ID: 946416850

View in Genome Browser
Species Human (GRCh38)
Location 2:219544062-219544084
Sequence CAAAGGCCGCGGGCGGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946416842_946416850 -3 Left 946416842 2:219544042-219544064 CCGGAGCTGTCCATCAGCACCAA 0: 1
1: 1
2: 0
3: 16
4: 161
Right 946416850 2:219544062-219544084 CAAAGGCCGCGGGCGGGCTCAGG 0: 1
1: 0
2: 1
3: 10
4: 115
946416838_946416850 22 Left 946416838 2:219544017-219544039 CCCTGAGTGACGTCAGGAGCAGA 0: 1
1: 0
2: 2
3: 10
4: 131
Right 946416850 2:219544062-219544084 CAAAGGCCGCGGGCGGGCTCAGG 0: 1
1: 0
2: 1
3: 10
4: 115
946416839_946416850 21 Left 946416839 2:219544018-219544040 CCTGAGTGACGTCAGGAGCAGAG 0: 1
1: 0
2: 0
3: 18
4: 141
Right 946416850 2:219544062-219544084 CAAAGGCCGCGGGCGGGCTCAGG 0: 1
1: 0
2: 1
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946416850 Original CRISPR CAAAGGCCGCGGGCGGGCTC AGG Intronic
900417306 1:2540979-2541001 CTAATGCCGCGGGGGGGCCCAGG + Intergenic
900611881 1:3547740-3547762 CAAAGACGGAGGGCGGGCTAGGG - Intronic
901012321 1:6208830-6208852 CGCTGGCCGCGGTCGGGCTCTGG + Intronic
901086553 1:6614748-6614770 CAAAGCCCGCGGGCGGGGGGCGG - Intronic
904688136 1:32275143-32275165 CAAGGGCCGCAGGAGGGCTGCGG - Intronic
914013523 1:143796720-143796742 CACTGGCCGTGGGCGGGTTCTGG + Intergenic
914164301 1:145164465-145164487 CACTGGCCGTGGGCGGGTTCTGG - Intergenic
914652148 1:149705329-149705351 CACTGGCCGTGGGCGGGTTCTGG + Exonic
914824793 1:151132866-151132888 AAGAGGGCGGGGGCGGGCTCCGG + Exonic
922573198 1:226645728-226645750 CAAAGGCCTCGGGCTGGCTGGGG + Intronic
924957687 1:248945017-248945039 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1063407703 10:5813055-5813077 CTAGGGGCGCGGGCGGGTTCAGG - Intronic
1065342864 10:24723318-24723340 CAAAGGCCGGCGGTGGGCGCTGG - Intronic
1066220645 10:33334689-33334711 AAAAGGCCGGGGGGGGGCTGTGG + Exonic
1073088516 10:100912611-100912633 CGAAGGCAGCTGCCGGGCTCCGG + Intronic
1074898550 10:117797429-117797451 CAAAGGCCGTGGGCGGCCTTGGG - Intergenic
1076963535 10:133786531-133786553 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1078069772 11:8100786-8100808 CAAAGGCCTGGGCCTGGCTCAGG + Intronic
1078887496 11:15519008-15519030 CAAAGGCCCCGGGCATGGTCAGG - Intergenic
1083684717 11:64369360-64369382 CGAAGGCCGGGGGCGGGGCCTGG + Intronic
1084214681 11:67640909-67640931 CAAAGACGGTGGGCTGGCTCTGG + Intergenic
1089112529 11:116068187-116068209 GAAAGGCCGTGGGAGGGCACAGG - Intergenic
1089455119 11:118621462-118621484 CAAAGGCTCCGGGCGGGCCCGGG + Intronic
1091842133 12:3628756-3628778 GAAAGGCCTCTGGAGGGCTCAGG + Intronic
1094466074 12:30754889-30754911 CAGAGGCCGCGGGCGAGGACCGG - Intronic
1095812253 12:46383541-46383563 CCAAGTCCGCGCGCGGGCTGGGG - Intergenic
1102428416 12:112862705-112862727 CAAAGGCAGCCTGCAGGCTCTGG - Intronic
1102462016 12:113105842-113105864 CAATGGCCGAGGGCGGGAACAGG + Exonic
1104405127 12:128510750-128510772 CAAAGGCCCTTGGCAGGCTCTGG + Intronic
1105768070 13:23579890-23579912 CGCAGGACGCGGGCGGGCGCCGG - Intronic
1107851806 13:44577987-44578009 CAAGGGCCGGGGGCGAGCCCAGG - Intergenic
1108221015 13:48233318-48233340 CGAAGGGCGGCGGCGGGCTCGGG - Exonic
1113989971 13:114353410-114353432 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1117548066 14:56809182-56809204 CCAAGGCCGCGGCCGGGCCAGGG - Intronic
