ID: 946428523

View in Genome Browser
Species Human (GRCh38)
Location 2:219612769-219612791
Sequence CCAAACTCCTTGGCAGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 217}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946428523_946428533 24 Left 946428523 2:219612769-219612791 CCTGTGTCTGCCAAGGAGTTTGG 0: 1
1: 0
2: 0
3: 19
4: 217
Right 946428533 2:219612816-219612838 GCCACTGAAGGATTTGAAATGGG 0: 1
1: 2
2: 16
3: 88
4: 446
946428523_946428528 -1 Left 946428523 2:219612769-219612791 CCTGTGTCTGCCAAGGAGTTTGG 0: 1
1: 0
2: 0
3: 19
4: 217
Right 946428528 2:219612791-219612813 GACTTGTTTCTGAGGGCCACTGG 0: 1
1: 0
2: 1
3: 16
4: 162
946428523_946428530 12 Left 946428523 2:219612769-219612791 CCTGTGTCTGCCAAGGAGTTTGG 0: 1
1: 0
2: 0
3: 19
4: 217
Right 946428530 2:219612804-219612826 GGGCCACTGGGAGCCACTGAAGG 0: 1
1: 1
2: 16
3: 108
4: 491
946428523_946428532 23 Left 946428523 2:219612769-219612791 CCTGTGTCTGCCAAGGAGTTTGG 0: 1
1: 0
2: 0
3: 19
4: 217
Right 946428532 2:219612815-219612837 AGCCACTGAAGGATTTGAAATGG 0: 1
1: 0
2: 7
3: 69
4: 414
946428523_946428535 25 Left 946428523 2:219612769-219612791 CCTGTGTCTGCCAAGGAGTTTGG 0: 1
1: 0
2: 0
3: 19
4: 217
Right 946428535 2:219612817-219612839 CCACTGAAGGATTTGAAATGGGG 0: 1
1: 1
2: 4
3: 57
4: 289
946428523_946428527 -8 Left 946428523 2:219612769-219612791 CCTGTGTCTGCCAAGGAGTTTGG 0: 1
1: 0
2: 0
3: 19
4: 217
Right 946428527 2:219612784-219612806 GAGTTTGGACTTGTTTCTGAGGG 0: 1
1: 1
2: 6
3: 103
4: 545
946428523_946428526 -9 Left 946428523 2:219612769-219612791 CCTGTGTCTGCCAAGGAGTTTGG 0: 1
1: 0
2: 0
3: 19
4: 217
Right 946428526 2:219612783-219612805 GGAGTTTGGACTTGTTTCTGAGG 0: 1
1: 1
2: 4
3: 69
4: 434
946428523_946428529 0 Left 946428523 2:219612769-219612791 CCTGTGTCTGCCAAGGAGTTTGG 0: 1
1: 0
2: 0
3: 19
4: 217
Right 946428529 2:219612792-219612814 ACTTGTTTCTGAGGGCCACTGGG 0: 1
1: 0
2: 0
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946428523 Original CRISPR CCAAACTCCTTGGCAGACAC AGG (reversed) Intronic
900414184 1:2527613-2527635 CCCACCCCCTTGGAAGACACAGG - Intergenic
905827637 1:41038180-41038202 ACAAACTCCTTGGAAGAAAGGGG - Intronic
906643489 1:47456276-47456298 CCAAACTACTTGGGAGACTGAGG + Intergenic
908560003 1:65296916-65296938 CCTAACTCCATGCCTGACACAGG - Intronic
909597497 1:77422747-77422769 CCAGGCTCCGTGGCAGGCACTGG - Intronic
914440154 1:147698479-147698501 CCCAACTACTTGGGAGACTCAGG - Intergenic
914676888 1:149912818-149912840 CCAAACTCCTTGGTATAAATGGG - Intronic
917401725 1:174656834-174656856 CAGAACTCCTTGGCAAAGACTGG - Intronic
917512325 1:175678736-175678758 CCAAAGGGCTTGGCAGAGACAGG + Intronic
