ID: 946426732

View in Genome Browser
Species Human (GRCh38)
Location 2:219602481-219602503
Sequence AGAGCAGAAGTCGCCGCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946426732_946426734 -7 Left 946426732 2:219602481-219602503 CCTGCGGCGGCGACTTCTGCTCT 0: 1
1: 0
2: 2
3: 3
4: 84
Right 946426734 2:219602497-219602519 CTGCTCTGCCCTCCCTTGGCTGG 0: 1
1: 0
2: 6
3: 60
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946426732 Original CRISPR AGAGCAGAAGTCGCCGCCGC AGG (reversed) Exonic
900245411 1:1634076-1634098 GTAGCAGAAGTCGCAGCTGCTGG - Exonic
900256642 1:1701235-1701257 GTAGCAGAAGTCGCAGCTGCTGG - Intronic
900987606 1:6082249-6082271 ACAGCAGAAGTCTACGCAGCCGG + Exonic
901242599 1:7704151-7704173 ATTGCAGACGCCGCCGCCGCAGG + Intronic
902169657 1:14599356-14599378 AGAGCAGCGGTGGCCACCGCCGG - Intronic
912363553 1:109114252-109114274 AGAGCAGCAGCCGCCACAGCCGG - Exonic
915974394 1:160375417-160375439 AGAGCAGAAGTCAAGGCCCCAGG + Intergenic
922937460 1:229433167-229433189 AGCGCAGAAGTCTCAGCGGCAGG + Intronic
924511279 1:244730771-244730793 AGAGCAGGAGCCGCCGTCGCCGG + Intergenic
1073325853 10:102643757-102643779 AGCGCAGAAGTAGCCGCCCGGGG + Intergenic
1073457281 10:103645291-103645313 AGAGCAGAAGTTGCGGGGGCCGG - Intronic
1076485002 10:130810233-130810255 AGAACAGAAGTCCCCGACTCAGG - Intergenic
1076554215 10:131311557-131311579 AGAGGAGAGGCTGCCGCCGCCGG + Exonic
1076821162 10:132940433-132940455 AGTGCTGGAGTCGCCTCCGCAGG + Intronic
1082005199 11:47415294-47415316 AGAGCAGAAGCAGCTGCTGCAGG - Exonic
1084236546 11:67791363-67791385 AGAGCAGAAGTCACAGAGGCTGG + Intergenic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1091086664 11:132727697-132727719 AGAGCAGAAGTGCCAGCCCCTGG - Intronic
1091490691 12:930015-930037 AGTGCAGAAGTCCCCACTGCTGG + Intronic
1098161165 12:67649085-67649107 AGGGCTGCCGTCGCCGCCGCCGG - Exonic
1098255489 12:68611257-68611279 GGAGCAGCCGCCGCCGCCGCGGG + Intronic
1114612523 14:24052104-24052126 AGAGGAGCCGCCGCCGCCGCCGG - Exonic
1117675662 14:58152361-58152383 CCAGCAGAAGCCGCCCCCGCGGG - Intronic
1125324077 15:38518189-38518211 AGAGCAGCAGTCACCGCTGGGGG + Intronic
1127790254 15:62392114-62392136 AGAGCAGAACACGCAGCCGCGGG - Intronic
1130390180 15:83447833-83447855 AGGGCAGAGGTGGCGGCCGCGGG + Intronic
1134667634 16:16030616-16030638 CAAGCAGAAGTGGCCGCTGCAGG - Intronic
1141881986 16:86866376-86866398 AGAGCAGATGTGGCTCCCGCAGG + Intergenic
1144501078 17:15786899-15786921 GGAGCAGACGTCGCCGCCGCGGG - Intergenic
1145163245 17:20589573-20589595 GGAGCAGACGTCGCCGCCGCGGG - Intergenic
1152049084 17:77958760-77958782 GGAGCCGTAGCCGCCGCCGCCGG + Intergenic
1152844941 17:82593887-82593909 AGAGCAGCAGCTGCCGCCACTGG + Intronic
1156036155 18:32770288-32770310 GCAGCAGCAGCCGCCGCCGCAGG - Exonic
1160865118 19:1252929-1252951 TGAGCAGAGCTCCCCGCCGCTGG + Intronic
1163602070 19:18255274-18255296 AAAGCAGAAGTGGCGGCAGCTGG + Exonic
1166424175 19:42661369-42661391 AAAGCAGAAGTCACCGCTCCTGG - Intronic
925328721 2:3042270-3042292 AGAGCAGCAGAGGCCGCGGCCGG - Intergenic
925349008 2:3188352-3188374 AGCGCAGAAGTGGCCCCTGCGGG + Intergenic
944451776 2:199851027-199851049 AGAGCGGCAGGCGCGGCCGCTGG - Exonic
946130276 2:217601299-217601321 AGAGGAGAAGTGGCAGCTGCTGG - Intronic
946426732 2:219602481-219602503 AGAGCAGAAGTCGCCGCCGCAGG - Exonic
1178278869 21:31263933-31263955 AGTGCAGAAGTAGCCCTCGCAGG + Intronic
