ID: 946430625

View in Genome Browser
Species Human (GRCh38)
Location 2:219625384-219625406
Sequence CTTGGTGTGCAGGATGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946430618_946430625 14 Left 946430618 2:219625347-219625369 CCTCAGAGGGACAAGTCCTGTGA 0: 1
1: 0
2: 0
3: 10
4: 128
Right 946430625 2:219625384-219625406 CTTGGTGTGCAGGATGTACATGG 0: 1
1: 0
2: 1
3: 19
4: 154
946430620_946430625 -2 Left 946430620 2:219625363-219625385 CCTGTGACACCCTTATGGCATCT 0: 1
1: 0
2: 0
3: 6
4: 90
Right 946430625 2:219625384-219625406 CTTGGTGTGCAGGATGTACATGG 0: 1
1: 0
2: 1
3: 19
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946430625 Original CRISPR CTTGGTGTGCAGGATGTACA TGG Intergenic
900898614 1:5501854-5501876 CTTCCTGAGCAGGCTGTACATGG + Intergenic
902138179 1:14328932-14328954 ATAGGTGTTCAGGATGTAAAAGG + Intergenic
906053178 1:42891691-42891713 CTTGGTGTGTGGGATCTGCATGG - Intergenic
906387194 1:45380238-45380260 CTTGGTGAGCAGGATGTTTTGGG - Intronic
907240255 1:53077324-53077346 CTTGAGGTGCAGCTTGTACAGGG - Exonic
911687528 1:100794092-100794114 CTGGGGGTGCTGAATGTACAGGG - Intergenic
912891471 1:113536965-113536987 CTTTGTGTGGAGAATGTACAGGG - Intronic
913373676 1:118128682-118128704 GTTGGGGTGCAGGAAGTTCAGGG - Intronic
915986346 1:160469217-160469239 CTTGGAATGCAGGTTGTGCAAGG + Intergenic
916209013 1:162343414-162343436 CTTGGTCTGCAGGAGCTCCAGGG + Intronic
918557629 1:185822298-185822320 CGGGGTGGGCAGGAGGTACATGG + Intronic
918878076 1:190075791-190075813 TTTTGTATGCAGAATGTACATGG - Intergenic
920087057 1:203425114-203425136 CTTAGTGGGAAGGATGGACAGGG + Intergenic
921006593 1:211099970-211099992 CTTAGTGAGCAGGAGGTAGAGGG - Intronic
922618706 1:226977995-226978017 GTGGGTGTGCAGGAGGTATAAGG - Intronic
922680889 1:227594659-227594681 CTTTATGTGCAAGATGTATAAGG - Intronic
923485816 1:234430079-234430101 CTTGGAGTGCAGCAGGTACAGGG - Exonic
924904825 1:248441352-248441374 CTGGCTGAGCAGGAAGTACATGG - Exonic
924923062 1:248650690-248650712 CTGGCTGAGCAGGAAGTACATGG + Exonic
1063223687 10:3994294-3994316 CTTGGTGTGGAGGAAATAAAGGG - Intergenic
1063280970 10:4628761-4628783 CTAAGTGTGCAGGATATGCAGGG - Intergenic
1064322945 10:14322535-14322557 ATGGGTGTGCATGATGTACTTGG + Intronic
1066070925 10:31811213-31811235 GTTGGTGTTCAGGAACTACATGG - Intronic
1067248865 10:44570595-44570617 CATGGTCTGCAGGCTGTACAAGG + Intergenic
1067294949 10:44970271-44970293 CTTGGTGTGCAGGTTGGGCGGGG + Intronic
1070381048 10:75880773-75880795 CTTGGCTTGCAGGAAGAACATGG - Intronic
1070424334 10:76270816-76270838 CTTTGTGGACAGGATGTGCACGG - Intronic