917929781 1:179815278-179815300 CCAATCCCCATGGCAGACAGCGG + Exonic
918052608 1:180987430-180987452 GCAAACTCTTTGGCAGAGATGGG + Intronic
920770746 1:208882704-208882726 CCAACCTCCTTTGCAGACAAAGG - Intergenic
921483684 1:215691935-215691957 CCAAACTCAGTGGCAGATGCAGG + Intronic
922452847 1:225750722-225750744 CCTGGCTCCTTGGCAGACATTGG + Intergenic
922707785 1:227798712-227798734 CCAAACTCTCTGGAAGACTCTGG + Intergenic
923623364 1:235595210-235595232 CCACCCTCCACGGCAGACACGGG - Intronic
923879931 1:238092550-238092572 CCAGCCTCCTTTGCAGACAGGGG - Intergenic
1063399436 10:5728103-5728125 CCAATCTCCTTGGGAGGCTCAGG + Intronic
1066250782 10:33630789-33630811 CCAAACTCACTGGCAGCCAGAGG + Intergenic
1067032180 10:42885468-42885490 CCAAAGTCCTGGGCTGAGACAGG - Intergenic
1068044045 10:51862746-51862768 ACAAATTCCTAGGCAGACAGAGG - Intronic
1068188632 10:53619980-53620002 CCAAATGCCTAGGCAGACAGAGG - Intergenic
1068764748 10:60750665-60750687 CCCAACTACTTGGCAGACCGAGG + Intergenic
1069926792 10:71856065-71856087 CCAACCTCCCTTGCAGCCACGGG + Intergenic
1070420642 10:76233132-76233154 CCAAATGCCTAGGCAGACAGTGG - Intronic
1072341454 10:94455840-94455862 CCCAACTCCTTGGGAGACTGAGG + Intronic
1074114158 10:110443252-110443274 CCAAGCTCCTAGGCAGACTTTGG - Intergenic
1074117891 10:110471288-110471310 CCCAGCTACTTGGGAGACACAGG - Intergenic
1075264480 10:120989020-120989042 CCAAATGCCTAGGCAGACAGGGG + Intergenic
1076547054 10:131252474-131252496 CCAGACCCCTGGGCAAACACAGG + Intronic
1076547454 10:131254753-131254775 ACGAACTCCTGGGCAGACCCGGG + Intronic
1077067164 11:647041-647063 CCAAGCTACTTGGGAGACAGAGG + Intronic
1080752172 11:35160779-35160801 CCATACTAAATGGCAGACACTGG + Intronic
1081733145 11:45385304-45385326 CCAGGCCCCTTAGCAGACACAGG + Intergenic
1084509825 11:69596618-69596640 ACACTCTCCTTGCCAGACACAGG + Intergenic
1085055493 11:73401050-73401072 TCAAACTACTTGGAAGACACTGG + Intronic
1085803012 11:79608789-79608811 CCAAGCTCCGTGGCAGATACTGG - Intergenic
1086181311 11:83955430-83955452 CCAAACGCCTAGGCAGATAGGGG + Intronic
1086305139 11:85472005-85472027 ACAAATTCCTAGGCAGACAAGGG + Intronic
1087825122 11:102756368-102756390 CCTAACTACTTGGGAGACAGAGG - Intergenic
1088185537 11:107163821-107163843 CTAAAATCCTTGCCACACACTGG - Intergenic
1090253235 11:125265389-125265411 CAAACCTCCCTGGCAAACACCGG + Intronic
1092530519 12:9340577-9340599 CCAAACTCTATGGCTCACACTGG + Intergenic
1092609762 12:10159739-10159761 CAGAACTCCTTTGCAGAAACTGG - Exonic
1095377092 12:41542993-41543015 CCAAAGTCCTGGGCAGAAAAGGG - Intronic
1096415478 12:51408667-51408689 CCATACTCCTGGGCAGCCTCGGG - Intronic
1099368092 12:81795195-81795217 CCAAATGCCTAGGCAGACAGGGG + Intergenic