1178672356 21:34603221-34603243 AGACCAGCGGTCGCCGCCGGGGG - Intronic
1184233319 22:43169956-43169978 AGAGCTCAAGACTCCGCCGCGGG + Intronic
954952451 3:54487465-54487487 AGAGCAGAAGTCTCCACTCCAGG - Intronic
961775038 3:129278718-129278740 AGGGGAGAAGACGCCGCCTCCGG + Intergenic
967848598 3:194064605-194064627 AGAGCAGAAGGAGCTGCAGCTGG - Intergenic
979789259 4:124757636-124757658 AGAGCAGAAGCAGCAGCAGCAGG - Intergenic
982109916 4:152044639-152044661 AGAGCACAAGTGGCCCCCCCAGG + Intergenic
985548857 5:523342-523364 AGAGCAGCAGGCGCCGCGGCAGG - Intronic
994191732 5:96876264-96876286 ACAGCAGAAGTGGCAGCCACTGG + Exonic
996405470 5:123098923-123098945 AGAGCAGGAGCCGCAGCCCCAGG - Intronic
1009808827 6:68635551-68635573 ATAGCAGCCGCCGCCGCCGCCGG + Exonic
1012110548 6:95225757-95225779 AGAGAAGAAGTCTCCTCCTCTGG - Intergenic
1014798313 6:125749645-125749667 GGAGCAGACCGCGCCGCCGCCGG + Exonic
1019940217 7:4283601-4283623 ACAGCAGCAGTGGCAGCCGCAGG - Intergenic
1022136943 7:27457839-27457861 GGAGCAGAGGTGGCCGCCGTGGG - Intergenic
1022651250 7:32277594-32277616 AGAGCTGAAGTCTCAGCTGCTGG - Intronic
1026661575 7:72307529-72307551 AGAGCAGAAGTCACAGCCTGTGG + Intronic
1026926199 7:74195610-74195632 GGAGCAGAGGTGGCCGCCGTGGG + Exonic
1033603587 7:142908601-142908623 AGAGCAGCAGTCACCGAGGCTGG - Exonic
1034543950 7:151777465-151777487 AGAGCAGGACTCACTGCCGCAGG - Intronic
1034872800 7:154698831-154698853 AGCTCAGAAGTCGCTGCCTCTGG - Intronic
1035649994 8:1257023-1257045 AGAGAAGACGTCGGGGCCGCAGG - Intergenic
1041044757 8:53879561-53879583 AGGGAAGAAGACGCCACCGCTGG + Exonic
1045676624 8:104614817-104614839 AGAGCAGGAGTCCCCACCCCTGG - Intronic
1049557692 8:143291271-143291293 TGAGCTGAAGGCGCCGCGGCTGG + Intronic
1055081901 9:72275728-72275750 AATGCAGAAGTCCCCGCCACTGG - Intergenic
1059433188 9:114261897-114261919 AGAGCAGTAGCAGCCACCGCAGG - Intronic
1189303047 X:39966738-39966760 ACAGCAGAGGTGGCGGCCGCAGG - Intergenic
1189473804 X:41334044-41334066 CGGGCAGAAGTCGCCGCGACAGG + Exonic
1196442359 X:115728429-115728451 AGAGAAGCAGGCTCCGCCGCGGG - Intergenic
1196443198 X:115732475-115732497 AGAGAAGCAGGCTCCGCCGCGGG + Intergenic
1196443856 X:115735443-115735465 AGAGAAGCAGGCTCCGCCGCGGG + Intergenic
1196445519 X:115844390-115844412 AGAGAAGCAGGCTCCGCCGCGGG + Intergenic
1196446190 X:115847371-115847393 AGAGAAGCAGGCTCCGCCGCGGG + Intergenic
1196446861 X:115850352-115850374 AGAGAAGCAGGCTCCGCCGCGGG + Intergenic
1196447529 X:115853335-115853357 AGAGAAGCAGGCTCCGCCGCGGG + Intergenic
1196448200 X:115856314-115856336 AGAGAAGCAGGCTCCGCCGCGGG + Intergenic
1196448869 X:115859305-115859327 AGAGAAGCAGGCTCCGCCGCGGG + Intergenic
1196449540 X:115862296-115862318 AGAGAAGCAGGCTCCGCCGCGGG + Intergenic
1196450209 X:115865279-115865301 AGAGAAGCAGGCTCCGCCGCGGG + Intergenic
1196450879 X:115868264-115868286 AGAGAAGCAGGCTCCGCCGCGGG + Intergenic
1196451550 X:115871243-115871265 AGAGAAGCAGGCTCCGCCGCGGG + Intergenic
1196452221 X:115874230-115874252 AGAGAAGCAGGCTCCGCCGCGGG + Intergenic
1196452891 X:115877199-115877221 AGAGAAGCAGGCTCCGCCGCGGG + Intergenic
1196453561 X:115880192-115880214 AGAGAAGCAGGCTCCGCCGCGGG + Intergenic
1196454230 X:115883201-115883223 AGAGAAGCAGGCTCCGCCGCGGG + Intergenic
1196455311 X:115888273-115888295 AGAGAAGCAGGCTCCGCCGCGGG + Intergenic
1200093813 X:153648004-153648026 GGAGCAGGAGCCGCGGCCGCGGG - Exonic