1074654886 10:115573417-115573439 CTTGGGGTTCAGGGTTTACATGG + Intronic
1076572885 10:131444121-131444143 CTTGGGTTGCGGGTTGTACAGGG - Intergenic
1079181415 11:18196998-18197020 CGTGGTCAGCAGGATGTGCAGGG - Intronic
1081572519 11:44300597-44300619 CTGGTGGTGCAGGATGTACGGGG + Intronic
1085699014 11:78729724-78729746 CTGGGTGTTCAGGAGGTAGAGGG + Intronic
1086739725 11:90352378-90352400 CTTGGTGTGCAGCCTGTGTATGG + Intergenic
1090828958 11:130407687-130407709 CTTACTCTGCAGGAAGTACATGG + Intronic
1092205995 12:6614341-6614363 CTTGGTCTGTGGGATGGACATGG + Intergenic
1095314456 12:40743099-40743121 CTTGTTGTGAAGGATGTCTAGGG + Intronic
1097152234 12:56987501-56987523 ACTGGTGGGCAGGATGTAGAGGG + Intergenic
1097288504 12:57895544-57895566 CTGGCTGTGCAGGATGCAGAGGG + Intergenic
1099067651 12:78003920-78003942 CTTGGTGAGCAGGATATAAATGG - Intronic
1099150431 12:79105282-79105304 CTTGGTATGATGCATGTACAGGG + Intronic
1100385558 12:94102033-94102055 CTGGGTGTCCAGGGTGTCCAGGG - Intergenic
1105427098 13:20303131-20303153 CTTGGTGAGCAGAAAGAACATGG - Intergenic
1106221922 13:27753482-27753504 CTGGGTGTCCAGGGTGTAGATGG - Intergenic
1106234114 13:27847054-27847076 TTTGGTGAGCACGATGTGCAGGG - Intergenic
1107928131 13:45283469-45283491 ATTGGTGTTCAGAATGTAAAAGG + Exonic
1109986506 13:69993375-69993397 CATGGAATGCAGGCTGTACAGGG - Intronic
1111047235 13:82829664-82829686 CTTGGTTTGCAGGCTTTACACGG + Intergenic
1111985319 13:95060188-95060210 CTTGGAGATCAGGATCTACATGG + Intronic
1114135733 14:19847539-19847561 GTTGCTGAGCAGGAAGTACATGG - Intergenic
1114162077 14:20179405-20179427 GTTGGCGAGCAGGATGTACATGG - Intergenic
1114163723 14:20197622-20197644 GTTGGCGAGCAGGATGTACATGG - Exonic
1118862475 14:69675239-69675261 CTTGGTGTGCAGGTGGAAGAGGG + Intronic
1119261520 14:73240753-73240775 CTGGGTCTTGAGGATGTACAAGG + Intronic
1119935291 14:78586709-78586731 CTTGGGGGACAGGGTGTACACGG - Intronic
1120780058 14:88479148-88479170 CTTGGGCTCCAGGATGTGCAGGG + Exonic
1121590591 14:95103990-95104012 CTTGATGTGCAGCATTTTCAGGG + Exonic
1121987072 14:98517395-98517417 CTTGGTATGCAGGACTTCCAAGG + Intergenic
1124649016 15:31461400-31461422 CTTGGAATGCAGACTGTACAGGG - Intergenic
1125256287 15:37767547-37767569 CTTGGTGTGTCCGATGTCCAAGG - Intergenic
1127144349 15:56009177-56009199 CTCGGAATGCAGGCTGTACATGG - Intergenic
1129361278 15:75026129-75026151 CTTGATGTGGAGGAGGTTCAGGG + Intronic
1129686970 15:77691869-77691891 GTTGGGTTGCAGGATGTACGAGG + Intronic
1134294079 16:12929759-12929781 CTACGTGTGCAGGATGTGCAGGG - Intronic
1137732131 16:50697014-50697036 CATGGTCTCCAGGATGCACAAGG + Intronic