1099440746 12:82696768-82696790 TAAAACTCCTTGCCAGCCACAGG - Intronic
1099889121 12:88568408-88568430 CCAAACACTTTGGAAGACAGAGG - Intronic
1101512181 12:105403328-105403350 CCCCACCCCTTGGCAGACACAGG - Intergenic
1102198027 12:111038039-111038061 CCAAACTCCTTGGAAAAGTCCGG - Intronic
1103294199 12:119872267-119872289 CCAAATTGCTGGGTAGACACAGG - Intronic
1104395809 12:128431668-128431690 CCCAACTCCTCGGCAGGCAGAGG - Intronic
1105068456 12:133219305-133219327 CTCAGCTCCATGGCAGACACAGG + Exonic
1106464380 13:29999738-29999760 TCAAAGTCCTTGGCAGAGCCAGG + Intergenic
1106564016 13:30870269-30870291 CATAACTCCTTGGCCTACACGGG + Intergenic
1106903149 13:34376240-34376262 CCAAAGTCTTTGGCAGAGCCCGG - Intergenic
1108915458 13:55605602-55605624 ACAAATTCCTAGGCAGACAGGGG + Intergenic
1108942609 13:55976845-55976867 ACAAATTCCTAGGCAGACAAGGG + Intergenic
1109829674 13:67770342-67770364 ACAAATTCCTAGGCAGACAAAGG - Intergenic
1112327247 13:98450053-98450075 CCAAACTACTTGCTGGACACTGG + Intronic
1117513941 14:56481780-56481802 CCAAAATGCTTGGCTGGCACAGG + Intergenic
1118093803 14:62513732-62513754 CCCAACTTCTTGGCAGACTGAGG - Intergenic
1119334783 14:73823804-73823826 CCAAACATCTTGGCAGACAATGG - Intergenic
1124792000 15:32736574-32736596 CAGAGCTCCTTGGCAGAGACTGG + Exonic
1125096358 15:35856821-35856843 ACAAACTCCTTGCTAGACAAGGG + Intergenic
1127234631 15:57035810-57035832 CCAAACCCCTGGGCACAGACTGG + Intronic
1129356107 15:74993094-74993116 TCAAACTGCGTGGCAGGCACTGG - Intronic
1129433634 15:75520012-75520034 CCCAGCTCCTTGGGAGACAGAGG + Intronic
1130410111 15:83640006-83640028 CCAAAAGCCTTGGCAGTCTCTGG - Intergenic
1130769638 15:86911501-86911523 CCAATCTCCTTGACAGCCTCAGG + Intronic
1137147897 16:37161196-37161218 ACAAACTCGTTCCCAGACACTGG + Intergenic
1139819044 16:69705285-69705307 CCCAGCTACTTGGCAGACAGAGG + Intergenic
1140375490 16:74442438-74442460 CCAAGCTACTTGGGAGACTCAGG - Intergenic
1143323890 17:6086042-6086064 CCAGACCCTTTGGCAAACACTGG + Intronic
1144806398 17:17971270-17971292 CCAAACACTTTGACAGACAGGGG + Intronic
1145815784 17:27793904-27793926 CCAAACTCCGCGGCAGACGCCGG - Intronic
1146086912 17:29838388-29838410 GCAGACTCCTAGGCAGACAATGG + Intronic
1147621951 17:41873958-41873980 CCAAGCTCCTGGGCAGAGATGGG + Exonic
1148235830 17:45968396-45968418 CCAGCCTCCTGGGCAGACAGGGG - Intronic
1151369472 17:73638923-73638945 CCAAACTACTTGGGAGACTGAGG - Intronic
1153523116 18:5970170-5970192 CCAAAGTCCCTGGCTGCCACAGG - Intronic
1157658792 18:49420417-49420439 CCAAACACCTTGGGAGACCGAGG - Intronic
1158110786 18:53939433-53939455 CTAAACTATTTGGTAGACACTGG + Intergenic
1158488543 18:57889583-57889605 CCAAATGCCTTGGCAGATAGGGG - Intergenic
