ID: 946417702

View in Genome Browser
Species Human (GRCh38)
Location 2:219548855-219548877
Sequence GTCCAGTGGAAAGATGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 5, 3: 59, 4: 440}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946417700_946417702 0 Left 946417700 2:219548832-219548854 CCAGTGAAGAAGCAGCTGTGATT 0: 1
1: 1
2: 0
3: 36
4: 263
Right 946417702 2:219548855-219548877 GTCCAGTGGAAAGATGATGATGG 0: 1
1: 0
2: 5
3: 59
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946417702 Original CRISPR GTCCAGTGGAAAGATGATGA TGG Intronic
900750294 1:4391398-4391420 GTCCAGTGCAAAGGTCATGGTGG - Intergenic
901817041 1:11800289-11800311 GACCAGTGGGAAGAGGAGGAGGG - Exonic
902184681 1:14716498-14716520 GTCCAAGGGAAGGATTATGAGGG - Intronic
903397227 1:23011056-23011078 GTTCAGTGAAATGAAGATGAAGG - Exonic
903849026 1:26295320-26295342 GTCCAGGAGAAAGATGACGGTGG - Intronic
904378833 1:30097666-30097688 GTCCAGTGGAAAGAGGTTGTGGG + Intergenic
904586069 1:31581345-31581367 GTCCAGGTGAGAGGTGATGAGGG + Intronic
904698392 1:32343532-32343554 CCCCAGACGAAAGATGATGAAGG - Intergenic
905702702 1:40030299-40030321 GTCCAGGCAAGAGATGATGATGG - Intergenic
906576460 1:46895095-46895117 GTCCAAAGGACAGATGATGGAGG - Intergenic
906595458 1:47072490-47072512 GTCCAAAGGACAGATGATGGAGG + Intronic
906669805 1:47646152-47646174 GTCCAGTGGAAAGAAGGTCTGGG - Intergenic
906794149 1:48683388-48683410 GTCCAGTTGAAAGCTGAGGAAGG - Intronic
907596177 1:55721959-55721981 GTCCTGTGAAAAGATAATCAGGG + Intergenic
909300860 1:74011432-74011454 ATCCAGGTGAAAGATGATGAAGG + Intergenic
909367028 1:74836907-74836929 GTACAGTGAAAAGTTGAAGATGG + Intergenic
909515067 1:76497813-76497835 TTCTATTGGAAAGATGAGGAAGG - Intronic
909724250 1:78815020-78815042 ATCCAGGGGAAAGATGATGGTGG - Intergenic
910088921 1:83438628-83438650 GTGCAGTTTAAAGATGATGTAGG - Intergenic
911182784 1:94875882-94875904 GTACACTGGAAATATGCTGAGGG + Intronic
911261039 1:95685698-95685720 TTTCATTGGAAAGATGCTGAAGG + Intergenic
911956821 1:104246644-104246666 GTCCAGGTTAAAGATGATGGTGG - Intergenic
912207845 1:107527863-107527885 GTCCAGGTGAAAGAAGGTGAAGG - Intergenic
912233525 1:107822749-107822771 GTCCAGGCAAAAGATGATGTTGG + Intronic
912347374 1:108977077-108977099 GTTCAGTTGAGAGATGATGGTGG + Intronic
912699183 1:111863843-111863865 ATCCAGGGGAGAAATGATGAGGG + Intronic
912964129 1:114222476-114222498 GTCCAGGAGAGAGATGATGGTGG - Intergenic
913099542 1:115550466-115550488 GTTCAGTGGAGAGATGAATATGG - Intergenic
913335597 1:117706760-117706782 GTCCAGTTGGCAGATGATGGTGG - Intergenic
913567786 1:120090510-120090532 GTCCAGGTGAAAACTGATGAGGG - Intergenic
914288534 1:146251219-146251241 GTCCAGGTGAAAACTGATGAGGG - Intergenic
914549569 1:148701963-148701985 GTCCAGGTGAAAACTGATGAGGG - Intergenic
914617111 1:149369753-149369775 GTCCAGGTGAAAACTGATGAGGG + Intergenic
916172365 1:162010660-162010682 GACCAGGGGAAAGATGACCATGG + Intronic
916634966 1:166658634-166658656 GCTCAGTGTAAAGGTGATGAAGG - Intergenic
917183996 1:172331891-172331913 GTTCAGGGGAGAGATGATGATGG + Intronic
918095278 1:181329252-181329274 GTCCAAGGGAGAGATGAAGATGG - Intergenic
918103285 1:181395124-181395146 GTCCAGATGAGAGATGATGGTGG + Intergenic
918641956 1:186852318-186852340 CTCCACTGGAAAGATGATATTGG + Intronic
918951791 1:191150005-191150027 GTTCAGTGGAAGGCTGATCAGGG + Intergenic
919171043 1:193954496-193954518 GACCAGTGCAAAGACTATGAAGG - Intergenic
919197363 1:194304205-194304227 ATCCAGGTGAAAGATGATGTTGG + Intergenic
919619197 1:199846157-199846179 GTTCACTGGAAAAATGGTGATGG - Intergenic
921117913 1:212112079-212112101 GTCCAGGAGCAAGATGAGGATGG - Intergenic
921492122 1:215790058-215790080 TTCAACTGGAATGATGATGAAGG - Exonic
921879915 1:220244521-220244543 GTTCTGTGAAAAAATGATGATGG - Intronic
923321702 1:232840506-232840528 GTACAGTGGAATGAAGATTATGG - Intergenic
923365320 1:233254632-233254654 CTCCAGTGGTAATATCATGATGG - Intronic
923446138 1:234073004-234073026 ACCCAGTGGAGAGATGATGGAGG + Intronic
923651964 1:235882558-235882580 GCCCAAGAGAAAGATGATGAGGG + Intronic
923679543 1:236108542-236108564 GTCCAATAGAAATATGATGCAGG + Intergenic
924141402 1:241027541-241027563 CTCCAGGGGAAAGATGCTGGTGG + Intronic
924141686 1:241030671-241030693 GTCCAGGGGAGAGATGATAGTGG - Intronic
924146973 1:241086528-241086550 GTCTAGAGCAGAGATGATGAAGG - Intronic
924934574 1:248757179-248757201 GCACAGTGGAAAGATGAGGAGGG - Intergenic
1063045931 10:2392596-2392618 GACCAGCTGACAGATGATGAGGG + Intergenic