1118971575 14:70642168-70642190 CTCCGGCCGCGGGCGGGCTCGGG - Exonic
1120787963 14:88554551-88554573 CCGGGGCCGCGGGCGCGCTCCGG + Intronic
1121403968 14:93706767-93706789 CTAAGGACGCTGCCGGGCTCGGG + Exonic
1122302788 14:100740603-100740625 CAGAGGCAGAGGGCGGGCTTGGG + Intergenic
1122329469 14:100903001-100903023 CACAGGCCGGGGGCTGCCTCCGG - Intergenic
1122470739 14:101964464-101964486 CTAAGGCCGCGAGCGAGCGCGGG + Intergenic
1122499503 14:102187402-102187424 CATAGGCTGGGGGGGGGCTCAGG + Intronic
1122624254 14:103075945-103075967 CAAACACCCCGGGCGGGCGCGGG + Intergenic
1122629396 14:103100392-103100414 CAAAGCCCGCTGGCTGGCCCGGG - Exonic
1122768047 14:104085224-104085246 CAATGGCCGCAGGATGGCTCAGG + Intergenic
1129333483 15:74839448-74839470 CAGAGACAGAGGGCGGGCTCAGG - Intronic
1129382857 15:75178718-75178740 CACAGGCGGCGGGCGGGCGCGGG - Intergenic
1132863340 16:2082126-2082148 CAGAGTGCGCAGGCGGGCTCAGG - Intronic
1144496538 17:15749588-15749610 CGAAAGCCGCAGCCGGGCTCGGG - Intergenic
1144833360 17:18143865-18143887 CACAGGCCTCGGGCTGGCCCAGG + Exonic
1146445312 17:32928168-32928190 CAAAGTCCGGGCGCGGGCGCGGG - Exonic
1147752421 17:42744662-42744684 CAAAGGGCGCGGGAGGGCGGTGG - Intronic
1151767966 17:76141656-76141678 CTAAGGCTGGGAGCGGGCTCAGG + Intergenic
1152745676 17:82037586-82037608 CAAAGGCCGGCGGCGGGCAGAGG - Intronic
1152910528 17:83002874-83002896 CACACGCGGAGGGCGGGCTCAGG - Intronic
1152910614 17:83003175-83003197 CACACGCGGAGGGCGGGCTCAGG - Intronic
1154300427 18:13186638-13186660 CCAGGGCCACGGTCGGGCTCAGG + Intergenic
1159511529 18:69401900-69401922 CAGTGACCGCGGGCGGGCGCGGG - Intronic
1160164041 18:76495088-76495110 CAGGGGCCGCGGGCGGGCGGTGG - Intronic
1160524458 18:79526780-79526802 CAAAGGCCCCGGCCTGTCTCAGG - Intronic
1160983582 19:1827564-1827586 CAAGGGCCGAGGGCGGCCTGTGG - Exonic
1162299309 19:9835273-9835295 CAGCGGCGGCGGGCGGGCGCGGG + Intronic
1163413685 19:17172680-17172702 CAAAGACCCCGGGCTGGCGCAGG - Intronic
1163544413 19:17932665-17932687 CATGGACCGCGGGCGCGCTCTGG + Intergenic
1166998148 19:46729591-46729613 GAAAGGCAGCGGCCGGGCTCAGG + Intronic
1167504139 19:49862489-49862511 CACAGGCCAGGGTCGGGCTCGGG + Intronic
925328718 2:3042263-3042285 CAGAGGCCGCGGCCGGGCCAGGG - Intergenic
927803003 2:26118431-26118453 CAAAGGCCGGGGGTGGGGTGGGG + Intronic
932036450 2:68251902-68251924 CAGAGGCCGGGGGCGGGCGCGGG + Intronic
935557682 2:104528251-104528273 TATAGGCCGCGGGCTGGATCTGG + Intergenic
935704332 2:105842723-105842745 CAAAGACTGCAGGTGGGCTCTGG + Intronic
937408127 2:121649317-121649339 CCAGGGCCGCGAGAGGGCTCGGG + Intronic
937883558 2:126885743-126885765 CAAAGGCGCCTGGAGGGCTCTGG + Intergenic
938236414 2:129709984-129710006 CAGGGGCCGCGTGAGGGCTCTGG - Intergenic
938422284 2:131154961-131154983 CGAGGCCCGCAGGCGGGCTCAGG + Intronic
944651821 2:201838017-201838039 CAAAGGACTCCGGCAGGCTCTGG + Intronic
946416850 2:219544062-219544084 CAAAGGCCGCGGGCGGGCTCAGG + Intronic
948859479 2:240745964-240745986 CACAGGCCTGGGCCGGGCTCAGG + Intronic
1174287818 20:49484386-49484408 GGGAGGCCGGGGGCGGGCTCCGG + Intergenic
1174488602 20:50876583-50876605 CAAAGGCCGAGGGCAGGTGCGGG - Exonic
1175546287 20:59780153-59780175 CACAGGCAGCTGGGGGGCTCTGG - Intronic