1158521425 18:58174456-58174478 CCAAACGCCTGGGCAGATAGGGG - Intronic
1160006242 18:75071111-75071133 CCAAACTTCACGGCAGACGCTGG + Intergenic
1161673597 19:5628689-5628711 CCAAACACTGTGGCTGACACTGG - Intronic
1162998254 19:14350071-14350093 CCCATCTCCCTGGGAGACACAGG + Intergenic
1163297937 19:16424428-16424450 CCAAACTCACTGGTAGGCACAGG - Intronic
1165389495 19:35530144-35530166 CCAAATTCCTGGGCAAACTCAGG + Intergenic
1167222310 19:48208374-48208396 CCAATCTCATAGGCACACACAGG + Exonic
1167226998 19:48251828-48251850 CCAGTCTCCTCTGCAGACACCGG + Intronic
1168649975 19:58086620-58086642 CCACCCTCCTTGCCAGATACAGG - Intronic
1168692035 19:58383096-58383118 CCTAACCACTTGGCAGGCACAGG + Intergenic
926219047 2:10923008-10923030 CCAAACTCCTTGGCATCCCTTGG + Intergenic
927047022 2:19289585-19289607 CCAAACTGATTAGCAGATACTGG + Intergenic
927062833 2:19440573-19440595 CCAAACAGCTTGGTAGAGACTGG - Intergenic
927303378 2:21541539-21541561 CCAAGCACCTTGGGAGACCCAGG - Intergenic
929094994 2:38254743-38254765 CCAAATGCCTAGGCAGACAAGGG - Intergenic
930655699 2:54005453-54005475 CCCAACTACTTGGGAGGCACAGG - Intronic
931414925 2:62072177-62072199 ACAAATTCCTAGGCAGACAGGGG + Intronic
932360709 2:71103441-71103463 CCAAATTCCTGGGCAGATAGGGG + Intergenic
933254968 2:80070599-80070621 CCAAACTACTTGGGAGGCTCAGG + Intronic
933661213 2:84928558-84928580 CCCAACTCTTTGGGAGACAAAGG + Intergenic
938102000 2:128503919-128503941 CCTATCCCCTTGGCAGACACTGG - Intergenic
939267311 2:139890934-139890956 ACAAATTCCTAGGCAGACAGGGG + Intergenic
940868215 2:158837854-158837876 CCACACTCCTTGCCAGCCATGGG + Intronic
940971739 2:159903801-159903823 CCACACCCCTTGGCAGCAACCGG - Intronic
943432217 2:187817666-187817688 ACAAATTCCTAGGCAGACAGGGG - Intergenic
945419330 2:209615651-209615673 CCAAATGCCTAGGCAGATACAGG + Intronic
945697192 2:213121876-213121898 ACAAACTCCCTGGCTGAAACAGG + Intronic
946014567 2:216593603-216593625 GCAGACACCATGGCAGACACTGG + Intergenic
946428523 2:219612769-219612791 CCAAACTCCTTGGCAGACACAGG - Intronic
946436665 2:219661176-219661198 CCAAGCTCTTTGCTAGACACTGG + Intergenic
948444382 2:238020816-238020838 CCAGGCTCCGTGTCAGACACTGG + Intronic
1170351141 20:15442615-15442637 CCAACCTCCTTTGCAGACATTGG - Intronic
1170801757 20:19596160-19596182 CCCAACTGCTTGGCAGAGAAAGG + Intronic
1171460737 20:25296590-25296612 CCAAACACTTTGCCAGCCACTGG + Exonic
1172594223 20:36138952-36138974 CAAAACTTCTTGGCAGTCAAAGG - Intronic
1173932000 20:46828451-46828473 GCACACTGCTTGGCAGTCACAGG - Intergenic
1174825879 20:53767808-53767830 GCAAACTCTGTGACAGACACCGG + Intergenic
1176123790 20:63466148-63466170 CCAAACTACCCGGCACACACAGG + Intronic