1140214388 16:72995651-72995673 CATGGTGTGCAGCAAGAACACGG + Intronic
1142224493 16:88870983-88871005 CTGGGTCTGCAGGCTGTGCAGGG - Intergenic
1146530844 17:33606652-33606674 CTTGGTGTCCAGGATCTGCCAGG - Intronic
1146958509 17:36952122-36952144 ACTGGAGTGCAGGATGCACAAGG - Intronic
1151207333 17:72517609-72517631 CCTGGTGTTTAGGATGTATACGG - Intergenic
1152597493 17:81244961-81244983 TTTGGTGTCCAGGAAGCACAGGG - Intergenic
1153522922 18:5968972-5968994 CTTGAGGTGCAGGATGTCCTGGG + Intronic
1159748560 18:72271042-72271064 CTTGGTGAGCAGGAGGTATATGG - Intergenic
1160085022 18:75769030-75769052 CTGGTTGTGCAGGAAGCACAGGG + Intergenic
1160815363 19:1033130-1033152 CTTGGTGAACAGGAAGGACATGG + Intronic
1162162786 19:8731201-8731223 CTGGCTGAGCAGGAAGTACATGG - Exonic
1162203417 19:9037817-9037839 CTTGGTGAGCATGATCTAAAAGG - Intergenic
1163382201 19:16976547-16976569 CTTGGTGGGCAGGGGGTGCATGG - Intronic
928419539 2:31127315-31127337 CTTAGTTTGTAGGATGTACTAGG - Intronic
930643622 2:53880012-53880034 CTTGGTGTGGAGGAAGAATATGG + Intronic
931537664 2:63297258-63297280 CTTGGAATGCAGGCTGTACCGGG - Intronic
931875431 2:66506870-66506892 CTGGGTGTGCCTGATGTCCAGGG - Intronic
934928244 2:98397077-98397099 CCTGGTCTGCAGGGTGTCCAGGG - Exonic
935092745 2:99912004-99912026 CTTGGTGAGCTGGCTGTAGATGG - Intronic
938842079 2:135173705-135173727 ATTGGTGGGCAGGATGTGGAAGG + Intronic
939306775 2:140421902-140421924 CTTCGTCTGCAGGATGGAAAGGG - Intronic
939339811 2:140880286-140880308 CAGGGTGTGCAGAATCTACAAGG - Intronic
943663726 2:190587015-190587037 CATTGTGTGTACGATGTACATGG - Intergenic
943999468 2:194814120-194814142 CTTGCTGTACAGGATTTAAATGG + Intergenic
944226529 2:197354421-197354443 CTTGGAATGCAGGTTGTATAGGG + Intergenic
946430625 2:219625384-219625406 CTTGGTGTGCAGGATGTACATGG + Intergenic
946863189 2:224019537-224019559 CATGGTGAACAGGATGAACAAGG - Intronic
948942811 2:241204508-241204530 TGTGGTGGGCAGGATGTAGAGGG + Intronic
1170109953 20:12794468-12794490 CTTGGAATGCAGGCTGTACAAGG - Intergenic
1171143953 20:22765770-22765792 CTTGGGGTGCTGGCTGTCCAGGG + Intergenic
1172609056 20:36235962-36235984 CTTGGCCTGCAGGAAGGACACGG + Intergenic
1172843570 20:37916208-37916230 CTAGCTTTGCAGGATGTACTGGG + Intronic
1173824288 20:46037351-46037373 GATGGTGCCCAGGATGTACATGG - Exonic
1176411146 21:6450258-6450280 CTTTGTGTGCAGGCTGTCCTGGG - Intergenic
1177379060 21:20314459-20314481 CTTGGAATGCAGGCTGTACAGGG + Intergenic
1178413304 21:32383434-32383456 CTTGGTCACCAGGGTGTACAGGG + Exonic
1178437580 21:32573502-32573524 CTTGCTGTGGAGGATGCCCATGG - Intergenic
