ID: 946416914

View in Genome Browser
Species Human (GRCh38)
Location 2:219544283-219544305
Sequence CGCCAGAGGCTCCAACTGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946416914_946416917 -1 Left 946416914 2:219544283-219544305 CCAGTCAGTTGGAGCCTCTGGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 946416917 2:219544305-219544327 GCCCCGCAACCCCGGCCCCTCGG 0: 1
1: 0
2: 0
3: 27
4: 334
946416914_946416916 -9 Left 946416914 2:219544283-219544305 CCAGTCAGTTGGAGCCTCTGGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 946416916 2:219544297-219544319 CCTCTGGCGCCCCGCAACCCCGG 0: 1
1: 0
2: 0
3: 9
4: 136
946416914_946416919 0 Left 946416914 2:219544283-219544305 CCAGTCAGTTGGAGCCTCTGGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 946416919 2:219544306-219544328 CCCCGCAACCCCGGCCCCTCGGG 0: 1
1: 0
2: 11
3: 59
4: 1029

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946416914 Original CRISPR CGCCAGAGGCTCCAACTGAC TGG (reversed) Exonic
900917939 1:5651405-5651427 CCCCAGGGGCTCCACCTGATGGG + Intergenic
901134342 1:6983357-6983379 CTCCAGACGCTCCAACAGTCAGG + Intronic
903001185 1:20266947-20266969 TGTCAGAGGCTCCCACTGAGCGG - Intergenic
903560158 1:24221057-24221079 CGCTCAAGGCTCCAAATGACAGG - Intergenic
903576024 1:24340396-24340418 CACCAGAGGCTCCATCTCTCAGG - Intronic
904004414 1:27356380-27356402 CCCCAGAGCCTCCAAGTGAGTGG - Exonic
904684692 1:32251585-32251607 CACCAGTGGCCCCACCTGACTGG + Intronic
906251924 1:44317306-44317328 CGCAAAAGGCACCAACTGCCAGG + Intronic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
923224938 1:231930556-231930578 CTCCAGAGGCTCCCACTGCCTGG - Intronic
924251711 1:242139834-242139856 GGCCAGATGCTCCATCTGTCTGG - Intronic
924643641 1:245857251-245857273 CGGCAGAGGCTCCACCAGCCAGG - Intronic
1067528961 10:47056418-47056440 CACTAGAGACTCCACCTGACAGG - Intergenic
1067725555 10:48768121-48768143 CACCAGATGCTCCAGATGACAGG - Intronic
1068143048 10:53029564-53029586 CGCCAGAGGCTCCCACTGCATGG - Intergenic
1076405804 10:130211987-130212009 GGCCAGAGGCTGGAACTGAAGGG - Intergenic
1098552638 12:71780380-71780402 GGCCAGTGGCTCCAACAAACAGG - Intronic
1102236762 12:111298618-111298640 TGCCAGAGGCTCCCTCTGCCTGG + Intronic
1102628583 12:114256667-114256689 TGCCTGAGGCCACAACTGACAGG + Intergenic
1118808520 14:69257833-69257855 CACCAGAAGCCCCAACTGTCTGG + Intergenic
1119938809 14:78618782-78618804 CACCAGTGGCTGCAACTAACAGG - Intronic
1122972547 14:105158278-105158300 AGCCAGAGGCCCCAACAGGCCGG + Intronic
1124222569 15:27863111-27863133 CCCCTGAGGCTGCAACTAACTGG + Intronic
1124414411 15:29463159-29463181 CCCCAGTGGCTCCAACCCACAGG - Intronic
1129198480 15:73984789-73984811 CGCCAGAGGCTGCTTCGGACTGG + Exonic
1133211441 16:4265279-4265301 AGCCAGATGCCCCAACTGGCAGG + Intronic
1134191356 16:12123654-12123676 AGCCAGCGGCCCCAACTGATTGG + Intronic
1140778355 16:78271620-78271642 CCTCAGAGGCTCCACCTCACTGG - Intronic
1142411872 16:89921110-89921132 CCCCAGAGGCCCCAAATGCCTGG + Intronic
1143197903 17:5090455-5090477 AGCCAGTGGCTCCAAATGTCAGG + Intronic
1153593527 18:6700283-6700305 GGCCAGAAGCTCGAACTGAGTGG + Intergenic