1176606381 21:8836534-8836556 CCCAGCTCCTTGGGAGACAGAGG + Intergenic
1178130141 21:29563144-29563166 ACAAATCCCTTGGCAGGCACAGG + Intronic
1178854569 21:36239693-36239715 CCAGGCACCGTGGCAGACACTGG - Intronic
1178985173 21:37297226-37297248 CAAAACTGCTTTGCAGAAACAGG + Intergenic
1179931175 21:44571974-44571996 GCAAACGCCTGGGCAGACGCAGG + Intronic
1183412243 22:37661691-37661713 CCCAACTACATGCCAGACACGGG - Intronic
1185256180 22:49833582-49833604 CCAAGAGCCATGGCAGACACTGG + Intergenic
949337719 3:2993983-2994005 GAAAATTACTTGGCAGACACTGG + Intronic
951072523 3:18348962-18348984 ACAAACTGCTTGGCAGCCCCAGG - Exonic
952460340 3:33518185-33518207 CAAAACTCCTTGGTAACCACTGG - Intronic
953147463 3:40291581-40291603 CCAAATTCCTAGGCAGACAGGGG - Intergenic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
959934674 3:112016822-112016844 CAAAGCTCCTTGGAAAACACAGG + Intergenic
960267496 3:115637230-115637252 GCAAACTACTTGGCAGAATCAGG - Intronic
962259437 3:133893837-133893859 CCAAAATCCCTTCCAGACACAGG + Intronic
963353130 3:144176687-144176709 ACAAATTCCTAGGCAGACAGAGG - Intergenic
966563747 3:181352482-181352504 CCAAACTCCTGGCCACAGACTGG - Intergenic
966621207 3:181966167-181966189 CCACACTCCTTGGCACACATGGG - Intergenic
967036162 3:185649642-185649664 CCACACTCCCTGGGACACACAGG + Intronic
967910391 3:194537870-194537892 CCAAAGCCCTTGCCAGTCACAGG + Intergenic
968689379 4:1982825-1982847 CAAAACTCCCAGGCAGGCACAGG + Exonic
968959188 4:3734387-3734409 CCAAAGACCTGGGCAGTCACAGG + Intergenic
969275939 4:6135851-6135873 CCTAACACCTTGGCAGAGGCTGG + Intronic
971221932 4:24716811-24716833 CCAAACTCCAGGGCAGCCTCTGG - Intergenic
971991242 4:33897861-33897883 CCAAGCTCTTTGGGAGACCCAGG + Intergenic
974196268 4:58579777-58579799 CCCAACTCCCTGACAGACCCTGG + Intergenic
974399942 4:61390840-61390862 CCTAACTCCCCGGCAGCCACTGG + Intronic
974554610 4:63428562-63428584 CCAAACCCCATGGCAGGCTCCGG + Intergenic
975354835 4:73389713-73389735 CCAAACTCCTTGACAGGCCCTGG + Intergenic
979724246 4:123941935-123941957 ACAAATTCCTAGGCAGACAAGGG + Intergenic
982362207 4:154531182-154531204 CCAAAGGCCTTGGGAGAGACAGG + Intergenic
983203108 4:164883627-164883649 CCAAGCACGTTGGCACACACCGG - Intronic
987916468 5:24221054-24221076 ACAAATTCCTAGGCAGACAGGGG - Intergenic
988439589 5:31217589-31217611 CCAGACACCATGCCAGACACTGG + Intronic
988955301 5:36310413-36310435 CCATCCTCCTTGCCAGTCACTGG + Intergenic
991008172 5:61852840-61852862 CCAAAATGCCTGGCAGCCACTGG - Intergenic
993311472 5:86338104-86338126 CCAAACTCTATGGCAGACAGAGG + Intergenic
993835687 5:92817703-92817725 GCAAATTCCTAGGCAGACAGGGG + Intergenic
