ID: 946421949

View in Genome Browser
Species Human (GRCh38)
Location 2:219570358-219570380
Sequence CGGCGGCGGTCCGGGAGCAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946421942_946421949 1 Left 946421942 2:219570334-219570356 CCGTCGCGGTCGCGGTACATGAG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 946421949 2:219570358-219570380 CGGCGGCGGTCCGGGAGCAGCGG 0: 1
1: 0
2: 1
3: 23
4: 261
946421941_946421949 4 Left 946421941 2:219570331-219570353 CCGCCGTCGCGGTCGCGGTACAT 0: 1
1: 0
2: 0
3: 1
4: 8
Right 946421949 2:219570358-219570380 CGGCGGCGGTCCGGGAGCAGCGG 0: 1
1: 0
2: 1
3: 23
4: 261
946421938_946421949 18 Left 946421938 2:219570317-219570339 CCTTGAGCACGAAGCCGCCGTCG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 946421949 2:219570358-219570380 CGGCGGCGGTCCGGGAGCAGCGG 0: 1
1: 0
2: 1
3: 23
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946421949 Original CRISPR CGGCGGCGGTCCGGGAGCAG CGG Exonic
900138025 1:1126785-1126807 CAGCGGCCCTCCGCGAGCAGCGG + Intergenic
900138093 1:1127240-1127262 CTGCGGCGGGCCGGGCACAGTGG - Intergenic
900179498 1:1305015-1305037 GGGCAGGGGTCCAGGAGCAGAGG + Intronic
900645252 1:3706111-3706133 CGGAGGCGGGCCGGGGGCGGGGG - Intronic
903573415 1:24322583-24322605 CGGCGGCGGCCCGGGCGGCGCGG + Intronic
903668586 1:25022485-25022507 CGGAGGCAGGCCGGGAGCTGGGG - Intergenic
903828650 1:26161969-26161991 CGGCGGCGGCTCGGAGGCAGCGG + Exonic
904215402 1:28914783-28914805 CGGCGGCGGCGCGGGAGCCGGGG + Intronic
904753174 1:32753904-32753926 CGGGGGCGGGCCCGGAGGAGGGG - Intronic
906214261 1:44030157-44030179 CGCGGTCGGTCTGGGAGCAGCGG + Intronic
908355587 1:63323017-63323039 CGGCGGCGGGGAGGGGGCAGCGG - Intergenic
914779930 1:150776121-150776143 CGGGCGCGGGCCGGGCGCAGTGG - Intergenic
915549590 1:156624567-156624589 CGGCGGAGGTCGGGGATAAGAGG - Intronic
916179224 1:162069811-162069833 CGGCGCCGGCCCCAGAGCAGTGG - Exonic
916890253 1:169106606-169106628 CGGCGGCGGGGCGGGGGCGGAGG - Exonic
918388856 1:184037425-184037447 CGGCGGCTGCCGGGGAGCAAGGG + Exonic
921039472 1:211416462-211416484 CGCCGGCGCTCCGGAGGCAGGGG - Intergenic
922314844 1:224434042-224434064 CGGCGGCGGTGGAGGAGGAGGGG - Exonic
922739764 1:228008420-228008442 GGGCGCCGGGCCAGGAGCAGCGG + Intronic
922740002 1:228009353-228009375 CGGCAGGGGTCCAGCAGCAGGGG - Intronic
1063458496 10:6201536-6201558 AGGCGGCGGGTCGGGAGGAGTGG + Intronic
1066685376 10:37976520-37976542 CCGGCGCGGGCCGGGAGCAGAGG - Exonic
1067830161 10:49607147-49607169 CGGCGGCTGGCGGGGAGAAGAGG + Intergenic
1068560820 10:58512908-58512930 CGGCCCCGGTCCGGGTCCAGTGG - Intergenic