1063298663 10:4831954-4831976 GTGCAGGTGGAAGATGATGAAGG + Intronic
1065504661 10:26417451-26417473 TTCCAATGAAAAGAAGATGAAGG + Intergenic
1065736007 10:28753087-28753109 GTTCAGGGGAAGGATGATGGTGG + Intergenic
1065738841 10:28778425-28778447 GCCCAGTGAGAACATGATGATGG + Intergenic
1068612404 10:59074745-59074767 ATCCAGGGGAGAGATGATGGTGG - Intergenic
1069202513 10:65639029-65639051 GTCCAGTGGTAAAATGATGAAGG + Intergenic
1069294877 10:66831100-66831122 GTCCAGGTGAAAGAGGATGATGG - Intronic
1069706274 10:70460615-70460637 GTCCAGGAGAGAGATGATGGTGG - Intergenic
1069884534 10:71615510-71615532 GTCCAGGGCAAAGATGCTGTTGG - Intronic
1070055074 10:72926406-72926428 GTCCAGGTGAAAGATAATGAAGG - Intronic
1070339251 10:75481560-75481582 GTCCAGGTGACAGATGACGATGG - Intronic
1070951959 10:80438211-80438233 GTCCAGGAGAAAAATCATGAAGG - Intergenic
1071093634 10:81948608-81948630 GTACAGTGGGAAGATGCTGGAGG + Intronic
1071126014 10:82335591-82335613 GTACAGTGGCATGATGATCATGG - Intronic
1071239083 10:83683951-83683973 GCCAAGTGAAGAGATGATGATGG + Intergenic
1071254838 10:83862804-83862826 GTCCTGTGGAGAGATGCTGCTGG + Intergenic
1071861976 10:89683523-89683545 GCTCGGTGTAAAGATGATGAAGG + Intergenic
1073473437 10:103738089-103738111 CTTCAGAGAAAAGATGATGAAGG - Intronic
1073567723 10:104549488-104549510 TTCAAGAGGAAAGAGGATGATGG + Intergenic
1075178401 10:120187173-120187195 GTCCAGGTGAGAGATGATGGAGG + Intergenic
1075401511 10:122164256-122164278 GTGCAGAGGAAAGATGCTGACGG - Intronic
1075918674 10:126191436-126191458 GTCCAGATGAAAGGTGATGATGG + Intronic
1076977855 11:189154-189176 ATTCAGTGGAAGGCTGATGAAGG + Intronic
1077760864 11:5095788-5095810 ATCCAGGGGAGAGAGGATGATGG - Intergenic
1077891677 11:6422486-6422508 GACCAGGTTAAAGATGATGATGG + Intergenic
1077895748 11:6452017-6452039 TTCCAGTTGAGAAATGATGATGG + Intronic
1078648282 11:13163164-13163186 GTCCAGATGAGAGAGGATGAAGG - Intergenic
1080099559 11:28443822-28443844 GTCCAGGGGAACAATGATGAAGG - Intergenic
1080303010 11:30805482-30805504 GTCCAGTGGAAATGTAATGCAGG + Intergenic
1080682219 11:34487447-34487469 GCCCAGAGGAGTGATGATGATGG - Intronic
1080703660 11:34667807-34667829 GCCCAGAGGGAAGATGATGTTGG - Intergenic
1080859080 11:36137462-36137484 ATCCAGGGGAAAGATTCTGAAGG + Intronic
1081401236 11:42645307-42645329 GCCCAGGTGAAAGATGATGTTGG - Intergenic
1081542101 11:44042750-44042772 TTCCAGTGGAAAGACCAGGATGG - Intergenic
1081816123 11:45943479-45943501 GTCCAGGCAAGAGATGATGATGG - Intronic
1082785948 11:57316714-57316736 GTCCAAGTGAGAGATGATGACGG - Intronic
1083410206 11:62487135-62487157 GTCCAGTGTGAAGCTGATAAAGG + Intronic
1083459859 11:62803900-62803922 TTCCGGTGGAAATATGGTGAAGG - Exonic
1084589686 11:70083530-70083552 CCCCAGTGGACAGATGATGGGGG + Intronic
1084854975 11:71977753-71977775 ATTCAGTGGAAAGATGAGGCAGG - Intronic
1085063712 11:73472651-73472673 GTTCAGATGAAAGATGATGGTGG + Intronic
1085329249 11:75634049-75634071 GTCCAGATAAAAGATTATGACGG + Intronic
1085382338 11:76131357-76131379 GGCCAGTGGACAGAGGATGAGGG - Intronic
1085556616 11:77428588-77428610 GTCTAGTTAAGAGATGATGAGGG + Intronic
1085582741 11:77669235-77669257 GTCCAGGTGAGAGATGATGGAGG - Intronic
1085919794 11:80939061-80939083 GTCCAGAAGATGGATGATGATGG + Intergenic
1087661898 11:100998157-100998179 CTCCAGAAGAAAGATGAAGATGG + Intergenic
1088059982 11:105635715-105635737 TTCCAGTGCACTGATGATGAGGG - Intronic
1088708837 11:112487922-112487944 GTCCAAGTGGAAGATGATGATGG + Intergenic
1089204640 11:116749807-116749829 GTCCAGGCAACAGATGATGAAGG + Intronic
1090373161 11:126270873-126270895 GTCCAGTTGAGAGATGATAGTGG + Intronic
1090456900 11:126857856-126857878 GTGCAGTGGGAAGCTCATGAAGG + Intronic
1092056745 12:5513758-5513780 GTCCAGGGGAAGGATGACAAGGG - Intronic
1092090589 12:5800500-5800522 GTCCAGGGAAGAGATGATGATGG + Intronic
1092605157 12:10110892-10110914 GTTCTGTGAAAAAATGATGATGG - Intronic
1092836325 12:12492521-12492543 GTACAGTGGAAAATTGATGTAGG - Intronic
1094614488 12:32023848-32023870 ATTCAGTGGAAAGATGATCAAGG - Intergenic
1096053642 12:48632638-48632660 CTCCTCTGGAAAGATGATTAAGG + Intergenic
1096456679 12:51793149-51793171 GTCCAGATGAGAGATGATGGTGG + Intronic
1096828922 12:54299825-54299847 GTGCAGTGAAAGGATGAGGAGGG + Intronic
1098076650 12:66738696-66738718 GTCCAGGGGACAGTTGATGGGGG + Intronic
1098602745 12:72351739-72351761 GTGCAATGGAAAGATATTGATGG - Intronic
1099633421 12:85179711-85179733 GTCGGATGGAAAGGTGATGAGGG - Intronic
1100762651 12:97826429-97826451 GTCCAGGAGGAAGATGATGATGG + Intergenic