995868163 5:116715079-116715101 TCAAACTCCTTGGCATACTATGG + Intergenic
995906976 5:117136324-117136346 CCAAACTGCTTTGCACACATGGG + Intergenic
996470350 5:123852935-123852957 CTAGACCCCTTGGCAGACAGTGG + Intergenic
999030313 5:148283357-148283379 ATAAACTCTTTGGCAGACCCAGG + Intronic
999180492 5:149666720-149666742 ACAAACTTCTTTGCTGACACAGG + Intergenic
1001461912 5:171923864-171923886 ACAAAATCCTAGGCAGACAGGGG + Intronic
1002857144 6:1048047-1048069 CCAAACTCCTGAGCAGAAAGCGG - Intergenic
1004528557 6:16431965-16431987 CAAAACTCCTGCGCAGAGACTGG - Intronic
1007519964 6:42444472-42444494 CCAAACTCCTTCCCAGGGACAGG + Intronic
1007593566 6:43037966-43037988 CCAAACCCCTGGGAGGACACGGG + Exonic
1007713734 6:43841299-43841321 ACAAACTCCTTGACAGACTCAGG - Intergenic
1008065725 6:47045873-47045895 CCAAACTGCTTGGGAGACTGAGG - Intergenic
1010611373 6:77957687-77957709 CCAAACTCCTTGGGAGGCTGAGG + Intergenic
1011310690 6:85976402-85976424 CCACACTCTTTGCCAGACTCTGG - Intergenic
1011521808 6:88215544-88215566 CTAAAGGCCTAGGCAGACACTGG + Intergenic
1012328838 6:97958739-97958761 ACAAATTCCTAGGCAGACAGGGG - Intergenic
1012898943 6:104984558-104984580 ACAAACTACTTGGGAGACTCAGG - Intronic
1013360840 6:109392603-109392625 CTAGACTCCTTTGCAGCCACGGG - Intronic
1014941285 6:127442233-127442255 CCAGACTACTTGGGATACACTGG + Exonic
1016250186 6:142031587-142031609 CCAAACTCCTTTCGAGACATAGG + Intergenic
1017204151 6:151786923-151786945 CCAAACTACTTGGGAGACTGAGG - Intronic
1017946419 6:159099789-159099811 CCTAACTGCTTGGCAGACTGAGG + Intergenic
1019931580 7:4226710-4226732 CAAAACTCCCTGGAAGGCACTGG + Intronic
1021068051 7:16201237-16201259 ACAAATTCCTAGGCAGACAGGGG + Intronic
1021111819 7:16704119-16704141 CCAATCTCCTTAAAAGACACTGG + Intronic
1022261835 7:28713166-28713188 CCCAGCTACTTGGGAGACACAGG - Intronic
1023160009 7:37288073-37288095 CCAAACTACTTGGGAGACTGAGG - Intronic
1026060638 7:67022583-67022605 ACAAACTGGTTGGGAGACACTGG + Intronic
1026795437 7:73363473-73363495 CGCGTCTCCTTGGCAGACACAGG - Intergenic
1026948659 7:74332861-74332883 CCAGACTCTGTGTCAGACACTGG - Intronic
1028907247 7:96168556-96168578 CCAATCTCCTTGGCACCCAGAGG + Intronic
1028998875 7:97131031-97131053 ACAAATTCCTAGGCAGACAAGGG - Intronic
1029661089 7:101962518-101962540 CCAGAACCCATGGCAGACACGGG - Intronic
1030646187 7:112064366-112064388 CAAAGGACCTTGGCAGACACAGG + Intronic
1032081526 7:128860885-128860907 ACAAACCCCATGCCAGACACCGG + Intergenic
1032487075 7:132296088-132296110 CCTAACACCTGGGCCGACACTGG - Intronic
1034026500 7:147709998-147710020 CCAAACTCCATGGCAGAGATAGG + Intronic
1034989346 7:155538359-155538381 CCAACCTCATTTTCAGACACTGG + Intergenic