1157843739 18:50982987-50983009 TTCCACTGGCTCCAACTGACTGG - Intronic
1168100540 19:54138691-54138713 CGGCAAAGGCTCCAACTAACGGG - Intronic
927065714 2:19469023-19469045 CATCAGAGGCTCCAGCTGAAAGG + Intergenic
927390286 2:22587454-22587476 TGCCAGTGGCTCCAACAGGCTGG - Intergenic
933771849 2:85749633-85749655 GGCCAGTGGCTCCAGCTGAGAGG + Intergenic
934759019 2:96843279-96843301 CGCCAGAGGCTGCACCAGGCTGG + Intronic
939634810 2:144569081-144569103 AGCCAGAGGCTCCAACTCTGAGG + Intergenic
940277285 2:151952609-151952631 CGCTAGAGGCTCCAAATAATGGG + Intronic
946416914 2:219544283-219544305 CGCCAGAGGCTCCAACTGACTGG - Exonic
948510238 2:238459066-238459088 CTCCAGAGCCGCCCACTGACAGG + Intergenic
1170669757 20:18420891-18420913 AACCAGACTCTCCAACTGACAGG + Intronic
1172543753 20:35742826-35742848 CGCCATTGGCTCCAAATGACAGG - Intergenic
1175812209 20:61864431-61864453 CCCCACAGGCTCCAAGTGGCAGG - Intronic
1182289925 22:29268886-29268908 CGCCAGACGCCCCAGCCGACTGG - Intronic
1182360245 22:29742279-29742301 CAGCAGTGGCTCCAGCTGACTGG - Intronic
1183208192 22:36433542-36433564 CAACACAGGCTCCAACTGAAGGG + Intergenic
952402002 3:32971813-32971835 AGCTAGAGGCTCCAACTGCTTGG + Intergenic
964223033 3:154368157-154368179 CGCCAGAGGCTCCCCCTGCAAGG + Intronic
964917246 3:161852949-161852971 CGCCAGAGGCTCCCCCTGCATGG - Intergenic
968533951 4:1112643-1112665 AGCCAGAGCCCCCGACTGACAGG + Intronic
969336763 4:6515215-6515237 TGCCAGAGCCTCCAGTTGACTGG - Intronic
969564591 4:7970559-7970581 CCCCAGAGGCTCCCACAGCCTGG - Intronic
972632913 4:40857289-40857311 CGCCAGATGCTCCAGCTGCTAGG + Intronic
972930514 4:44066258-44066280 CCACGAAGGCTCCAACTGACTGG + Intergenic
987385560 5:17325945-17325967 TGCCAGAGACTCCTACTGAGGGG - Intergenic
993626091 5:90226601-90226623 GGCCAAAGGCTGCAACTAACAGG - Intergenic
995393892 5:111667033-111667055 CTTCAGAGGCTCCAACTCAGTGG + Intronic
999115717 5:149161517-149161539 GGCCAGAGGCCCAAACTCACTGG - Intronic
1002322793 5:178385488-178385510 CTCCAGGGGCTCCAACAGTCTGG - Intronic
1003309529 6:4957348-4957370 CCTCAGAGGCTCCAACCCACTGG + Intergenic
1013864287 6:114675928-114675950 TCCCAGAGGCTTAAACTGACTGG - Intergenic
1015891650 6:137975916-137975938 CGACTGAGGCTCCAACTGCATGG - Intergenic
1019009705 6:168834228-168834250 CTCCTGAGGCTCAAGCTGACAGG + Intergenic
1019379448 7:713219-713241 CCCCAGAGGCTCCAAATGCCAGG + Intronic
1019753568 7:2750344-2750366 TGCCAGAGCCTGCAACTGATAGG + Intronic
1019999380 7:4746610-4746632 CGCCACAGCCTCCAACTGCTGGG - Intronic
1024030177 7:45454214-45454236 TGCCACAGGCTCCGACTGCCGGG - Intergenic
1041295862 8:56356846-56356868 CGCCAGAAGCTCGAACTGGGTGG - Intergenic
1042781552 8:72496272-72496294 CGAGAGAATCTCCAACTGACAGG + Intergenic
1045929586 8:107606040-107606062 CGCCAGAGGCTCCCCCTGCACGG - Intergenic
1056808978 9:89749837-89749859 CTCCAGAAGCTCCATCTTACAGG + Intergenic
1060225195 9:121786199-121786221 CTCCAGACGCTCCAAGGGACAGG + Intergenic
1061809172 9:133152470-133152492 AGCTAGAGGCTACAACGGACAGG - Intergenic
1062087570 9:134656853-134656875 GGCCAGAGGTTCCAATTGGCAGG + Intronic
1198296850 X:135295680-135295702 CCCCAAAGGCTGCAACTGGCAGG + Intronic