ID: 946423979

View in Genome Browser
Species Human (GRCh38)
Location 2:219582349-219582371
Sequence CAGGGCAATCTGGAAGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946423968_946423979 25 Left 946423968 2:219582301-219582323 CCAATCATAATAAAATCTCCATA No data
Right 946423979 2:219582349-219582371 CAGGGCAATCTGGAAGCGGAAGG No data
946423967_946423979 26 Left 946423967 2:219582300-219582322 CCCAATCATAATAAAATCTCCAT No data
Right 946423979 2:219582349-219582371 CAGGGCAATCTGGAAGCGGAAGG No data
946423972_946423979 7 Left 946423972 2:219582319-219582341 CCATAAATTTGGTTGGCCGGTTG No data
Right 946423979 2:219582349-219582371 CAGGGCAATCTGGAAGCGGAAGG No data
946423975_946423979 -9 Left 946423975 2:219582335-219582357 CCGGTTGAATATGCCAGGGCAAT No data
Right 946423979 2:219582349-219582371 CAGGGCAATCTGGAAGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946423979 Original CRISPR CAGGGCAATCTGGAAGCGGA AGG Intergenic
No off target data available for this crispr