1069424715 10:68279139-68279161 CCGCGGCGGTCCGGGAGGTCGGG - Intergenic
1070162392 10:73874170-73874192 CGGCGGCGCGTGGGGAGCAGCGG + Intronic
1071086788 10:81875137-81875159 GGGCGGCGGGCGGGGAGGAGAGG - Intergenic
1071571826 10:86701356-86701378 AGGCTGGGGTCTGGGAGCAGGGG - Intronic
1071813438 10:89207882-89207904 CGCCGGCGTTCGGGGACCAGCGG - Intergenic
1072351854 10:94565047-94565069 CGTCAGGGGGCCGGGAGCAGTGG + Intronic
1073049187 10:100656687-100656709 CCGCGGCGGGCGGGGCGCAGCGG + Intergenic
1073268304 10:102241438-102241460 GAGAGGCGGCCCGGGAGCAGGGG - Exonic
1074173457 10:110970192-110970214 TGGCGGGGGTTGGGGAGCAGCGG - Intronic
1075519741 10:123136404-123136426 CGGCGGGGGTCAGGGTGTAGGGG - Exonic
1076690157 10:132219694-132219716 CGGCAGCCGTCCTGGAGGAGGGG + Intronic
1076921633 10:133457425-133457447 CGGCGGGGGGCCTGGAGCACAGG - Intergenic
1077253633 11:1571467-1571489 CGGAGTCGGTCCGGGAGGTGTGG - Intronic
1079076657 11:17388930-17388952 CGGGGGCGCTCCGGGAGGGGTGG - Intronic
1079126238 11:17720329-17720351 CCGCCGCGGCCCGGGGGCAGCGG - Exonic
1079451199 11:20601247-20601269 CGGCGGCGGGGCGGCAGCCGCGG - Exonic
1080643605 11:34173047-34173069 GGGCGGGGGTCAGAGAGCAGGGG - Intronic
1080779947 11:35420104-35420126 GGGCGGCGGGCGGGGTGCAGGGG + Intergenic
1083207461 11:61161292-61161314 CGGGGGCGCTCCGGGAGCCACGG + Intronic
1083303271 11:61749835-61749857 CGGGGGCGGTGAGGGAGCTGCGG + Intergenic
1083618029 11:64035988-64036010 CGGTGGCGGGCCCGGAGCGGGGG - Intronic
1083679594 11:64344997-64345019 CAGCAGCGGGCCGGGAGCGGAGG + Exonic
1083753866 11:64778567-64778589 CGGGGGCGGGCCGGGGGCGGCGG + Intronic
1084154996 11:67308350-67308372 GGGCGGCAGGCCAGGAGCAGAGG + Intronic
1084345972 11:68549176-68549198 GGGAGGGGGACCGGGAGCAGTGG - Intronic
1084575468 11:69985726-69985748 CGGGGGCGGGCCGGGACCTGGGG + Intergenic
1087163376 11:94973379-94973401 CGGTGGAGGCCCTGGAGCAGCGG - Intronic
1089543594 11:119206054-119206076 CCGCGGCTTTCCGGGAGCTGTGG + Exonic
1089620098 11:119717255-119717277 CAGAGGCAGGCCGGGAGCAGGGG + Intronic
1090817791 11:130314453-130314475 CGGCGGCGGCCCGGGGGGAGGGG + Exonic
1090832413 11:130428476-130428498 GGGCGGCGGCGCGGGAGGAGCGG - Exonic
1091422164 12:351212-351234 CGGGGCCTGTCCGGGAGTAGGGG - Intronic
1091473816 12:753061-753083 CGGTGGCGGCCCCGGGGCAGAGG - Exonic
1092230305 12:6772452-6772474 GGGGGGCGGGCCGGGAGGAGGGG + Intergenic
1096589328 12:52646996-52647018 CGGAGGCGGACAGAGAGCAGAGG + Intronic
1097218139 12:57430484-57430506 GGGCGGCGGTGCGGGGGCAGGGG - Intronic
1100830938 12:98516095-98516117 CGGCGGCGGCCCCAGAGCCGAGG - Exonic
1102116005 12:110403464-110403486 CGGCGGCGGTCTGGGAGCGGGGG - Intronic