1035258434 7:157646803-157646825 CCAAAGGCCATGGCAGCCACTGG + Intronic
1035259683 7:157653490-157653512 CCACCCTCCCTGGCACACACAGG - Intronic
1035454693 7:159000322-159000344 CCAAACCCCTCCGCAGACAGCGG + Intergenic
1035727742 8:1835070-1835092 CCCAGTGCCTTGGCAGACACGGG - Intronic
1037992219 8:23329093-23329115 CCAAAGTACTAGGCAGGCACTGG + Intronic
1040475554 8:47774197-47774219 CCAACATCCTTGGCAGAACCTGG - Exonic
1040581484 8:48702156-48702178 CCAGACTTCTTGGCAGAGGCTGG + Intergenic
1040786928 8:51177072-51177094 ACAAATTCCTAGGCAGACAGGGG - Intergenic
1042949489 8:74186179-74186201 TCAAAATCCTTGGCAGAGCCAGG - Intergenic
1044609103 8:94074488-94074510 GCAAACTCCATGGAAAACACTGG - Intergenic
1047584942 8:126260948-126260970 CCAAATGCCTTGGCAGAGACTGG - Intergenic
1048016817 8:130504937-130504959 CCAAACTCGTTGCCTGGCACAGG - Intergenic
1048976896 8:139678179-139678201 ACGAACTCCTTGGAAGGCACTGG + Intronic
1049300154 8:141865425-141865447 CCAAATTCCATGGCAGTCTCAGG + Intergenic
1049782082 8:144433753-144433775 CCAAACTCTGTGGAAGACACAGG + Exonic
1053042178 9:34884202-34884224 CCCAACTCCATGACAGACCCTGG - Intergenic
1055795505 9:79971051-79971073 CCTAACTCCTTAGCGGCCACGGG + Intergenic
1056196083 9:84230032-84230054 CCATTCTCCTTTCCAGACACTGG + Intergenic
1056253451 9:84774161-84774183 CCAGACTGCTGGGCAGTCACTGG + Intronic
1056662773 9:88556694-88556716 ACAAATTCCTAGGCAGACAGGGG - Intronic
1056883825 9:90420787-90420809 CCATACTCCTTGCCAGACTCTGG - Intergenic
1057917796 9:99071046-99071068 CCAATCTCCTTGAGAGACAGAGG - Intergenic
1059965661 9:119610979-119611001 CCAAGCTCCTTGCCAGAACCAGG - Intergenic
1203696167 Un_GL000214v1:99688-99710 CCCAGCTCCTTGGGAGACAGAGG - Intergenic
1203553773 Un_KI270743v1:188369-188391 CCCAGCTCCTTGGGAGACAGAGG + Intergenic
1203640106 Un_KI270751v1:4375-4397 CCCAGCTCCTTGGGAGACAGAGG + Intergenic
1188660263 X:32750580-32750602 CCAAACTCCTAGGCAGATAGGGG + Intronic
1188847185 X:35087653-35087675 ACAAACTGCTTGGCAGACCCTGG + Intergenic
1189186699 X:39061137-39061159 ACAAATTCCTAGGCAGACAGGGG - Intergenic
1190315514 X:49148041-49148063 CCACTCTCCTCGGCAGTCACTGG + Intergenic
1191043807 X:56114198-56114220 CCAGTCTCCTTGGCACCCACAGG + Intergenic
1193639166 X:83990520-83990542 CCTAACTCCTCGACAGACCCTGG - Intergenic
1194207330 X:91028059-91028081 CCTCACTCCTTGGCTGACAATGG - Intergenic
1196581575 X:117385534-117385556 CCATACTCCTAGACAAACACTGG + Intergenic
1196836737 X:119820573-119820595 CCAAACTCCTCGGGAGGCTCAGG - Intergenic
1200126904 X:153819492-153819514 CCCACCTCCGTGGCAGCCACGGG - Intronic
1200553072 Y:4602790-4602812 CCTCACTCCTTGGCTGACAATGG - Intergenic
1201340146 Y:12924985-12925007 CCATACTCCATGGCATAAACAGG - Intergenic