1101618518 12:106361213-106361235 GACCAGCTGAAAGATTATGAGGG + Intronic
1101886492 12:108668011-108668033 GCCCAGTAGCAAGTTGATGATGG - Intronic
1101960648 12:109247026-109247048 GTGCAGTGGTATGATGATCATGG - Intronic
1102249940 12:111379912-111379934 GTCCAAGTGAAAGATGATGGTGG + Intergenic
1104175822 12:126331716-126331738 GTCCAGCTGAGAGATGATGGAGG + Intergenic
1104405859 12:128516126-128516148 ATCCAGTGAAAAGAGGAGGAAGG - Intronic
1104475238 12:129065628-129065650 GACCAGTACAGAGATGATGAAGG + Intergenic
1104658724 12:130593237-130593259 GTCCAGTGCTGTGATGATGAGGG - Intronic
1105989155 13:25601095-25601117 GTCCAGGTTAAAGATGATGAAGG + Intronic
1106779295 13:33040997-33041019 GTCCAGGCAAAAGATCATGATGG - Intronic
1106936602 13:34729431-34729453 ATCCAGGAGACAGATGATGATGG - Intergenic
1107105989 13:36643201-36643223 ATCCAGGAGAACGATGATGAGGG + Intergenic
1107390460 13:39957724-39957746 GTCCACAGAAAAGATGATGATGG + Intergenic
1107405953 13:40113586-40113608 GTCCAGGTGAAAGATGATAAAGG + Intergenic
1108036863 13:46299157-46299179 GTCCAGATGAGAGATAATGATGG - Intergenic
1108067369 13:46592104-46592126 TTCCAGTGGAAAGATGGTAGGGG - Intronic
1109185556 13:59263619-59263641 TGTCAGGGGAAAGATGATGAGGG + Intergenic
1109422375 13:62130805-62130827 ATTCAGTGGAAAGCTGATCAAGG + Intergenic
1109584392 13:64379458-64379480 GTGTAGTGGTACGATGATGATGG + Intergenic
1110234977 13:73207567-73207589 GTTCAGGGGAAAGATGCTGGTGG - Intergenic
1111775187 13:92652773-92652795 ATCTAGAGGAAAGATGATAAGGG - Intronic
1111798394 13:92953048-92953070 GTCAGGTTGCAAGATGATGATGG + Intergenic
1112074612 13:95898131-95898153 GTCCAGATGAGAGATGATGGTGG - Intronic
1112675613 13:101697993-101698015 CTCCACTGGAGAGATGATGGGGG - Intronic
1112902028 13:104368667-104368689 GTCCAGTGCAGACATGCTGAAGG + Intergenic
1113265941 13:108618081-108618103 GTCCAGGGGAGAGAGCATGAGGG - Intronic
1114711010 14:24778282-24778304 GGCCAGAGGAATGATGGTGATGG - Intergenic
1115081708 14:29460968-29460990 TTCCAGTGGAAAGAAAAAGATGG - Intergenic
1115446069 14:33491417-33491439 ATCCAGTGGAAATTTGATGATGG + Intronic
1116041807 14:39694865-39694887 GGCCAGTAAAAAGATAATGATGG - Intergenic
1116783673 14:49265434-49265456 GCCCAGGGGAAAGATGGTGGTGG + Intergenic
1116789198 14:49321707-49321729 GTCCAAGAGAAAGATGATGGAGG + Intergenic
1117080884 14:52150840-52150862 GTGCAGTGGAAAGGTGTTGGGGG + Intergenic
1118128604 14:62937274-62937296 GTCAAGGAGAGAGATGATGATGG - Intronic
1118575027 14:67233660-67233682 ATCCAGGCAAAAGATGATGATGG + Intergenic
1118727722 14:68641145-68641167 GTTCAGATAAAAGATGATGAAGG + Intronic
1119333301 14:73811663-73811685 GTCCAGGGGAAAAATGAGGGTGG - Intergenic
1120086862 14:80285466-80285488 GTTCAGGGGAAAGATCAGGATGG + Intronic
1120826185 14:88957694-88957716 GTTCACTTGAAAGATGATCATGG - Intergenic
1120826398 14:88960029-88960051 GTTCACTTGAAAGATGATCATGG + Intergenic
1121342205 14:93112134-93112156 GACCCCTGGAAAGATAATGAGGG + Intronic
1121505192 14:94471909-94471931 GTCCAGGGGAGAGATAAGGAGGG - Intronic
1123130883 14:105984378-105984400 CTCCAGTGGGAAGGAGATGAAGG - Intergenic
1123581114 15:21715599-21715621 CTCCAGTGGGAAGGAGATGAAGG - Intergenic
1123617763 15:22158222-22158244 CTCCAGTGGGAAGGAGATGAAGG - Intergenic
1124027752 15:25982438-25982460 GTGGAGTGGGAAGATGATAAAGG - Intergenic
1124353099 15:28973565-28973587 ATCCAATGAAAAGATGATGTGGG + Intronic
1124820405 15:33039837-33039859 GTCCAGAGGAGAGATGATAGAGG - Intronic
1124968944 15:34465496-34465518 ATCTAGAGGAAAGATGGTGAGGG - Intergenic
1125159829 15:36630254-36630276 GTCCAGTGTCAATATGATTATGG + Intronic
1126312848 15:47336801-47336823 CTCCAGTGGAGAGATGGTCATGG - Intronic
1126964803 15:54039858-54039880 ATCCAGTGCAGAGATGATGAAGG - Intronic
1128036064 15:64527869-64527891 GTCCAGGTTAAAAATGATGAGGG - Intronic
1128754444 15:70171883-70171905 TTCCAGAGGAAAGATGTTCAAGG - Intergenic
1129725058 15:77897487-77897509 GCCATGTGGAAAGATGATGTGGG - Intergenic
1130217723 15:81987911-81987933 GTCTAGCTGAAAGATGATGAAGG - Intergenic
1130989154 15:88865526-88865548 GGCCATTGGAAGGATAATGAAGG + Intronic
1131443542 15:92476770-92476792 GTGCAGAGGAAAGAGAATGAAGG - Intronic
1131869685 15:96749892-96749914 GTGCAGTGGCATGATGATGTCGG + Intergenic
1132190340 15:99849931-99849953 ATCTAGAGAAAAGATGATGAGGG + Intergenic
1135542394 16:23341624-23341646 GCCCAGTTAAAAAATGATGAAGG + Intronic
1136488485 16:30588866-30588888 GTGCAGTGGCATGATGATAATGG - Intergenic
1137384278 16:48027172-48027194 GTCCAGGGAAAAGATGGTGATGG + Intergenic