1102197199 12:111034077-111034099 CGGCGGCGGCCCCGGGGCTGGGG + Exonic
1102362641 12:112301467-112301489 AGGCGGAGGTCTGGGTGCAGTGG - Intronic
1103017971 12:117510587-117510609 CTGCGACAGGCCGGGAGCAGTGG + Intronic
1103850267 12:123928409-123928431 CGGCGGTGGCTCGGGGGCAGTGG + Exonic
1104865402 12:131950344-131950366 CGGCGGCGTTGCGGGAACCGGGG + Intronic
1105407202 13:20142499-20142521 CGGCGGGCGGCCGGGAGCTGGGG + Exonic
1107695099 13:42992176-42992198 CGACGGCGGCCCGGGACCCGCGG - Exonic
1111396247 13:87672475-87672497 CGGCGGAGGTCCGGCTGGAGAGG - Intergenic
1112570457 13:100588805-100588827 CGGGGGCGGCCTGGGAGCAGAGG - Intronic
1113962133 13:114132179-114132201 CGGGGCCGCTCCGGGCGCAGAGG + Intronic
1114458421 14:22872114-22872136 CGGCGGCAGCCCGGGAGTAGGGG - Exonic
1116887050 14:50231661-50231683 CCGCGGCGGGCGGTGAGCAGCGG + Intergenic
1127439024 15:58987725-58987747 CGGCGGCTGTAGGGGAGCAGCGG + Intronic
1128310933 15:66631400-66631422 CGGCAGTGGTCAGGGGGCAGGGG + Intronic
1131131439 15:89903240-89903262 CAGCGGAGATCCGAGAGCAGGGG - Exonic
1132314511 15:100880071-100880093 CGGCGGGGGCGAGGGAGCAGCGG + Intronic
1132553170 16:561453-561475 GGGCGGCGGGCAGGGAGAAGGGG + Intronic
1132828929 16:1918269-1918291 CGGGGGCGGCCAGGGCGCAGGGG - Exonic
1132856644 16:2047990-2048012 CGGCGGCGTCCCGGGGCCAGGGG + Exonic
1132893325 16:2215099-2215121 CCGCGGCAGCCCGGGAACAGCGG - Intergenic
1133097278 16:3456304-3456326 AGTCTGCGGTCCAGGAGCAGCGG - Intronic
1133784506 16:8963784-8963806 CGGCCGCGTTCCGAGAGCCGCGG + Intronic
1136188260 16:28600762-28600784 CGGCGGAGGTCGGGGTGCAGCGG + Intergenic
1136190732 16:28613756-28613778 CGGCGGAGGTCGGGGTGCAGCGG + Intronic
1136913022 16:34159630-34159652 CGGAGGCGGTGGGGGAGCCGCGG + Intergenic
1137236327 16:46621317-46621339 GGGCGGCGGTCTGGAGGCAGCGG - Exonic
1137618361 16:49859387-49859409 CAGCGGCAGTCAGGGTGCAGAGG + Intergenic
1137734017 16:50711090-50711112 TGGGGTCGGTCGGGGAGCAGTGG - Exonic
1137824483 16:51479412-51479434 CGGGGCCTGTCAGGGAGCAGAGG - Intergenic
1139528166 16:67529035-67529057 CGGCCGGGGTCCGGGAGATGGGG - Intronic
1139534413 16:67562686-67562708 CGGCGGCGGAGCGGGCGCCGCGG + Exonic
1139664837 16:68448230-68448252 CGGCGGCTGTCCGGGACCCGCGG + Intronic
1140072354 16:71662142-71662164 CGGGTGCGGGCCGGGCGCAGTGG + Intronic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1141644640 16:85360621-85360643 GGGCGGCGGGGCGGGTGCAGGGG + Intergenic
1142214125 16:88822486-88822508 AGGCGGCGGGCAGGGTGCAGAGG + Intronic
1142697695 17:1643067-1643089 CGGCGGGGCGCCGGGAGGAGGGG - Intronic
1142698863 17:1647885-1647907 AGGTGGCTGTCCGGAAGCAGCGG - Exonic
