2: 4
3: 15
4: 208
Right 946416673 2:219543482-219543504 GCCCACGGCCACGGGCCCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946416673 Original CRISPR GCCCACGGCCACGGGCCCTG CGG Exonic
900000814 1:13926-13948 GCCCCCAGGCAGGGGCCCTGTGG - Intergenic
900020529 1:184443-184465 GCCCCCAGGCAGGGGCCCTGTGG - Intergenic
900043001 1:487951-487973 GGGCACGGCCACTGCCCCTGGGG + Intergenic
900124794 1:1064602-1064624 GCCCACGGCCCTGGTGCCTGTGG - Intergenic
900503966 1:3019942-3019964 GGGCACGGCCTAGGGCCCTGAGG - Intergenic
900659606 1:3776005-3776027 CCCCACAGACACGGACCCTGCGG + Intergenic
902503374 1:16924835-16924857 TCCCATTGCCACGGGCCTTGGGG + Intronic
904866522 1:33583483-33583505 CCCCAAGGCCATGGGACCTGAGG - Intronic
905202077 1:36322315-36322337 CCCCACGGCCACGGGCACCCTGG - Exonic
905646323 1:39626983-39627005 GCCCACGCCCACTGGCCCTTTGG - Exonic
905886809 1:41496192-41496214 GCCCCCCGCCACGGGCCCCACGG + Intergenic
906700183 1:47852134-47852156 AGCCACCGCCATGGGCCCTGGGG + Intronic
907319492 1:53593820-53593842 GCACACAGCCCCGGGCCCTGTGG + Intronic
910550331 1:88467344-88467366 GCCCACGGCGCCGGGGGCTGGGG - Intergenic
916060986 1:161098525-161098547 GGCCACCGCCATGGGCCCCGGGG - Exonic
916284653 1:163093400-163093422 GTCCATGGGCACAGGCCCTGGGG - Intergenic
919455808 1:197818546-197818568 GCCCACAGCCAGTGGACCTGGGG + Intergenic
919521722 1:198597850-198597872 CCCCAGTGCCAAGGGCCCTGTGG + Intergenic
919974334 1:202600876-202600898 GTCCACCACCAAGGGCCCTGGGG + Intronic
922042580 1:221911193-221911215 GCCCACAGACACGGGTCCTAAGG + Intergenic
922763113 1:228144598-228144620 GCCCAGGGCCAGGCCCCCTGGGG + Intronic
922817372 1:228459345-228459367 GCGCAAGACCACGGGCTCTGAGG + Exonic
1063064475 10:2594573-2594595 GCCAACGCTCAGGGGCCCTGTGG + Intergenic
1063125086 10:3130001-3130023 TCCCAAGGGGACGGGCCCTGAGG - Intronic
1063352806 10:5372275-5372297 GCCCATGGCCACTGTCCCTGAGG - Intronic
1065428460 10:25630180-25630202 TCCCACGGCCAGGGGTTCTGAGG + Intergenic
1065845149 10:29737079-29737101 GCCCACGCGCACGCGCCCAGCGG + Intergenic
1067015300 10:42753675-42753697 GGCCACTGTCACGGGTCCTGTGG - Intergenic
1067854155 10:49777377-49777399 GCCCAGAGCTACGGGCTCTGAGG + Intergenic
1068005391 10:51387227-51387249 CCCCTTGACCACGGGCCCTGTGG - Intronic
1071567937 10:86681152-86681174 ACCCACTTCCTCGGGCCCTGGGG + Intronic
1071603725 10:86971128-86971150 ACCCAGGGCCACGGCCCCTCAGG + Intronic
1073249818 10:102114631-102114653 GCCCCCGGCCCCCGGCCCAGTGG - Intronic
1076701519 10:132275613-132275635 GCCCCTGGCCACTGGCCCCGTGG - Intronic
1076701756 10:132276886-132276908 AGCCACGGCCTCGAGCCCTGGGG - Intronic
1077106897 11:846081-846103 CCCCAGGCCCACGGGCTCTGAGG - Intronic
1077451693 11:2652145-2652167 GCCCGCGCCCTCGGGGCCTGGGG + Intronic