1138012381 16:53394499-53394521 GTCTAAGTGAAAGATGATGAGGG + Intergenic
1138674435 16:58640863-58640885 GTCCAGGCGAGAGATGATGGTGG + Intergenic
1138813007 16:60172535-60172557 GTCTAGGTGAAAGATAATGATGG + Intergenic
1140185742 16:72769393-72769415 GTCCAGTGGCAAGAAAATGAGGG - Intergenic
1140256416 16:73340410-73340432 GTGCAGTGGCACGATGATCATGG + Intergenic
1140859621 16:79007487-79007509 ATCCGGGAGAAAGATGATGAAGG + Intronic
1141007147 16:80363169-80363191 GGCCAGGGGAAAAGTGATGAGGG + Intergenic
1142115775 16:88355430-88355452 GTCCAGCGGGAAGATGAACATGG - Intergenic
1142442477 16:90108179-90108201 ATTCAGTGGAAGGCTGATGAAGG - Intergenic
1142465276 17:133619-133641 ATTCAGTGGAAGGCTGATGAAGG + Intergenic
1144041397 17:11414140-11414162 GTACAGAAGAAAGATGAGGAAGG - Intronic
1144765159 17:17728555-17728577 GTCAAGTGGGAAGGTGTTGAGGG + Intronic
1146524091 17:33551368-33551390 GTCCAGGGGAGGAATGATGAGGG + Intronic
1146926642 17:36750270-36750292 GTCCAGGAGAGAGATGAGGATGG - Intergenic
1147630255 17:41925708-41925730 ATCCAGGAGAGAGATGATGAGGG + Intronic
1148986029 17:51622170-51622192 GTCCAGGCCAAAGAGGATGACGG + Intergenic
1149111378 17:53035371-53035393 ATCCAGGGAAAAGATGATGGTGG - Intergenic
1150848620 17:68683872-68683894 GTGCAGAGCAGAGATGATGAGGG + Intergenic
1150879675 17:69009705-69009727 ATCCAGAAGAGAGATGATGATGG + Intronic
1151176657 17:72294310-72294332 GTCCAGTGGCCAGATGCTCAAGG - Intergenic
1151197211 17:72440141-72440163 GTCCAGTAGAAAGCTGAAGATGG - Intergenic
1151350514 17:73529133-73529155 GTCCAGAAGAAAGATGATTCTGG + Intronic
1152025654 17:77807354-77807376 GCCAAGTGGAAAGATGGGGAGGG - Intergenic
1153607569 18:6849409-6849431 GTCCTGCAGAAGGATGATGAAGG + Intronic
1154110281 18:11562065-11562087 GCCCAATGGGAAGGTGATGATGG - Intergenic
1155002225 18:21698507-21698529 GGCCAGGGAATAGATGATGAGGG + Intronic
1155076682 18:22363441-22363463 GTCCAGAGGAAAGATGATGGAGG - Intergenic
1155549967 18:26954382-26954404 GTCCAGGGGAGACATGTTGATGG - Intronic
1156347358 18:36269748-36269770 ATCCAGGGGGAAGATGATGAAGG - Exonic
1158831451 18:61283783-61283805 GTACAGAGCAATGATGATGACGG + Intergenic
1158935926 18:62364501-62364523 GTCCAGAGGAGAGGTGATCATGG + Intronic
1159234999 18:65659980-65660002 GTCCAGGTGAGAGGTGATGATGG - Intergenic
1159490442 18:69126965-69126987 ATTCAATGGAAAGATGATAAAGG + Intergenic
1159533967 18:69691782-69691804 CTCCAGCTGAAAGATGATAAAGG + Intronic
1160267945 18:77356765-77356787 TTCCAGTGTATACATGATGATGG + Intergenic
1160900653 19:1426401-1426423 GCACAGTGGAAACATCATGAAGG + Intronic
1161881432 19:6956695-6956717 CTCCAGAGGAAAGACGATGTGGG + Intergenic
1162186764 19:8911314-8911336 GTTGAGTGGGATGATGATGATGG - Intronic
1162352521 19:10159206-10159228 GCCACGTGGAAAGCTGATGAAGG - Intronic
1163803558 19:19382865-19382887 GTACAGTGGCAAGATCATGATGG - Intergenic
1165709706 19:38002127-38002149 GTTCTGTGGATGGATGATGATGG - Intronic
1167581697 19:50348130-50348152 GGTAACTGGAAAGATGATGATGG - Intronic
1167615783 19:50532304-50532326 GTGTAGAGGAAAGATGCTGAGGG - Intronic
1167968207 19:53166170-53166192 TGTCAGTGGAAAGATGATGAAGG - Exonic
1168520088 19:57043290-57043312 ATCCAGGGGAGAGATGATGGCGG - Intergenic
925274818 2:2641280-2641302 GTCCACTGGAGGGATGGTGAGGG - Intergenic
925308118 2:2864554-2864576 ATTCAGTGGAAAGGTGATCAAGG + Intergenic
925654467 2:6131152-6131174 GCACAGTGGAAAGATGAGGGTGG - Intergenic
926798847 2:16641104-16641126 GTCCAGGAGAAAGATAATAAGGG - Intronic
926985485 2:18618041-18618063 GCACAGAGGAAAGATGATGTGGG + Intergenic
928020179 2:27698437-27698459 GTCCAGGTGAAAGATAATGGTGG + Intergenic
928265658 2:29809499-29809521 GTCCAGTAGAATGAATATGAAGG - Intronic
928281745 2:29952560-29952582 TTCCAGCGGAAAGAAGAAGATGG + Intergenic
928289275 2:30023479-30023501 GTCCAGAAGATAGATGATGATGG + Intergenic
928489164 2:31763596-31763618 GTCCAGATGATAGATGATGCTGG + Intergenic
929496109 2:42445594-42445616 GTGCTGTGTAAAAATGATGATGG - Intronic
930153019 2:48077641-48077663 GTCCTGGTGAAAGAGGATGATGG - Intergenic
930482027 2:51960562-51960584 CCCCTGTGGAAACATGATGAGGG + Intergenic
935432051 2:102986777-102986799 TTCCACTGGGAAGATGATCATGG + Intergenic
935747204 2:106198884-106198906 GTAGAGTGCAAAGATGAAGATGG - Intergenic
937234655 2:120423405-120423427 GACCAATGGAAAGAGGAGGAGGG - Intergenic
937378358 2:121353395-121353417 GTCCAGTGCCAACATCATGATGG + Intronic
939166366 2:138645310-138645332 GTCCAGTAGAAAGAGGATCGAGG + Intergenic
939695295 2:145315969-145315991 GTGCAGTGGAAAGCTATTGAAGG + Intergenic