1143483349 17:7239288-7239310 GGGCGCCGGACCGGGAGGAGGGG - Exonic
1143492979 17:7294609-7294631 CGGCAGCGGGCCCGGAGCCGAGG + Intronic
1143579569 17:7817729-7817751 TGGGGGCGGTACGGGAGCATGGG + Intronic
1143590849 17:7885222-7885244 CCGCGGCGGTCCGGGAGGTCGGG + Intronic
1144764230 17:17724217-17724239 CGGCGGCGGGCCGGGGGCTCGGG - Intronic
1146382634 17:32342182-32342204 CGACGGCTGCACGGGAGCAGGGG - Exonic
1147184372 17:38705569-38705591 CGGCGGGGGTCGGGGGTCAGGGG - Exonic
1147189251 17:38729499-38729521 AGGGGGCGGGACGGGAGCAGGGG - Exonic
1147314396 17:39612666-39612688 CTGCGGCGGGCGGGGAGGAGGGG - Intergenic
1148048647 17:44758892-44758914 CGGCGGCGGCCCGGGCCCTGCGG + Intergenic
1148060133 17:44830326-44830348 CCGCCGCGGCCCGGGAGCGGGGG + Intronic
1148836570 17:50468850-50468872 CGGCGGCGGGGCGCGGGCAGCGG + Exonic
1150791887 17:68205748-68205770 CGGCGGCGGGGCCGGGGCAGGGG - Intergenic
1152111625 17:78360230-78360252 CGAGGGCGGGCCGCGAGCAGGGG + Intergenic
1152175239 17:78782554-78782576 AGGAGGCGGACCGGGAGAAGGGG - Intergenic
1152740711 17:82017157-82017179 GGGCGGGGGTCCGGGTGCTGTGG + Intronic
1153997436 18:10454524-10454546 CGGCGGCTGCCCGGGGGCGGTGG + Intergenic
1157374473 18:47150472-47150494 CGGCGTCCGTCGGGCAGCAGCGG - Exonic
1160719161 19:589995-590017 CGGCGGCGGCCCCGGCGCGGGGG - Exonic
1160824102 19:1071427-1071449 CGCCCGCGGTGGGGGAGCAGCGG + Intronic
1160960557 19:1718831-1718853 CCGCGGGGGCCCGGGAGGAGAGG + Intergenic
1160967703 19:1753839-1753861 CGGCGGCGGTGGGGGCGCCGGGG + Exonic
1162128446 19:8511648-8511670 AGCCGGCGGCCCGGGTGCAGCGG + Exonic
1162959472 19:14117563-14117585 CGGGGCCGGTCCCGGAGCTGCGG + Exonic
1162975669 19:14206135-14206157 CGGCGGCGGTGCTGGGCCAGGGG - Exonic
1163715539 19:18870344-18870366 CCGCGGCGGCCCGGGACCAGTGG + Exonic
1164833421 19:31340517-31340539 GGGCGGCGGGCAGGGAGGAGGGG + Intronic
1165065491 19:33225863-33225885 CGGCGGGGGCCCGGGAGGGGCGG + Intergenic
1165363650 19:35351359-35351381 AGGCAGCAGTCAGGGAGCAGCGG - Intergenic
1165396683 19:35568227-35568249 GGACGGTGGTCCAGGAGCAGTGG + Intergenic
1165924867 19:39320759-39320781 CTGCAGCGGCCCGGGAGCGGCGG - Intergenic
1166375221 19:42324052-42324074 CGGCGGCGGCCGGGGAGCTGGGG - Intronic
1168056090 19:53866172-53866194 CGGAAGGGGTCCGGGAGCTGGGG - Intergenic
927809315 2:26172987-26173009 GGGCGGGGGTCCGGGAGGAGGGG + Intergenic
927809326 2:26173008-26173030 GGGCCGGGGTCCGGGAGGAGGGG + Intergenic
927997300 2:27495067-27495089 CGGAGTCTGTCCGGGAGCAGGGG + Exonic
929711614 2:44272261-44272283 CGGCGCCTGGCCAGGAGCAGAGG + Intergenic
929983017 2:46698990-46699012 CGGGGGCGGCCCGGGAGTCGGGG - Exonic