1077461616 11:2713652-2713674 GGCCACAGCCACAGGCTCTGCGG + Intronic
1077532385 11:3103346-3103368 GCCCACGGCCCCCGGAGCTGGGG - Intronic
1083658770 11:64242444-64242466 GGCCACGGCCACGGGGGCCGAGG + Exonic
1087104705 11:94398088-94398110 TCCCAAGGCCATGGGCCTTGTGG + Intronic
1091596906 12:1884476-1884498 GCCCAGGGCCATGGGGACTGCGG + Intronic
1091613967 12:2035104-2035126 GGCCACGCCCCCGGGCCTTGCGG - Intronic
1092406507 12:8225103-8225125 TACCTAGGCCACGGGCCCTGTGG - Intronic
1096180757 12:49549246-49549268 GCCCCCGGCCTCAGGCCCTCCGG - Intronic
1096504898 12:52086612-52086634 GCCCACGCCCACGGCTCCTCTGG + Intergenic
1096529643 12:52234591-52234613 GCTCAGGGCCCCAGGCCCTGGGG - Intronic
1101504126 12:105330837-105330859 GCTCTCGGCCGCGGGTCCTGGGG - Exonic
1101771975 12:107760673-107760695 GTGCACGGCCACCGGCCCTCGGG - Exonic
1103932347 12:124457454-124457476 GCCCACGTCGCTGGGCCCTGGGG - Intronic
1104103229 12:125634950-125634972 GCCCAGGGCCAGTGGACCTGGGG - Intronic
1104895054 12:132159893-132159915 GGACACAGCCACGGGCTCTGGGG + Intergenic
1106568372 13:30906188-30906210 GCCCACGGCCACGACCCCAGAGG - Exonic
1108597064 13:51958602-51958624 ACACAGGGCCAAGGGCCCTGGGG + Intronic
1109152502 13:58861270-58861292 GTCCATGGCCACAGGCCCAGGGG + Intergenic
1111122989 13:83879093-83879115 GCCCTCGGCCCCGGGGCCTGTGG - Exonic
1113885280 13:113655571-113655593 GCCCATGGCCACGGGGACGGTGG - Intronic
1114522221 14:23346920-23346942 GGCCCAGGCCACGGCCCCTGGGG + Exonic
1118760559 14:68878314-68878336 CCCCAAGGACATGGGCCCTGGGG + Intronic
1121775840 14:96590263-96590285 GCCCAAGGCCGCAGGCTCTGAGG + Intergenic
1123018178 14:105385352-105385374 TCCCTGGGCCTCGGGCCCTGTGG + Intronic
1123982809 15:25619469-25619491 TCCACCGGCCACGGGCCATGGGG + Intergenic
1124550693 15:30678574-30678596 GACCAGGGCCATGGGCCATGTGG - Intronic
1124577515 15:30922952-30922974 GCCCACAGGCACAGGCTCTGCGG - Intronic
1124680555 15:31727037-31727059 GACCAGGGCCATGGGCCATGTGG + Intronic
1125522494 15:40356130-40356152 GGCCATGGCCCAGGGCCCTGCGG + Exonic
1125522526 15:40356196-40356218 GGCCATGGCCCAGGGCCCTGCGG + Exonic
1128776032 15:70321275-70321297 GACCACTGCCAAGGGCTCTGTGG + Intergenic
1129320272 15:74770881-74770903 GCCCACGGTAGGGGGCCCTGTGG + Intergenic
1132118760 15:99158735-99158757 GCACATGGCCATGGGCACTGTGG - Intronic
1132155844 15:99494888-99494910 GCCCCCGGCCCCGGGCAGTGAGG - Intergenic
1132452696 15:101977019-101977041 GCCCCCAGGCAGGGGCCCTGTGG + Intergenic
1132454203 16:13607-13629 GCCCCCAGGCAGGGGCCCTGTGG - Intergenic
1132502624 16:291329-291351 GCCGGCGGCCACCAGCCCTGGGG + Intronic
1132547570 16:540350-540372 CCCCACGGCCCCGGGCCCGAAGG + Intronic
1132706490 16:1245767-1245789 CCCCACCTCCACGGGCACTGTGG - Intergenic
1132943530 16:2520164-2520186 GCGCAGGGCCACGGGCCCGGCGG - Exonic