940109765 2:150138618-150138640 GTCCAGGTGAAAGATAATCATGG + Intergenic
941760837 2:169241197-169241219 TCACAGTGGAAATATGATGAAGG + Exonic
942357044 2:175127461-175127483 GTCCAGGTGAGAGATGATGGTGG - Intronic
942894863 2:181040259-181040281 GTCCCGTGGAAGGACGAAGAAGG - Intronic
943656373 2:190513039-190513061 GTCCAGGCGAGAGCTGATGAGGG - Intronic
943665281 2:190602621-190602643 GTAGAGTGGAAAGATGGGGAGGG - Intergenic
945292899 2:208143455-208143477 ATTCAGTGGAAAGCTGATCAAGG + Intronic
946417702 2:219548855-219548877 GTCCAGTGGAAAGATGATGATGG + Intronic
1169218149 20:3805064-3805086 GTCCATGGGAAAGATGGTGTGGG + Exonic
1169732408 20:8800904-8800926 ATCCAGGGGAGAGATGATGGAGG - Intronic
1170135304 20:13067292-13067314 GCCCAATAGAAAGAGGATGAAGG + Intronic
1171211779 20:23322338-23322360 GTCCAGGTGAGAGATGATGGAGG + Intergenic
1171568554 20:26221394-26221416 GTCCAGTTGAAGGATGCTGGTGG - Intergenic
1171840880 20:30209376-30209398 GTCCAGTGGATATGTCATGAGGG + Intergenic
1172525325 20:35597502-35597524 GGCCAGGGGAAGGAGGATGATGG - Intergenic
1172590140 20:36112064-36112086 ATCCAGCGGAGATATGATGAGGG - Intronic
1172741399 20:37170659-37170681 CTCCACTGGAAGGAGGATGAGGG - Intronic
1173226055 20:41163030-41163052 GCCCAGTGGAGAGATGAAGGGGG - Intronic
1174665505 20:52254166-52254188 GTCCAGGGGAAGGAGGAGGAAGG - Intergenic
1175149512 20:56922078-56922100 ATCCAGGAGAGAGATGATGATGG - Intergenic
1175578683 20:60081878-60081900 GCCCACTGGAAAGACGATGGAGG + Intergenic
1175930712 20:62492588-62492610 GTGCTGAGGACAGATGATGAGGG + Intergenic
1175980175 20:62734894-62734916 GTCCCGTGGAAATAGGATGCAGG - Intronic
1177252308 21:18610121-18610143 GGTCACTGGAAACATGATGAAGG + Intergenic
1177294921 21:19161600-19161622 GACCAGTGAAAAAATGAAGAAGG - Intergenic
1178136613 21:29635028-29635050 GTCCAGGTGAAAAATGATGAGGG + Intronic
1178142681 21:29701761-29701783 ATCCAGGTGAGAGATGATGATGG + Intronic
1178470891 21:32891746-32891768 CTCCTGTGGATAGATGGTGAGGG - Intergenic
1179950916 21:44708428-44708450 GTCCAGAGGACAGAGGTTGAGGG + Intronic
1180282366 22:10714249-10714271 GTCCAGTTGAAGGATGATGGTGG + Intergenic
1180936695 22:19630097-19630119 CTCTAGTGGAGAGATGAGGACGG + Intergenic
1181110569 22:20600504-20600526 GTCCAGTGGCAAAAAGTTGAGGG + Intergenic
1181434368 22:22901605-22901627 GTACAGTGGAGAGCTGAGGAAGG - Intergenic
1182273432 22:29170096-29170118 TTGCAGAGGAAAGGTGATGAGGG + Intergenic
1183022038 22:35035028-35035050 GTCCAGGTGAAAGATGGTGATGG + Intergenic
1183108211 22:35629656-35629678 ATCTAGTGGAAAGATGAGAAAGG + Intronic
949176614 3:1070961-1070983 GCTCAGTGGACAGCTGATGAAGG + Intergenic
950041784 3:9924322-9924344 GAGGAGTGGGAAGATGATGATGG + Intronic
950303329 3:11900126-11900148 GTCCTCTGCAAAGATGATGCTGG - Intergenic
950800073 3:15543556-15543578 GTCCAGTAGAAATATGAAGGTGG + Intergenic
951581580 3:24170334-24170356 GTCCAGTTAGGAGATGATGATGG - Intronic
951666217 3:25127051-25127073 ATGCAGGCGAAAGATGATGATGG - Intergenic
953035228 3:39205301-39205323 GTCCTGTGGAGAGATTATGTGGG + Intergenic
953537082 3:43784569-43784591 GTCCAGGGTGAAGATGATGCTGG + Intergenic
954642623 3:52110628-52110650 CTCCTGTGGAGAGGTGATGATGG + Intronic
955252187 3:57294996-57295018 GACTTGTAGAAAGATGATGATGG + Intronic
955904879 3:63796206-63796228 GTCCAGGTGAGAGATGATGGGGG - Intergenic
956148816 3:66220099-66220121 GTTTTGAGGAAAGATGATGAGGG + Intronic
957110290 3:75946964-75946986 GTCCAGTTGAAGGATGATGGTGG + Intronic
959160835 3:102722632-102722654 ATCCACTGGGAAGATGATGAGGG - Intergenic
959343751 3:105165475-105165497 GTGAAGTGGACAGAAGATGAAGG - Intergenic
959575546 3:107929044-107929066 ATCCAGGTGAATGATGATGAAGG - Intergenic
960551947 3:118985775-118985797 GTTCAGAGGAGAGATGATAAGGG - Intronic
961003241 3:123388206-123388228 GTCCAGATGAGAGATGATGAAGG + Intronic
961171698 3:124801881-124801903 GGCCAGTGGAAAGCAGCTGATGG - Intronic
962169017 3:133081122-133081144 GTCCAGATGAGAAATGATGAAGG - Intronic
962490087 3:135884730-135884752 GGCCAGAGGAAAGATAATCACGG + Intergenic
962929214 3:140021997-140022019 GTCACCTGGAAAGATGCTGAAGG + Intronic
963224511 3:142848295-142848317 GTCCAGTGGCAACAAGATGATGG - Exonic
964011107 3:151892893-151892915 ATCCAGGTGAAACATGATGAGGG - Intergenic
965354582 3:167657822-167657844 GTCAAGAGGCAAGAAGATGATGG - Intergenic
965771407 3:172185301-172185323 GTACAGTGGGAAGAAGATGAGGG - Intronic
966431800 3:179840034-179840056 GTCCTGTGGAATGAGGAGGAGGG + Intronic
966699495 3:182831325-182831347 GTCCAGACAAAAGATGATGGTGG - Intronic
966961726 3:184946449-184946471 TGCCACTGCAAAGATGATGACGG - Intronic