1179611849 21:42557036-42557058 CAAGGGCCGTGGGCGGCCTTTGG + Intronic
1180136517 21:45865832-45865854 CAGAGGCCTCAGGCGGGCTCAGG + Intronic
1180852714 22:19029595-19029617 CACGGGCCGCCGGCGGGATCCGG + Intergenic
1182143444 22:27982290-27982312 CAAAGGGCGCGCGGGGGCTGTGG + Exonic
1183191393 22:36323937-36323959 CACAGGCCTCGGGCGGGCCTGGG + Intronic
1184439173 22:44498190-44498212 CGATGGCGGCGGGCGGCCTCCGG + Exonic
1185430382 22:50807256-50807278 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
953623898 3:44555052-44555074 CACCTGCCGCGGGCGGGGTCGGG - Intergenic
962309537 3:134315377-134315399 CAAAGGCTGGGGGAGGGGTCCGG - Intergenic
962369017 3:134805371-134805393 CAGAGGCCGGGGGCAGGCACTGG + Intronic
965521051 3:169668562-169668584 CAAAGGGCGCGGGGCGGCTGGGG + Intergenic
966911414 3:184562240-184562262 CGGCGGCGGCGGGCGGGCTCTGG - Exonic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968558170 4:1261044-1261066 CAAAGGCCCAGGGTAGGCTCGGG - Intergenic
969818754 4:9705124-9705146 CAAAGGCCTGGGGGGGGCGCTGG + Intergenic
971231032 4:24800277-24800299 CAAAGGCAGAGGGGGGCCTCGGG - Exonic
977536710 4:98261916-98261938 AAAAGGAAGCGGGCGGCCTCTGG - Intronic
985466789 4:190203974-190203996 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
990211117 5:53482069-53482091 CGGTGGCCGCGGGCGTGCTCCGG + Intronic
997472837 5:134126266-134126288 CAAAGGCTGCCAGCGAGCTCTGG - Intronic
998157687 5:139795857-139795879 GAAGGGACGCGGGCGGGCGCGGG + Exonic
1001382261 5:171312395-171312417 CGAAGGCCGCGGGCCAGCGCCGG + Intergenic
1003212310 6:4079044-4079066 CGAAGCCCGCGGGCCGGCGCAGG + Exonic
1005900477 6:30213177-30213199 CCAGGCCCCCGGGCGGGCTCAGG - Intronic
1006694472 6:35920208-35920230 GAAAGGTACCGGGCGGGCTCTGG + Intronic
1011603568 6:89081314-89081336 CCAAGGCGGCGGCCGGGCCCGGG - Exonic
1014079427 6:117270423-117270445 CGAAGGCGCCGGGCGGGCACAGG - Intronic
1014913385 6:127118862-127118884 CAACTGCCGCAGGCGGGATCCGG - Exonic
1018045266 6:159960287-159960309 CAAAGGTCGGGGGCGGGGTAGGG - Intergenic
1018916321 6:168134730-168134752 CCAAGGCCACGGCCGGCCTCTGG - Intergenic
1019407088 7:889496-889518 CAAAGGCAGCGGGAGGGCCCTGG + Intronic
1019545154 7:1570554-1570576 CTCAGGCGGCGGGCGGGCTGGGG + Intronic
1019608402 7:1922125-1922147 CACAGGCTGCAGGCGGGCTGAGG + Intronic
1024062319 7:45708373-45708395 CAAAGTCCGCCAGCGTGCTCAGG - Exonic
1031051869 7:116953412-116953434 CCCCGGCGGCGGGCGGGCTCCGG + Exonic
1031406755 7:121396030-121396052 CACCGGCCGGGGGCGGGCCCCGG - Intronic
1035187696 7:157139115-157139137 TACAGCCCGGGGGCGGGCTCGGG + Exonic
1036701313 8:11015714-11015736 AGAAAGCCGGGGGCGGGCTCGGG + Intronic
1039886034 8:41654306-41654328 CAGAGGCCGGGGCCAGGCTCTGG - Intronic
1049420340 8:142513637-142513659 GGAAGGCTGCGGGTGGGCTCTGG + Intronic
1062584220 9:137241695-137241717 CAAGGGACGCGGGCGGGCCCGGG - Intronic
1185736698 X:2501070-2501092 CAGAGGGCCCGGGCGGGGTCTGG - Intronic
1190239783 X:48648584-48648606 GAAAGGCTGCGTGCGGCCTCAGG + Intergenic
1193943779 X:87707933-87707955 CAAAGGCCTTGGGAGGCCTCAGG + Intergenic
1195964628 X:110418890-110418912 TAAAGGGCGGGGGTGGGCTCAGG - Intronic
1198800131 X:140439712-140439734 CAAAGGCCGGGGGCGGGCCCGGG + Intergenic
1200224799 X:154411599-154411621 CACAGGCCGTGGGCGCGCTGCGG - Exonic