1179646097 21:42777263-42777285 CTGGGTGTGCAGGCTGACCAGGG - Intergenic
1179686639 21:43058580-43058602 CTTTGTGTGCAGGCTGTCCTGGG - Intronic
1182893208 22:33836465-33836487 CTTGGTGTGCAGGAAGCAAATGG - Intronic
1183946129 22:41326801-41326823 CTCTGTGTGCAGAGTGTACAAGG - Intronic
1184568198 22:45306046-45306068 CTTGGAATGCAGGCCGTACAGGG + Intergenic
1184903739 22:47464718-47464740 CCTGGTGTGCAGGAAGAGCAGGG + Intronic
951079723 3:18438807-18438829 CCAGGTGTGCAGGAAGTAGAGGG - Intronic
951452796 3:22858372-22858394 TTTGATGTGCAGGTTGTAGATGG - Intergenic
953272322 3:41457706-41457728 CTTTGTGTGCATCTTGTACAGGG + Intronic
955199498 3:56837633-56837655 CTTGGAGTGGAGGGTTTACAAGG - Intronic
956231221 3:67018776-67018798 CTTGGTGTTCAGAATGAAGACGG + Intergenic
961811598 3:129525053-129525075 CCTGGTGTGTAGGATGGTCAGGG + Intergenic
962196353 3:133367084-133367106 CATGGAATGCAGGCTGTACAGGG - Intronic
962224836 3:133597231-133597253 CTTGGAATGCAGGCTGTATAGGG - Intergenic
962264679 3:133936390-133936412 CTTGGTGTGGTGGAAGTACATGG - Intronic
962381441 3:134901478-134901500 CTCAGTTTGCAGGATGTCCAGGG - Intronic
964007195 3:151845962-151845984 CTTATTGTGCAGGATGTTTAGGG - Intergenic
969217010 4:5730909-5730931 CGTGGTGTGCATGGTGTGCATGG + Intronic
973624411 4:52757047-52757069 CTTGGAGTGCAAGTTGTACAAGG + Intergenic
976599652 4:86926517-86926539 CCTGGAATGCAGGCTGTACAGGG - Intronic
979776649 4:124596999-124597021 CATGGTGTGTTTGATGTACAGGG + Intergenic
981104887 4:140869472-140869494 CTTAGTGTGCAGTAGGGACACGG - Intronic
985467539 5:12060-12082 CTCGGTGTACAGGATTCACAGGG + Intergenic
987751188 5:22039785-22039807 CTTGGTGTGCTGGTTGGAAAGGG - Intronic
995841664 5:116447985-116448007 CCTCGTGTGCAGTATGTAAATGG + Intronic
995859323 5:116625015-116625037 CTTGGTGGGGAGGGTGTTCATGG + Intergenic
999679620 5:154044486-154044508 CTCTGTGTTCAGGATGTACATGG + Intronic
1001485613 5:172117548-172117570 CTTGCTGTGCAGGAAGTTGAGGG + Exonic
1002369234 5:178737607-178737629 CTTGCTGTGCAGGAGGTTTAAGG - Intergenic
1003784253 6:9466447-9466469 CTTGGTGTCCTGGATTTATAAGG + Intergenic
1004953163 6:20697584-20697606 TTTGGTGGACAGGATGTATATGG - Intronic
1006277393 6:33016141-33016163 ATTGGTGTTCAGGATGGTCATGG - Intergenic
1006990454 6:38210921-38210943 CTTGGTGTTCAGGAGGGACTGGG - Intronic
1007336347 6:41157646-41157668 ATGGGTGTGCAGGAGGGACAGGG - Intergenic
1007947896 6:45842103-45842125 ATTGGTGTGGAGGAAGGACATGG - Intergenic
1014856378 6:126406956-126406978 GTACATGTGCAGGATGTACAGGG + Intergenic
1017595761 6:156027113-156027135 TTTGGAGTGCAGGTTCTACAGGG + Intergenic