967139339 3:186541050-186541072 GGCCAGGTGAGAGATGATGAGGG + Intronic
968022272 3:195403492-195403514 ATCCAGATGAAAGATGAAGATGG + Intronic
968261857 3:197331742-197331764 GTCGAGGTGAGAGATGATGATGG + Intergenic
968362750 3:198159139-198159161 ATTCAGTGGAAGGCTGATGAAGG - Intergenic
968441335 4:626009-626031 GTCCAGTGGGAAGACGATCTCGG - Exonic
968731200 4:2270177-2270199 GTCCTGAGGAAGGATGGTGAGGG + Exonic
969636960 4:8374876-8374898 GTCCCGTGGAAGGAGGACGATGG + Intronic
971284389 4:25273657-25273679 ATCCAGAGGAGAGATGATAAGGG - Intronic
973204538 4:47545478-47545500 GTCCAGTTGAGAGATGATGGTGG + Intronic
973277822 4:48327913-48327935 GTCCAGGGGAGAGATGATGGTGG - Intergenic
973553014 4:52053797-52053819 ATCCAGGTGAAAGATGATCAAGG - Intronic
974714247 4:65646357-65646379 GGTCAGTGGAAAGATCAGGAGGG + Intronic
975684887 4:76909881-76909903 GTAGAATGGAAAGATAATGAGGG - Intergenic
975844199 4:78507736-78507758 GTCCTCTGGAAAGGGGATGATGG - Intronic
976103661 4:81593274-81593296 GTCCAGATGAGAGACGATGAGGG + Intronic
976409369 4:84695379-84695401 GTTCAGAGAACAGATGATGATGG - Intronic
976872203 4:89808796-89808818 GTCCAGGTGAGAAATGATGAAGG + Intronic
977641432 4:99361963-99361985 GTCAAGAGGAAAGAAGCTGAAGG + Intergenic
977797027 4:101178697-101178719 GACCAGTGGTAAAATTATGATGG - Intronic
980016889 4:127660134-127660156 GTCCAGAAGAGAGATGATAAAGG + Intronic
980138000 4:128879261-128879283 GGACACTGGTAAGATGATGAGGG + Intronic
980765354 4:137296235-137296257 ATCCAGGTGAAAGATAATGATGG + Intergenic
980954191 4:139411430-139411452 GTCCAGATGAAAAATGATGATGG + Intronic
982204552 4:152988178-152988200 GGTCAGAGGAAAGATGATGGAGG - Intergenic
982363465 4:154549734-154549756 GTCCAGGTGAAAGATGATGTTGG + Intronic
982379404 4:154733427-154733449 GTCCAGGGAAAAGATGAAAAGGG - Intronic
982665165 4:158252369-158252391 TCCCAGGGAAAAGATGATGATGG - Intronic
982832693 4:160084222-160084244 ATCCACGGGAAAGATGATGGTGG + Intergenic
983498563 4:168473395-168473417 GTCCTGTAGAAAGATGATGGTGG + Intronic
984890700 4:184490068-184490090 GTACAGTGGAAACTGGATGAAGG - Intergenic
985137486 4:186801787-186801809 GTCCAGAGGGAAGTTGGTGAGGG + Intergenic
987389987 5:17366705-17366727 GTCCAGGAAACAGATGATGATGG + Intergenic
988055246 5:26086051-26086073 ATCCAGTAAAAAGATAATGATGG - Intergenic
988356334 5:30180552-30180574 GTTCAGATGAAAGATGATTAAGG - Intergenic
988819194 5:34863765-34863787 CTCCACTGGAAAGATGTTAAGGG + Intronic
989078174 5:37587067-37587089 GTCCAAGTGAAAGATGATAAAGG - Intronic
989389595 5:40886300-40886322 GTGCAGTGGCATGATGATCAGGG + Intergenic
989987391 5:50717227-50717249 GTCCAGGGGAAAAATGATGGTGG + Intronic
990580558 5:57163680-57163702 ATCCAGGTGAAAGATGATGGTGG - Intergenic
991056629 5:62327537-62327559 GTCCAGTGGAGATATGAAGTAGG - Intronic
991271758 5:64791960-64791982 GTCCAGTCTAGAGATAATGAAGG - Intronic
991351399 5:65723067-65723089 GACCAGTAGCAAGATGGTGAGGG + Intronic
991578647 5:68131271-68131293 GTCCAGTGGGAATATGAAGCAGG - Intergenic
992324964 5:75651503-75651525 GCCGAGTAGGAAGATGATGAGGG + Intronic
992363740 5:76070193-76070215 GGGCAGTGGAAATCTGATGAGGG - Intergenic
992423184 5:76627177-76627199 GTCCAGTTGGGAGATGATGGGGG + Intronic
992699693 5:79329587-79329609 GTCTAGTGGATAGATGACGTAGG - Intergenic
993886274 5:93419216-93419238 GTTCAGTGAAAAAAGGATGATGG + Intergenic
994013566 5:94938073-94938095 ATCCAGGTGAAAGATGATGGAGG - Intronic
994104732 5:95934571-95934593 CTCCAGTGGAAAGAAGGTGCAGG - Intronic
994820908 5:104650223-104650245 GTCAACTGGAAAGATAATCAGGG - Intergenic
995041558 5:107593867-107593889 TTCAGGTGGAAAGAAGATGATGG - Intronic
995421939 5:111977633-111977655 GTTCAGTGGAGTGATGAGGATGG - Intronic
995532505 5:113105708-113105730 GTCCAGTTGAGAGATGATGATGG - Intronic
996067637 5:119097241-119097263 GTGCAGTGGAAAACTGTTGAGGG + Intronic
996411266 5:123161922-123161944 ATCCAGGGGAGAGATGATGGTGG + Intronic
996555619 5:124776307-124776329 GTGCAGAAGCAAGATGATGATGG + Intergenic
996840970 5:127846984-127847006 GACCAGTTGAGAGATGATGAAGG - Intergenic
997829763 5:137139921-137139943 ATCCACTGGATAGATGATGCTGG + Intronic
998193319 5:140044610-140044632 GTCCAGGTGAGAGATGATGAGGG - Intergenic
998416863 5:141952440-141952462 GGCAAGTGGAAAGAGAATGAAGG + Intronic
998501305 5:142635363-142635385 GTACAATAGAAAGGTGATGATGG - Intronic
998906913 5:146915127-146915149 GCCCAGATGAAAGATGATGGTGG - Intronic
999536145 5:152519411-152519433 ATCCAGTTGATAGATGAGGATGG + Intergenic
1000093087 5:157947127-157947149 GTGCAGTGGCATGATGATCACGG + Intergenic