931869917 2:66446095-66446117 CGGCTGCGACCCCGGAGCAGAGG + Intronic
932492920 2:72132979-72133001 CGGGGGCGATGGGGGAGCAGGGG - Intronic
933973113 2:87486166-87486188 CGGCGTCTGGCCAGGAGCAGGGG + Intergenic
934882445 2:97995719-97995741 CGGCGGCGGCGCGGAAGCCGTGG + Exonic
935196630 2:100820199-100820221 CGGCTGCGGCCCAGGAGCGGCGG + Exonic
936278885 2:111121503-111121525 CGGCGCCGGCCCGGGAGCTGAGG + Intronic
936320607 2:111464047-111464069 CGGCGTCTGGCCAGGAGCAGGGG - Intergenic
938018278 2:127885652-127885674 GGGCGAGGGTCCGGGGGCAGCGG - Intronic
939613017 2:144332543-144332565 CGGCCGCGGGCCGGGAGGGGCGG - Intronic
941929962 2:170929414-170929436 CGACGGCGGCCGGGGAGCTGCGG + Intronic
943725333 2:191246095-191246117 CGGCGGCGGCGGGGGAGGAGGGG + Intronic
944221804 2:197310732-197310754 CGGCGGCGGAGGAGGAGCAGGGG - Exonic
945466042 2:210171398-210171420 CTGCCGCGGTCTGGGAGCAGTGG + Intergenic
946421949 2:219570358-219570380 CGGCGGCGGTCCGGGAGCAGCGG + Exonic
946692285 2:222319063-222319085 CGGCGGCGGCCCGAGGGCACGGG - Intergenic
946692441 2:222319572-222319594 GGGAGGCGGTCCTGGGGCAGCGG + Intergenic
947407151 2:229790516-229790538 CGGCAGGGGGCAGGGAGCAGGGG + Intronic
947800870 2:232928005-232928027 CGGCGGCGGGGCGGGTGCGGGGG + Intronic
948945695 2:241217966-241217988 CAGGGGCGGGCCGGGGGCAGCGG + Intronic
949000468 2:241610238-241610260 AGGGGGCCGCCCGGGAGCAGAGG - Intronic
1168804451 20:664215-664237 CGGCGGCGGGGCGGGGGCGGCGG - Exonic
1171810655 20:29742801-29742823 CGGCGGCGGTGTTGGAGCCGCGG - Intergenic
1172111083 20:32545445-32545467 AGTCGGCTGTCCGGCAGCAGAGG - Intronic
1174204306 20:48827945-48827967 CGCCGGCGGGCCGGGCTCAGCGG + Intergenic
1174317452 20:49713734-49713756 AGGCGGCGGACGGGGAGCTGCGG - Exonic
1175446365 20:59022961-59022983 TGGCGGGGCTCTGGGAGCAGTGG + Intronic
1175593555 20:60212875-60212897 GGGCAGCGGTCAGGGAGCAAAGG + Intergenic
1175847458 20:62066075-62066097 CGGCCGGGGTGCGGCAGCAGCGG + Intergenic
1176550122 21:8217268-8217290 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1176569050 21:8400303-8400325 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1176576964 21:8444538-8444560 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1177188076 21:17819497-17819519 CGGCGTCGGTGCAGGAGCGGAGG - Intergenic
1178708067 21:34890249-34890271 CGGGGGCGTTCCGGGAGCTCCGG - Intronic
1178948220 21:36966045-36966067 CTGTGGCGGGCCGGGAGCGGTGG - Intronic
1179537959 21:42064322-42064344 CGGAGGCCGTCCGGCAGGAGGGG - Intronic
1179548941 21:42131098-42131120 GGGAGTCAGTCCGGGAGCAGTGG - Intronic
1180342443 22:11629106-11629128 CGGCGGCGGTGGGGAAGCCGCGG + Intergenic