1133055438 16:3143383-3143405 CCCCTCAGCCAGGGGCCCTGAGG - Intergenic
1133188363 16:4116062-4116084 GCCCGCGGCGGCGGGCGCTGGGG + Exonic
1134413992 16:14028339-14028361 GCCTAAGGCCATGGGACCTGGGG - Intergenic
1135206833 16:20491924-20491946 CCCCAGGGCGACGGGCTCTGGGG - Intergenic
1135212052 16:20531708-20531730 CCCCAGGGCGACGGGCTCTGGGG + Intergenic
1137270979 16:46901995-46902017 GCCCATGGCCACGGGGTCTTTGG - Intronic
1138549377 16:57739282-57739304 GCCCAGGGCCACGTGACCTCTGG + Intronic
1139254569 16:65528699-65528721 GCCCACTGACCTGGGCCCTGGGG - Intergenic
1139489362 16:67278427-67278449 GCCCAGGCCCATGGTCCCTGGGG - Exonic
1139853378 16:69963467-69963489 GCCCATGGCCGTGGTCCCTGTGG - Intronic
1139882347 16:70186376-70186398 GCCCATGGCCGTGGTCCCTGTGG - Intronic
1139953251 16:70681868-70681890 GCCCTGGCCCAAGGGCCCTGTGG + Intronic
1140370162 16:74409128-74409150 GCCCATGGCCGTGGTCCCTGTGG + Intronic
1140474930 16:75235050-75235072 GGCCACTGCCCCGGGGCCTGAGG - Exonic
1141496586 16:84414619-84414641 CCCCACAGCCACGTGCTCTGGGG - Intronic
1142243667 16:88958679-88958701 GCCCCCAGCCCCCGGCCCTGGGG - Intronic
1143217445 17:5235434-5235456 GCCCACGGCCTCTGACCATGGGG + Intergenic
1144643464 17:16952559-16952581 ACCCCCGTCCACAGGCCCTGTGG + Exonic
1145277834 17:21445398-21445420 CCCCATGGTCCCGGGCCCTGAGG + Intergenic
1148903623 17:50897556-50897578 GCCCAAGGCCACGGAGCCTATGG + Intergenic
1150006071 17:61469792-61469814 TCCCACGGGCACGGGCCAAGAGG - Intronic
1151625021 17:75271089-75271111 GCCCACGGCCCAGGGTCCCGCGG + Exonic
1152374655 17:79912948-79912970 GTCCACCACCACGGGCCCTTAGG + Intergenic
1152812781 17:82390295-82390317 GACCACAGCCACGGACCCTCTGG + Intronic
1152815905 17:82407652-82407674 CGCCACAGCCACTGGCCCTGCGG + Intronic
1152822332 17:82443758-82443780 AGCCAAGGCCACGGGTCCTGTGG + Exonic
1153478318 18:5520751-5520773 GCCTAAGGCCATGGGCCTTGTGG - Intronic
1157564101 18:48668165-48668187 GCCCACCCCCAGGGGCGCTGAGG + Intronic
1157697007 18:49730957-49730979 CCCAAAGGCCTCGGGCCCTGAGG - Intergenic
1157815920 18:50729500-50729522 CCCCACGGCCACGGGGCTGGCGG + Exonic
1160033077 18:75279061-75279083 ACCCCAGGCCAGGGGCCCTGAGG - Intronic
1160235118 18:77079334-77079356 ACCCATGGCCACGGCCACTGTGG + Intronic
1160773378 19:843738-843760 GCCCACGCGCGCGGGGCCTGGGG - Intronic
1161101740 19:2424938-2424960 GCCCCCGGCCCCCGCCCCTGTGG - Intronic
1161120791 19:2525180-2525202 TCCCCGGGCCACGGGCCCCGAGG - Intronic
1161331750 19:3691928-3691950 GCCCACAGGCACAGGCCCCGAGG + Intronic
1161348418 19:3779172-3779194 GCCCTCGGCCACGTGCCTGGGGG + Exonic
1161416570 19:4150397-4150419 CCCCACAGCCACGGGATCTGGGG - Intergenic
1162743497 19:12786471-12786493 GCCCTAGGCCCCAGGCCCTGGGG + Intronic
1162966940 19:14160529-14160551 GCCCAGGGCCCAGGGCCCAGCGG - Intronic