1000726875 5:164782851-164782873 GTGCAGTGGCATGATGATGTTGG + Intergenic
1001187808 5:169593006-169593028 GTCCAGGAAAGAGATGATGAAGG - Intronic
1001531280 5:172463591-172463613 GTCCAGCTGAGAGATGATGGTGG + Intergenic
1001569104 5:172718570-172718592 GTCGAATGGATGGATGATGATGG + Intergenic
1002036085 5:176471178-176471200 GTCCAGGGAAAAGAGAATGATGG - Intronic
1002111656 5:176918788-176918810 GTACAGTAGAAAGAAGTTGAGGG - Intronic
1002544926 5:179934598-179934620 GTACAGTGGCAAGATCATCATGG + Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1003033628 6:2623805-2623827 GTCAAGTGGATAGATCATCAGGG + Exonic
1006175386 6:32118272-32118294 TTCCAGTGGAGAGTAGATGATGG - Intronic
1006912431 6:37572085-37572107 TTCCAGAGGAAAGTTGCTGATGG + Intergenic
1007156333 6:39748275-39748297 GTTCAGTGGAAGGCTGATCAAGG - Intergenic
1007401718 6:41606287-41606309 GTCCAGGTGACAGATGATGAAGG + Intergenic
1007865964 6:44971284-44971306 ATCCAGAGGAGAGTTGATGATGG - Intronic
1008204774 6:48641308-48641330 CTCCTGAGGAAAGATGATCATGG - Intergenic
1008240877 6:49109944-49109966 GTTCATGGGAAAGATGATGATGG - Intergenic
1008521690 6:52367726-52367748 GTGTAGAGGAAAGATGAGGATGG + Intronic
1008703544 6:54130268-54130290 TTCCAGCAGAAAGATGATGTAGG + Intronic
1011938959 6:92818459-92818481 GGCCAATGCAAAAATGATGACGG - Intergenic
1012200674 6:96402556-96402578 ATCCAGAGGAAAGATAATGCAGG + Intergenic
1012915216 6:105162677-105162699 GTGCAGTGGTAAGATGATCTCGG - Intronic
1013927215 6:115487837-115487859 TTCCAGTTGAGAGAGGATGAAGG - Intergenic
1014178306 6:118354112-118354134 GTCCAGGGAACTGATGATGAGGG + Intergenic
1015264390 6:131276026-131276048 CCCCAGTGTAAAAATGATGAGGG + Intronic
1015299977 6:131642094-131642116 GTCCATTATAAAGATGAAGAAGG - Intronic
1015785282 6:136916809-136916831 GTCCAGAGAAAAGCTAATGATGG - Intergenic
1016562799 6:145415929-145415951 GTCCAGTCTAAAGAAGAGGATGG - Intergenic
1016929572 6:149390823-149390845 TTGCAGTGAACAGATGATGAAGG - Intronic
1017673064 6:156785642-156785664 GTTCTGGGGATAGATGATGATGG - Intronic
1018142692 6:160855329-160855351 ACCCAGAGAAAAGATGATGATGG - Intergenic
1019099827 6:169620505-169620527 ATTCAGTGGAAAGCTGATCAAGG + Intronic
1019252933 7:29572-29594 ATTCAGTGGAAGGCTGATGAAGG + Intergenic
1019572679 7:1720260-1720282 CTCCAGTGGGAAGACGAAGATGG + Intronic
1019632005 7:2054364-2054386 CTCCAGTGTGAAGATGATGAAGG - Intronic
1020265100 7:6555258-6555280 CTCCAGTGGAAAGGTGAAGATGG + Intergenic
1020669254 7:11086098-11086120 GTCCAGGAGAGAGTTGATGAAGG - Intronic
1021811680 7:24408232-24408254 GTCCACTGAAGAGATGAAGAGGG - Intergenic
1022574857 7:31487640-31487662 ATCCAGGGGAAAGATGACAAGGG - Intergenic
1023174012 7:37418151-37418173 GTCAAGTGGAAAGAAAATGGAGG - Intronic
1024038934 7:45534306-45534328 GTCCAGTGGAAAGATGGGTGAGG + Intergenic
1024644914 7:51362934-51362956 GTCGATTGGAATGATGATGGTGG - Intergenic
1024787011 7:52919369-52919391 TAACAGTGAAAAGATGATGATGG + Intergenic
1026660240 7:72294334-72294356 GTCCAAGTGAAAGATGATGAAGG + Intronic
1027305770 7:76895063-76895085 GTGCAGTTTAAAGATGATGTAGG - Intergenic
1027556303 7:79668819-79668841 GTCCAAATGAAAAATGATGATGG - Intergenic
1028092425 7:86720089-86720111 GTCCAAAGGAGAGATGATGGTGG + Intronic
1028609403 7:92692732-92692754 GTGCAGTGGCATGATGATCACGG - Intronic
1030265957 7:107622119-107622141 GTCCATGTGAGAGATGATGATGG - Exonic
1030687107 7:112498172-112498194 GTCCTGGGGAAGGATGATGAGGG + Intergenic
1030994918 7:116348739-116348761 GTCCAAGGGAGAAATGATGAGGG - Intronic
1032654556 7:133913444-133913466 GTCCAGGTGAAAAAAGATGAGGG + Intronic
1036406190 8:8457232-8457254 GTTCTGTGGACAGATGGTGATGG - Intergenic
1037361215 8:18076022-18076044 TTACCATGGAAAGATGATGAAGG - Intronic
1037726369 8:21485945-21485967 TTCCTGTGGAGAAATGATGATGG - Intergenic
1038906543 8:31910517-31910539 GTCCAGCAGAGAGATGATGTTGG + Intronic
1039389770 8:37169346-37169368 GGAAAGTGGAAAGAGGATGAGGG + Intergenic
1039952988 8:42186390-42186412 GTTCAGTGAAAAGCTGATCAAGG + Intronic
1041862155 8:62526787-62526809 GTGAAGTGGAGAGATGATCAGGG - Intronic
1042379847 8:68100893-68100915 GCCCAGTTGAATGATGTTGATGG + Intronic
1043102471 8:76063362-76063384 GTCCAATGGAGAGAAGCTGAAGG + Intergenic
1043939614 8:86182116-86182138 GTCCAAGAGAAAGATGATGATGG - Intergenic
1044688735 8:94855196-94855218 GTCCAGTGGGAACATAATGTAGG + Intronic
1045663056 8:104457994-104458016 GTCCAGTGGGAAGACGAAGGTGG - Intronic
1046256268 8:111700046-111700068 CTCCAGTGGAGAGAGGATAATGG + Intergenic