1180836045 22:18929884-18929906 CGGCTGCTGTCAGGGTGCAGGGG + Intronic
1184002334 22:41684193-41684215 CTGCGCCTGGCCGGGAGCAGAGG + Intronic
1184265322 22:43343182-43343204 GGGCGGCTGGCCGGGGGCAGCGG - Exonic
1184593891 22:45502921-45502943 CGGGCGCGGTCCTGGGGCAGCGG - Exonic
1185315661 22:50178199-50178221 GGGCGGCGGGGCGGGGGCAGGGG - Exonic
1203255015 22_KI270733v1_random:133600-133622 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1203263071 22_KI270733v1_random:178679-178701 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1203286137 22_KI270734v1_random:155183-155205 CGGCTGCTGTCAGGGTGCAGGGG + Intergenic
952816723 3:37452902-37452924 CGGCGGCCGCCCGGAGGCAGAGG - Intronic
953950789 3:47188409-47188431 CCGAGGTGGGCCGGGAGCAGTGG - Intergenic
954025720 3:47781758-47781780 CGGCGGCGGGCCGGGGACAGCGG - Exonic
954076833 3:48187913-48187935 CGGCGGCGGTGCGGGGGCTCCGG + Exonic
954198043 3:49007829-49007851 AGGCGGAGGCCCGGGAGCTGAGG + Intronic
954468880 3:50674992-50675014 AAGCGGCGGCACGGGAGCAGCGG + Intergenic
955856497 3:63278570-63278592 GGGCGGCTGGCTGGGAGCAGGGG + Intronic
961067004 3:123884214-123884236 CGAAGGCGGCCCGGGAGCCGGGG + Intronic
961692601 3:128680852-128680874 TGGCGGCAGTGCCGGAGCAGCGG - Intronic
961827476 3:129606588-129606610 CGGCGGCGGCCCGGGCGCTAAGG + Exonic
962498617 3:135966441-135966463 CGGCCGCGGTGCAGGACCAGGGG - Intronic
962575573 3:136752294-136752316 CGCCGGGGGTTCGGGAGCGGGGG + Exonic
963236716 3:142963591-142963613 CGGCCGCGCGCCGGTAGCAGGGG - Exonic
966874610 3:184314995-184315017 GGGCGGCGGGCCGGGAGCCGTGG - Intronic
968582899 4:1403159-1403181 CGGGGGCGGACCGGGACCGGGGG - Exonic
968594065 4:1473378-1473400 CCGGGGCGGTGCGGGAGCACTGG - Intergenic
968701833 4:2061176-2061198 GGGCGGAGGTCGGGGAGCGGCGG - Intronic
968708583 4:2095826-2095848 AGGCTGCGGGCCGGGAGCTGGGG - Intronic
971457812 4:26860800-26860822 CGGCGGCGGCGCGGGAGCTGGGG + Intronic
981528808 4:145733194-145733216 CTCCGGCGGGCCGGGAGGAGCGG - Intronic
984973366 4:185209753-185209775 CGCCGGCGCTCCGGAGGCAGGGG - Intronic
985064241 4:186105304-186105326 CGGCGGAGCCCCGGGAGTAGGGG - Intronic
986152433 5:5140115-5140137 CGGAGGCGAGCGGGGAGCAGAGG - Intergenic
994525440 5:100900867-100900889 CGCCGGCGCTCTGGCAGCAGGGG + Intronic
995525012 5:113043802-113043824 AGCCAGCGGTCTGGGAGCAGAGG - Intronic
998236435 5:140402159-140402181 CGGCAGCGGTACGGGCGGAGGGG + Exonic
1002006430 5:176238413-176238435 CGGCGGCGGGGCGGCGGCAGCGG - Exonic
1002927248 6:1611576-1611598 CGGCGGCGGCGCGGGGGCCGCGG + Exonic
1003645372 6:7910129-7910151 CCGGGGCGGTGCGGGAGGAGGGG - Intronic