1165213743 19:34254749-34254771 GCCCACGGCCCCGCGCCCTGCGG - Intronic
1165461046 19:35944650-35944672 GCTCACGGCCACGCGGCCTGTGG + Exonic
1165814781 19:38635129-38635151 ACCCACGGCCTCGGGCTTTGGGG + Intronic
1165928492 19:39342105-39342127 GCCCAGGGCAACGGGCCCGGCGG - Intronic
1166234089 19:41443222-41443244 GCCCACCCCCCCAGGCCCTGAGG + Exonic
1166874786 19:45890800-45890822 CACCACGGACACGGGCTCTGGGG + Exonic
1167071768 19:47226270-47226292 GCCCGCGGCCGCGGGGACTGAGG - Intronic
1168062092 19:53898766-53898788 CCCCCCGGCCACGCCCCCTGAGG - Intronic
929857163 2:45647139-45647161 GCTCACAGTCACAGGCCCTGAGG + Intergenic
933938327 2:87225121-87225143 GGCCAAGGACACTGGCCCTGGGG - Intergenic
936354808 2:111740654-111740676 GGCCAAGGACACTGGCCCTGGGG + Intergenic
936568909 2:113599493-113599515 GCCCCCAGGCAGGGGCCCTGTGG + Intergenic
937275258 2:120679918-120679940 GCTCACTGCCATGGGCTCTGTGG - Intergenic
937352464 2:121174942-121174964 GGCCCCGGCCACGGTGCCTGAGG + Intergenic
938487172 2:131723337-131723359 GCCCAAGGCCAAAGGCTCTGTGG - Intronic
939933059 2:148256789-148256811 GCCTAAGGCCATGGGGCCTGAGG - Intronic
941360618 2:164546888-164546910 ACCCATGGCCAGGGGACCTGTGG - Intronic
942290532 2:174465536-174465558 GCCTAGAGCCACAGGCCCTGGGG + Intronic
943906123 2:193502663-193502685 GCCCGCCGCCACGGGCAGTGAGG - Intergenic
946018720 2:216624753-216624775 GCCCAAGGCCACACACCCTGAGG + Intergenic
946412594 2:219522641-219522663 GCCCCCGGCCCCGGGCCTTTTGG + Intronic
946416673 2:219543482-219543504 GCCCACGGCCACGGGCCCTGCGG + Exonic
948468623 2:238163886-238163908 GCCCGCGGCCCCGGGGCCAGGGG - Exonic
948763686 2:240208687-240208709 GCTCACAGCCACGACCCCTGTGG - Intergenic
948807550 2:240459553-240459575 GCCCCAGGCCACTGCCCCTGGGG + Intronic
1169569215 20:6888311-6888333 GCCCACAGCCAGGGGCAGTGAGG + Intergenic
1171104804 20:22422196-22422218 CCCCACTGCAACTGGCCCTGGGG + Intergenic
1171139528 20:22728979-22729001 GCCCATGGCCAAGGGACCAGTGG - Intergenic
1171439456 20:25148551-25148573 GCCCAGGACGCCGGGCCCTGGGG - Intergenic
1171777346 20:29381263-29381285 GCCCACCATCATGGGCCCTGAGG - Intergenic
1171896502 20:30814233-30814255 GCCCAGGGCCCAGGGTCCTGGGG + Intergenic
1172511673 20:35505070-35505092 GCCCACCACCCTGGGCCCTGTGG + Intronic
1172596170 20:36152772-36152794 GCCCAAGGCCACGGCCCCAGGGG + Intronic
1175161579 20:57011782-57011804 GCCCAGGGGGACTGGCCCTGAGG - Intergenic
1175985113 20:62760730-62760752 GCCCAAAGCCACGGAGCCTGCGG - Exonic
1179112078 21:38455960-38455982 CCCCATGGCCAGTGGCCCTGTGG - Intronic
1179621104 21:42617047-42617069 TCACACGGGCACGGGCCCTCTGG + Intergenic
1180065740 21:45411327-45411349 GCCCACAGCCCTGGGCTCTGAGG - Intronic
1180194393 21:46184213-46184235 ACCCATGGCCACGGCCCCTCGGG + Intronic
1180708512 22:17824185-17824207 GCCCCCGGCCAGTGGTCCTGTGG - Intronic