1018682008 6:166272118-166272140 CTTGGAGCGCAGGCTGTACCAGG - Intergenic
1018994300 6:168699467-168699489 CTGGGGGTGCAAGATGTGCAAGG + Intergenic
1023104031 7:36746437-36746459 CTTCCTGTGCATGATGTGCAGGG - Intergenic
1023850067 7:44145496-44145518 CCTGGGGTGCAGCTTGTACACGG + Exonic
1024598546 7:50960537-50960559 CATAGTGTGCAGGATACACAGGG + Intergenic
1026302190 7:69107634-69107656 GTTGGGGTGCAGGATGTTTATGG - Intergenic
1027387146 7:77670102-77670124 CTTGGTATGCAAGATGTTCAAGG - Intergenic
1027461557 7:78460674-78460696 CTTGGAACGCAGGATGTGCAAGG + Intronic
1028686329 7:93592320-93592342 CTTGGTGAGCAGGAGGAAGATGG - Intronic
1028692370 7:93667894-93667916 CTTGGTGTGCTGTGTGTACTTGG + Intronic
1029546447 7:101212781-101212803 CGTGCTGAGCAGGAGGTACAAGG - Intronic
1030176564 7:106660609-106660631 CTTGCTGCGCAGGATGTGCGGGG + Exonic
1031094361 7:117401742-117401764 CTTGGAATGCAGGCTGTACAGGG - Intronic
1031203365 7:118720826-118720848 ATGGGTGTGAAGGGTGTACATGG - Intergenic
1035724820 8:1817876-1817898 CATGGGGTGCAGGGGGTACATGG - Intergenic
1037709419 8:21343748-21343770 CTTGGGGTGGAGGATGGGCATGG - Intergenic
1040580283 8:48693407-48693429 CTCGGTGTGCAGGAAGTGTAGGG + Intergenic
1040821152 8:51559106-51559128 ATTGGTGTGCAGGACCTAAAAGG + Intronic
1046288726 8:112131061-112131083 ATAGGTGTGCAGGAAGTGCAAGG - Intergenic
1047559715 8:125973379-125973401 TTTTGTGTGCATCATGTACATGG - Intergenic
1048982624 8:139711106-139711128 CTTGGTCTGCGGGATGAACGTGG + Intergenic
1049760106 8:144328272-144328294 CTTGGTGTGCATATTGCACAGGG + Intergenic
1050333786 9:4571335-4571357 CATGTGGTGCAGGATGTACAGGG - Intronic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1057185246 9:93053820-93053842 CTTGGTGTGCAGGATGAGCATGG + Intergenic
1057518635 9:95742388-95742410 CTTTGTGTGCCAGATGTAAAAGG + Intergenic
1060019720 9:120118544-120118566 CATGTTCTGCAGGCTGTACAGGG - Intergenic
1061027026 9:128056390-128056412 CTGGGTCTGCAGTATGTGCAAGG - Intergenic
1062120943 9:134833774-134833796 CTGGGTGCCCAGGATGTACAAGG - Intronic
1062245044 9:135561854-135561876 CTTGGTCTGGGGGATGTCCATGG - Exonic
1187400045 X:18951213-18951235 CTTGGCGTGCAGGCTGTCCTTGG + Exonic
1187800638 X:23058901-23058923 CTTGGTGTGCTAGATGTTGATGG - Intergenic
1190919777 X:54840707-54840729 CTTGGAGTGCATGAGGTCCAAGG + Intergenic
1191131831 X:57022127-57022149 GTACGTGTGCAGGATGTGCAAGG + Intergenic
1195004196 X:100670482-100670504 ATTGCTGTGCAGGCTGCACAGGG - Intronic
1195412932 X:104588309-104588331 CTTTCTGAGCAGCATGTACAAGG + Intronic
1200044063 X:153391334-153391356 CGTGGTGTGCATGGTGTGCATGG - Intergenic