1004405719 6:15331576-15331598 CGGTGGGGGGCCGGGTGCAGTGG + Intronic
1004923949 6:20401925-20401947 CGGCGGCAGCCCGGGTGCTGCGG - Intronic
1005875507 6:30007433-30007455 CCGCGGCGGTCCAGGAGCGCAGG - Intergenic
1006043081 6:31271211-31271233 CCGCGGCGGTCCAGGAGCGCAGG + Exonic
1006052674 6:31356305-31356327 CCGCGGCGGTCCAGGAGCGCAGG + Exonic
1006058637 6:31403724-31403746 CCTCGGCGGAGCGGGAGCAGTGG + Intronic
1006580722 6:35076134-35076156 CTGAGGCTGTCCGGGCGCAGTGG + Intronic
1006725381 6:36196457-36196479 CGGTGGCGGTGCGGGCGCGGCGG - Intergenic
1007406030 6:41637033-41637055 CGGCTGCTGTCCGGGAGCTCTGG - Intronic
1007448004 6:41921651-41921673 GGGCGGGGGTCCGGGAGAAGCGG + Exonic
1007701919 6:43770783-43770805 CGGCGGCGAGCCGCGGGCAGGGG + Exonic
1008920905 6:56843586-56843608 CGGCAGCGGTGCGGGAGGACCGG + Intronic
1011226913 6:85117864-85117886 GGGCGGGGGTGCGGGGGCAGGGG + Intergenic
1013170788 6:107634932-107634954 CGGCGGCGGGCGGGCTGCAGTGG - Exonic
1015220666 6:130801581-130801603 CCGCGGCGGTCCGGGAGGTCGGG - Intergenic
1015376146 6:132512830-132512852 CGCAGGCGCTCCGGGAGCTGGGG + Intronic
1015999642 6:139029472-139029494 CGGCGCCGGGCCGGGAGCTGCGG + Intronic
1016386716 6:143536961-143536983 CGGCGGCGGGGCCGGAGCACCGG - Intronic
1018892290 6:167990606-167990628 CGGGGGCGAGCCGGGCGCAGCGG - Intergenic
1019320558 7:413627-413649 AGGTGTCGGTCCGGGAGCGGTGG - Intergenic
1019428326 7:987580-987602 CGGCGGGGGTCCAGGGGCACTGG + Intronic
1021106699 7:16646115-16646137 CGGGGGCGGTACGGGAGGCGGGG + Exonic
1022396091 7:29989361-29989383 CGGCTGCGGTGCGGGAGCCCGGG + Intronic
1028985821 7:97007298-97007320 CGGCAGCTGTCCGGGCGGAGCGG - Intronic
1029437201 7:100569960-100569982 ACTCGGCGGGCCGGGAGCAGCGG - Intergenic
1031629888 7:124033143-124033165 CGGCCGCGGTCCCGCGGCAGCGG + Intergenic
1031895934 7:127347848-127347870 CGGCGGCGCTCACGGAGCCGCGG + Intronic
1034243132 7:149624686-149624708 CAGGGGCAGTCAGGGAGCAGCGG - Intergenic
1034451966 7:151141967-151141989 CGGCGGAGGAGCGGGAGCTGTGG + Exonic
1034457859 7:151181132-151181154 CGGCGGCAGGCCAGGTGCAGGGG + Exonic
1034470455 7:151251889-151251911 GGGCGGCGGCCGGGGAGCTGGGG + Intronic
1034846618 7:154451920-154451942 AGGCCTCGGTGCGGGAGCAGCGG - Intronic
1035612159 8:973820-973842 CCGCGGCGGTCCGGGAGGTCGGG + Intergenic
1040850965 8:51899651-51899673 CGCCGGGCGTCCGGGAGCTGAGG - Intergenic
1044707718 8:95024838-95024860 CGGCGGCGGCCCAGATGCAGAGG + Intronic
1045160757 8:99541501-99541523 CGGGGCCTGTCCGGGTGCAGGGG - Intronic
1047262377 8:123274418-123274440 CAGCGGCCGTCCGGGGGCGGAGG + Exonic