1046413485 8:113879333-113879355 GTTCTGTGAAAAAATGATGATGG - Intergenic
1046803543 8:118455093-118455115 GTCCAGTGGGAGGATGAGGAAGG - Intronic
1046876458 8:119259988-119260010 GACCAGGTGAGAGATGATGATGG + Intergenic
1046955039 8:120054032-120054054 GTCCAGTGAAAAGACGAAGCGGG - Intergenic
1047110990 8:121789405-121789427 GTTCAGTGGAAGGCTGATCAAGG + Intergenic
1048426951 8:134331751-134331773 CTCCACTGGAAAGATTAGGAAGG + Intergenic
1048810818 8:138284440-138284462 GTGGAGTGGAAAGATGCTGAAGG - Intronic
1048870399 8:138792441-138792463 AGCCAGTTGAAAGAAGATGAAGG - Intronic
1049906932 9:226498-226520 ATCCAGGGGAAAGATGACGATGG + Intronic
1050054293 9:1635846-1635868 GTACAGTGGAAAGATAAGGCAGG - Intergenic
1050797805 9:9567054-9567076 GTCTAATGGAAATATGTTGAAGG + Intronic
1051351429 9:16201450-16201472 GTCCAGGAGAAAGGTGGTGAGGG - Intergenic
1051509214 9:17859211-17859233 GTGAAGTGAAAAGAGGATGAAGG - Intergenic
1053154834 9:35770096-35770118 GTCCAGATGAAGGATGATGGTGG + Intergenic
1055054305 9:72010141-72010163 ATTCAGTGGAAAGCTGATCAAGG - Intergenic
1055737557 9:79348152-79348174 GTCCAGAGGAGAGATGATCGTGG - Intergenic
1055905991 9:81293451-81293473 GTCCAATGGAAACATAATGTGGG + Intergenic
1057229402 9:93310543-93310565 GTTCAGTGGATGGATGGTGATGG - Intronic
1057528999 9:95827361-95827383 GTGCAGTGGAAAGTTGGTGGAGG - Intergenic
1057787333 9:98096750-98096772 GTCCAGGAGAGAGATGATGGTGG - Intronic
1057864932 9:98672611-98672633 GTTCATTTGAAAGATGCTGAGGG - Intronic
1058317467 9:103586588-103586610 GAACAGTTGAAAGATGGTGAAGG - Intergenic
1059093665 9:111389315-111389337 GTCCACTGGGAAGATGGTTAAGG - Intronic
1059385661 9:113962325-113962347 GTCCAGGGAAAAGATGATGGTGG - Intronic
1059619211 9:115984825-115984847 GTCTATGTGAAAGATGATGATGG - Intergenic
1060274453 9:122171857-122171879 ATCAAGGGGAAAGATGATGGAGG - Intronic
1060284692 9:122238837-122238859 GTCCAGGGAAGAGATGATGGTGG + Exonic
1061060690 9:128248889-128248911 GTCCAATAGAAATATCATGAGGG + Intronic
1061949447 9:133928054-133928076 GTCCAGTGTGAAGTTAATGACGG + Intronic
1062088497 9:134661419-134661441 GTCCTGTGGGCAGATGCTGACGG + Intronic
1062201307 9:135304276-135304298 GATGAGTGGATAGATGATGATGG + Intergenic
1062747437 9:138222802-138222824 ATTCAGTGGAAGGCTGATGAAGG - Intergenic
1185804952 X:3048490-3048512 ATTCAGTGGAAAGCTGATCAAGG + Intronic
1185989428 X:4876459-4876481 ATTCAGTGGAAAGAGGAAGAGGG + Intergenic
1186093486 X:6074981-6075003 GTACAGAGGAAAGATGACTAGGG + Intronic
1188340377 X:28993379-28993401 GTCCAGAGGAGACATGATGGTGG + Intronic
1189508753 X:41639487-41639509 ATCCAGGTGAAAGATGATGGTGG + Intronic
1189624879 X:42886335-42886357 GTCTAGATGAAAGATGATGGTGG + Intergenic
1191951271 X:66596551-66596573 CTCTAGAGGAAAGATAATGATGG - Exonic
1192205374 X:69092434-69092456 GTCCAGGTGAGAGATGATGGTGG + Intergenic
1192250241 X:69407141-69407163 GTCCAGGAGACAGATGGTGATGG + Intergenic
1192264112 X:69527055-69527077 ATCCAGGTGAGAGATGATGATGG + Intronic
1192950467 X:76010961-76010983 GAGCTGTGGCAAGATGATGAGGG - Intergenic
1193213813 X:78839357-78839379 ATTCAGTGGAAGGCTGATGAAGG + Intergenic
1195005229 X:100679146-100679168 GACCAGTGCAAAGGTGGTGAAGG + Intronic
1195476286 X:105289459-105289481 GTCCAGAGGGAAGATGATTATGG + Intronic
1195619491 X:106938810-106938832 AGCCAAAGGAAAGATGATGAGGG + Intronic
1196238393 X:113309795-113309817 TTCCAGATGAAATATGATGAGGG - Intergenic
1196722402 X:118866684-118866706 GTCCAGATGAAAGATGATGATGG - Intergenic
1197179412 X:123518148-123518170 TTCCAGGGGCAAGATGATGGTGG + Intergenic
1197605252 X:128578113-128578135 ATACAGAGGAGAGATGATGATGG - Intergenic
1197926710 X:131654753-131654775 GTCCAGTGAAACGATAATGCAGG - Intergenic
1197936460 X:131745006-131745028 GTGCAGTGGCATGATGATCATGG - Intergenic
1198007953 X:132518006-132518028 GTCCAGGCCAAAGATGATTATGG + Intergenic
1198183589 X:134233483-134233505 GTCCAGTCAAAAGATGATGAGGG + Intergenic
1198251721 X:134885475-134885497 GTCCAGTTCAAAGAAGATGATGG - Intergenic
1198310782 X:135424738-135424760 GTCCAGTGGGCAGCTGAGGAGGG - Intergenic
1198427063 X:136530934-136530956 GTCCTGGGGAAAAATGATGAGGG + Intergenic
1198591295 X:138185666-138185688 GTCCAGATGAGAGATGATGATGG - Intergenic
1198744925 X:139880156-139880178 CTCAAGATGAAAGATGATGAGGG + Intronic
1200036833 X:153336412-153336434 GTCAGGTGGAAAGAACATGAAGG + Intronic
1200738742 Y:6830200-6830222 GTTCAAGGGAAAGATGATTATGG + Intergenic
1201104884 Y:10756152-10756174 GTGCAGTGGAATGGAGATGAGGG - Intergenic
1201276304 Y:12302117-12302139 ATTCAGTGGAAAGCTGATCAAGG - Intergenic