1181017668 22:20080468-20080490 GCCCGCGGCCTCGGTCCCGGAGG - Intronic
1181027302 22:20133349-20133371 GCCCAAGGACAGAGGCCCTGGGG - Intronic
1181035016 22:20165669-20165691 GCCCATGCTCACGAGCCCTGTGG - Intergenic
1181637927 22:24182873-24182895 TCCCATCCCCACGGGCCCTGTGG + Intronic
1182549077 22:31091348-31091370 GCCGACGGCCACGGGCAGCGGGG - Exonic
1184424663 22:44402464-44402486 GCCCACTGCCCCAGGCCCTGTGG - Intergenic
1184697380 22:46147633-46147655 GCCCACGGCCCCTGCCCCGGTGG + Intergenic
1184829342 22:46974426-46974448 GCCCACGCCCACAGCCCCTGCGG + Intronic
949889972 3:8726431-8726453 GCCCACAGCCACTGGCTCCGTGG - Intronic
950648449 3:14392469-14392491 GCCCACGGGCAGGGACTCTGGGG - Intergenic
954875524 3:53800615-53800637 GGCCACAGCCGCTGGCCCTGTGG + Intronic
961359294 3:126357146-126357168 GAGCACGGCCACGCGCCCCGAGG + Intronic
961459154 3:127039325-127039347 GCCACGGGCCACGGGCCCTGGGG - Intergenic
961477038 3:127153394-127153416 GCCCAAAGCCATGGACCCTGTGG - Intergenic
961713865 3:128846010-128846032 GGCCAAGGCCAAGGGCCCTCTGG + Intergenic
963035164 3:141019507-141019529 GCCCGCGGCCCGGGCCCCTGTGG + Intergenic
966905845 3:184525550-184525572 GCCCCCGGCCCCCGGCCCCGGGG - Intronic
968130402 3:196189773-196189795 GGCCACGACCAGGGGCCCTCAGG + Intergenic
968429104 4:544823-544845 CACCACCACCACGGGCCCTGGGG + Intergenic
968618506 4:1593026-1593048 GCCCTCGGCCCTGGGCACTGGGG - Intergenic
968737451 4:2304708-2304730 CCCCTCGGCCACGGGCTCCGAGG + Exonic
968916817 4:3500254-3500276 GTCCACAGCCACGGGTCCTGGGG - Intronic
969001944 4:3989506-3989528 GTCCATGGGCACAGGCCCTGTGG + Intergenic
970593282 4:17577597-17577619 GCCCACGGGCAGGGCCCCAGCGG - Intronic
975719190 4:77233894-77233916 TCCAAAGGCCAGGGGCCCTGAGG - Intronic
976854167 4:89583062-89583084 GGCCACTGCCTAGGGCCCTGGGG + Intergenic
981603834 4:146521986-146522008 GCCCGCGGCCAGAGGCGCTGGGG - Intergenic
984771921 4:183444199-183444221 GCCCGCAGCCGCGGGGCCTGTGG - Intergenic
985644223 5:1077557-1077579 GCCCACAGCCACGTGTCCAGAGG - Intronic
986192777 5:5512118-5512140 TCCCACGGCCGCTGGCCCTCCGG - Intergenic
986873836 5:12081732-12081754 ACCCACTGCCTAGGGCCCTGGGG + Intergenic
992067356 5:73120358-73120380 GCGCACGGCCACGAGCGCGGAGG + Exonic
992105618 5:73447539-73447561 GCCTACGGCTACGGCCCCTACGG - Exonic
995988450 5:118208214-118208236 GCCCCCGGCCAGGGGCAGTGAGG - Intergenic
999202615 5:149826846-149826868 GCCCTCGGCCCCAGCCCCTGAGG + Exonic
1001518196 5:172372076-172372098 GCCCCTGGGTACGGGCCCTGTGG - Intronic
1002576873 5:180178992-180179014 GCCCCCGGCCATGGGGCCTGGGG + Intronic
1002730842 5:181330978-181331000 GGGCACGGCCACTGCCCCTGGGG - Intergenic
1004650175 6:17600565-17600587 GCCCACAGCCCCGGGCCTCGCGG + Exonic
1006263105 6:32893826-32893848 TCCCACATCCACGGGACCTGCGG + Intergenic