1049708116 8:144052023-144052045 CGGCGGGGCTCGGGGGGCAGAGG - Exonic
1049759780 8:144326734-144326756 CGGCGGCCGGCAGGGGGCAGTGG - Exonic
1049762280 8:144336911-144336933 CGGCGGCGGGCGGGGGGCGGGGG + Intergenic
1049801131 8:144517974-144517996 CGGCGCCGGGCGGGGAGCGGCGG + Intronic
1056643347 9:88388832-88388854 CGGCGGCGGCCGGGGAACTGGGG - Intronic
1056799540 9:89681489-89681511 CGGTGGCGGGGCGGGGGCAGCGG - Intergenic
1057259591 9:93576441-93576463 GGGCGGCGGGCGGGGAGCCGCGG - Exonic
1057872915 9:98731679-98731701 TGGCGGGGGTCCTGGAGCAAAGG + Intronic
1057976523 9:99611057-99611079 GGGCGGCAGGCAGGGAGCAGTGG - Intergenic
1060096268 9:120793366-120793388 AGGCTGCGGACCGGGAGCAGCGG - Exonic
1061272145 9:129549794-129549816 CGCAGATGGTCCGGGAGCAGGGG + Intergenic
1061325756 9:129863173-129863195 CAGCGGCGGGCTGGGTGCAGGGG - Exonic
1061575337 9:131502840-131502862 GGGCGCCGGTCCCGGAGGAGAGG - Intergenic
1062035131 9:134379593-134379615 CTGCGGCTGTCAGGGAGCACAGG - Intronic
1062277226 9:135736735-135736757 CCGCCGCGGGCCGGCAGCAGCGG - Intronic
1062325006 9:136008696-136008718 GGGCGGCGGCCCGGGCTCAGAGG - Exonic
1062349882 9:136133406-136133428 ACGCGGGGGTCCGGGAGCCGCGG - Intergenic
1062395300 9:136350378-136350400 TGGCGGGGGTCCCTGAGCAGAGG + Intronic
1062480616 9:136749185-136749207 CAGCCCCAGTCCGGGAGCAGAGG + Intergenic
1062502910 9:136858894-136858916 CAGCAGGGGTCCAGGAGCAGAGG + Intronic
1203471415 Un_GL000220v1:116740-116762 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1203479236 Un_GL000220v1:160712-160734 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1203361294 Un_KI270442v1:220745-220767 CGGCGGCGATGTGGGAGCCGCGG - Intergenic
1185693924 X:2179726-2179748 AGGCGGAGGTGCTGGAGCAGCGG - Intergenic
1187648330 X:21374174-21374196 TGGGGGCCGTCCGGGAACAGAGG - Intergenic
1189005131 X:36986452-36986474 CGGGGGCGGAGCGGGAGGAGTGG - Intergenic
1189043892 X:37571490-37571512 CGGGGGCGGAGCGGGAGGAGTGG + Intronic
1189726171 X:43969829-43969851 AGGGGGCGGGCTGGGAGCAGTGG + Intronic
1192657039 X:73003183-73003205 CGGCAGCGGCCCGGCGGCAGCGG + Intergenic
1192665081 X:73079818-73079840 CGGCAGCGGCCCGGCGGCAGCGG - Intergenic
1194268560 X:91782236-91782258 CGGCGGCGGGCCGCCAGCAGTGG - Intronic
1197415266 X:126165972-126165994 CGGCGGCGGCCCGGCGGCGGTGG + Intergenic
1200233555 X:154458017-154458039 AGGCGGCGGGCGGGGAGCCGGGG + Intergenic
1200292507 X:154886407-154886429 CGGCGCCGGCCCGGGACCCGAGG + Exonic
1200339351 X:155382147-155382169 CGGCGCCGGCCCGGGACCCGAGG + Exonic
1200347119 X:155458546-155458568 CGGCGCCGGCCCGGGACCCGAGG - Exonic
1200585761 Y:5003150-5003172 CGGCGGCGGGCCGCCAGCAGTGG - Intronic