1006348462 6:33502791-33502813 GGCCAGCGCCACTGGCCCTGGGG + Intergenic
1007584262 6:42979056-42979078 GCCGCCGGCCACGGGCCCCCGGG + Exonic
1007605345 6:43113993-43114015 GTCCCCGGCCACAGGCCCCGGGG - Intronic
1007633054 6:43283422-43283444 GCCCAAGCCCCCGGGGCCTGGGG + Exonic
1015736992 6:136411594-136411616 GGCCATGGACACGGGGCCTGGGG + Intronic
1015938237 6:138424152-138424174 GCCCCAGGCCCCCGGCCCTGTGG - Exonic
1017103262 6:150866266-150866288 GCCCACGCCCACCTGCGCTGCGG - Intronic
1018457971 6:163969765-163969787 GCCCAAGGCCAGGGGTCCCGAGG - Intergenic
1018681905 6:166271642-166271664 GCCCCCAGCCATGGCCCCTGAGG - Intergenic
1018686313 6:166307447-166307469 GCCCGCGGCCCGGGGCCCTGCGG - Exonic
1018899468 6:168043952-168043974 GCTCACGGCCCATGGCCCTGTGG - Intronic
1019136029 6:169908124-169908146 GGCCATCGCCAGGGGCCCTGGGG + Intergenic
1019164590 6:170089668-170089690 GCCCACGGCCAGGAGCCCATGGG + Intergenic
1019727753 7:2612447-2612469 GCCCACGGCCCCAGGGCCTGGGG + Exonic
1022093265 7:27122197-27122219 GGCCACGGGCACGGGCGCGGCGG - Intronic
1025093535 7:56081453-56081475 GCCCACTGGCTCGGTCCCTGAGG - Intronic
1026899340 7:74028301-74028323 GCCCACAGCTGCGGGCCCTTTGG + Intronic
1027217382 7:76192709-76192731 CCCCAAGGCCACTGGCCCAGGGG + Intergenic
1029674962 7:102062233-102062255 GCCCACTGCCACGTGACTTGTGG - Intronic
1031979034 7:128112542-128112564 GCCCACGGCCCCGGGACCCCTGG + Intergenic
1034349755 7:150408170-150408192 AGCCACGGCCACGGGCCCGAGGG + Intronic
1034911536 7:155002577-155002599 GCCCCCGGCCTGCGGCCCTGGGG - Intronic
1035233877 7:157484074-157484096 GCCCACAGTCACGGGACCAGAGG - Intergenic
1035375477 7:158404510-158404532 GCCCAAAGCCACGTCCCCTGGGG - Intronic
1035386242 7:158474972-158474994 CCCCACGGAGACAGGCCCTGAGG + Intronic
1035437382 7:158869178-158869200 TGCCACAGCCACGGGCCCAGAGG - Intronic
1035437393 7:158869217-158869239 TGCCACAGCCACGGGCCCAGAGG - Intronic
1035437403 7:158869255-158869277 TGCCACAGCCACGGGCCCAGAGG - Intronic
1035695093 8:1590058-1590080 ACCCACAGCCACGGACACTGAGG - Intronic
1035754952 8:2023943-2023965 TCCCAGGGCCACGGGCCAGGAGG + Intergenic
1036168491 8:6459969-6459991 AGCCACGGCCACGGGCTCTGGGG + Intronic
1036220024 8:6913789-6913811 GCCCAAGCCTACTGGCCCTGAGG + Intergenic
1036263218 8:7256611-7256633 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036264521 8:7264233-7264255 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036265820 8:7271855-7271877 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036267122 8:7279477-7279499 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036268425 8:7287099-7287121 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036269729 8:7294721-7294743 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036298161 8:7552333-7552355 TACCTAGGCCACGGGCCCTGTGG - Intergenic
1036299466 8:7559983-7560005 TACCTAGGCCACGGGCCCTGTGG - Intergenic
1036300771 8:7567631-7567653 TACCTAGGCCACGGGCCCTGTGG - Intergenic
1036302078 8:7575277-7575299 TACCTAGGCCACGGGCCCTGTGG - Intergenic
1036303373 8:7582924-7582946 TACCTAGGCCACGGGCCCTGTGG - Intergenic
1036315263 8:7715150-7715172 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036316565 8:7722798-7722820 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036317872 8:7730446-7730468 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036319181 8:7738094-7738116 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036320488 8:7745741-7745763 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036321798 8:7753389-7753411 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036323107 8:7761037-7761059 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036324409 8:7768684-7768706 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036351625 8:8015623-8015645 TACCTAGGCCACGGGCCCTGTGG - Intergenic
1036352934 8:8023269-8023291 TACCTAGGCCACGGGCCCTGTGG - Intergenic
1036354224 8:8030916-8030938 TACCTAGGCCACGGGCCCTGTGG - Intergenic
1036679654 8:10862004-10862026 GCCCTTGTCCATGGGCCCTGGGG + Intergenic
1036691538 8:10947760-10947782 GCCCACCGCCAGGGGAACTGTGG + Intronic
1038642644 8:29340131-29340153 GCCCAGGTCCAAGGGCTCTGTGG + Exonic
1049364119 8:142228377-142228399 GCCCAGGGCCCTGTGCCCTGGGG + Intronic
1049499685 8:142955217-142955239 GCCCAGGTCCAGGGGCCCAGGGG + Intergenic
1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG + Exonic
1049883623 9:14039-14061 GCCCCCAGGCAGGGGCCCTGTGG - Intergenic
1053306263 9:36986613-36986635 GCCCTCCGCCCCCGGCCCTGGGG + Intronic
1055309567 9:74964604-74964626 GCACACTGTCAGGGGCCCTGGGG + Intergenic
1056182859 9:84102428-84102450 TCCCGCGGCCACGAGCCCCGGGG - Intergenic
1056813481 9:89782496-89782518 GCCCAGGGGCAAGGGCTCTGGGG - Intergenic
1062044181 9:134417571-134417593 GCCCGGGGCCTGGGGCCCTGCGG + Intronic
1062234056 9:135499788-135499810 GCCCAAGGCCACGGCCCCGCCGG - Exonic
1062390523 9:136331942-136331964 CACCATGGCCACGGGTCCTGGGG - Intronic
1185647017 X:1623188-1623210 CGCCACGTCCAGGGGCCCTGGGG - Exonic
1185728914 X:2445538-2445560 GCCCACGGCAGCGGTCCCTTGGG - Intronic
1187915779 X:24150594-24150616 GCGCAGGGCCAGGGGCGCTGAGG - Intronic
1190108512 X:47574746-47574768 GCCCAAGGGCAGGGCCCCTGGGG + Exonic
1192051100 X:67724611-67724633 GCCCACAGCCTTGGTCCCTGGGG + Exonic
1192340424 X:70259314-70259336 GCCCACAACCACTGGCCCTTTGG - Exonic
1196964805 X:121044012-121044034 GCCCACTGCCAAGAGGCCTGAGG - Intergenic
1198711345 X:139507812-139507834 GCCCATGGGCACAGGCCCAGAGG - Intergenic
1200402195 X:156026110-156026132 GCCCCCAGGCAGGGGCCCTGTGG + Intergenic