ID: 946431656

View in Genome Browser
Species Human (GRCh38)
Location 2:219629689-219629711
Sequence AGGCTGCAGCCAGTACCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 291}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946431656_946431661 10 Left 946431656 2:219629689-219629711 CCAGCAGGTACTGGCTGCAGCCT 0: 1
1: 0
2: 2
3: 25
4: 291
Right 946431661 2:219629722-219629744 GGGCCCAGCCCAGAGCCACAGGG 0: 1
1: 3
2: 5
3: 73
4: 573
946431656_946431658 -10 Left 946431656 2:219629689-219629711 CCAGCAGGTACTGGCTGCAGCCT 0: 1
1: 0
2: 2
3: 25
4: 291
Right 946431658 2:219629702-219629724 GCTGCAGCCTCTACTCAGCAGGG 0: 1
1: 0
2: 1
3: 29
4: 266
946431656_946431660 9 Left 946431656 2:219629689-219629711 CCAGCAGGTACTGGCTGCAGCCT 0: 1
1: 0
2: 2
3: 25
4: 291
Right 946431660 2:219629721-219629743 AGGGCCCAGCCCAGAGCCACAGG 0: 1
1: 1
2: 7
3: 95
4: 537
946431656_946431666 24 Left 946431656 2:219629689-219629711 CCAGCAGGTACTGGCTGCAGCCT 0: 1
1: 0
2: 2
3: 25
4: 291
Right 946431666 2:219629736-219629758 GCCACAGGGTCCAGAGCTCCTGG 0: 1
1: 0
2: 5
3: 40
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946431656 Original CRISPR AGGCTGCAGCCAGTACCTGC TGG (reversed) Exonic
900164484 1:1239341-1239363 GGGCTGCAGCCAGGACAGGCAGG - Intergenic
900564008 1:3323568-3323590 CAGCTGCCGCCAGTGCCTGCTGG + Intronic
901803659 1:11724291-11724313 AGGTGGCAACCAGTAGCTGCTGG + Exonic
901804740 1:11731163-11731185 TCGCTGCAGCCTGCACCTGCCGG - Intergenic
902173606 1:14632749-14632771 GGGCTGCAGAGGGTACCTGCGGG - Intronic
902255861 1:15188233-15188255 AGGATGCAGCCTGCAGCTGCTGG - Intronic
902392735 1:16115774-16115796 AGGCTGCAAGCAGAACCTGTGGG - Intergenic
902556259 1:17248664-17248686 AGGCTGCACCCCTAACCTGCTGG + Intergenic
902562721 1:17287805-17287827 AGGAAGCATTCAGTACCTGCTGG - Intergenic
902736842 1:18406977-18406999 AGGCAGCAGCTAGCACCTTCTGG + Intergenic
904609141 1:31715507-31715529 AGGCTGCAGGACGTAGCTGCGGG + Intergenic
905925235 1:41745035-41745057 AAGCTCCAGCCAGAACCTGGGGG + Intronic
905942496 1:41875126-41875148 AGGCAGCAGCCAGGACCTTCGGG - Intronic
906693784 1:47810713-47810735 AGGCAGCAGGGAGTAGCTGCAGG + Intronic
906696913 1:47829273-47829295 AGTCTCCAGCCAGTTCCTGGAGG + Intronic
907000188 1:50845231-50845253 AAGTTGCAGCCAGAAACTGCAGG - Intronic
907017643 1:51032817-51032839 AGGCTGAAGCTAGTACCTTTGGG - Intergenic
907050611 1:51327501-51327523 AAGCTGCAGCTATTACTTGCTGG + Intronic
907427816 1:54391931-54391953 AGTTTGCAGCCTGTCCCTGCTGG - Intronic
907895750 1:58689260-58689282 AGGCTACAGCCTCTACCTGGGGG + Intronic
912499874 1:110114683-110114705 TGGCTGCAGCCAGTGCGTGCTGG - Intergenic
914218521 1:145656213-145656235 AGGTTGCAGCCAGCAGCAGCAGG - Intronic
914471080 1:147978904-147978926 AGGTTGCAGCCAGCAGCAGCAGG - Intronic
915079938 1:153345221-153345243 AGTCTGCAGCCAGAGACTGCGGG - Exonic
915440433 1:155942296-155942318 GGCCCCCAGCCAGTACCTGCTGG - Exonic
915546815 1:156603969-156603991 AGGCTGCAGCCTGTCCCTGGGGG + Intergenic
916741942 1:167653908-167653930 AGGCTGCAGGAAGTCCCTGGTGG + Intronic
917120829 1:171643255-171643277 AGGCAGCACCAAGTCCCTGCCGG - Intronic
921217579 1:212950783-212950805 CGCCTGCAGCCAGTCCCTCCCGG + Intronic
921905909 1:220495399-220495421 ACCCTGCAGTCAGTACCTGAGGG - Intergenic
922211738 1:223491638-223491660 CGTCTGGAGCCAGTTCCTGCTGG + Intergenic
922912789 1:229231644-229231666 AGGCTGCAGGCATTGCCTCCCGG + Intergenic
923338013 1:232986508-232986530 AGGCAGGAGCCAGTCCGTGCAGG - Exonic
924418315 1:243882914-243882936 AGGCTGCAGCCTCGACCTCCTGG + Intergenic
1063214037 10:3907766-3907788 AGGCTGCAGCCAGCAGCAGCTGG - Intergenic
1063437703 10:6048081-6048103 AGGATGCAGCCAGCACATGAGGG - Intronic
1064766235 10:18675623-18675645 AGTCTGCAGGCAGTACCTGATGG - Exonic
1067233424 10:44427384-44427406 TGGCTGGAGCCATTTCCTGCAGG + Intergenic
1067319200 10:45201467-45201489 TTGCTTCAGCCAATACCTGCTGG + Intergenic
1067529547 10:47060278-47060300 AGTCTGAAGCCAGTACCTAAAGG - Intergenic
1068830065 10:61483739-61483761 AGGCAGGAGCCAGTCCCTGCAGG + Intergenic
1069820694 10:71225861-71225883 ACCCTGCAGACACTACCTGCTGG + Intronic
1070398249 10:76031626-76031648 AGGCAGCAGCCAGCCCTTGCAGG + Intronic
1070776212 10:79111321-79111343 AGGCTGGAGCCAGTCCTTGAAGG + Intronic
1071467177 10:85951751-85951773 AGCCTTTAGCCAGCACCTGCGGG - Intronic
1071853843 10:89603298-89603320 ATGCTACAGCCAGCACCTACTGG - Intronic
1072036278 10:91565759-91565781 AGGCTGCAGCCCTCCCCTGCTGG - Intergenic
1073143092 10:101261792-101261814 AGCCAGCAGCCAGCACCTGCAGG + Intergenic
1073706621 10:105990543-105990565 CGACTGCAACCAGTACTTGCTGG + Intergenic
1074761597 10:116670576-116670598 AGGGAGCAGCCAGCACATGCTGG - Intergenic
1076191451 10:128486240-128486262 AGACTGGGGCCAGTATCTGCAGG - Intergenic
1076861668 10:133140830-133140852 AGGCTGCTCCCAGTACATCCAGG - Intergenic
1077015555 11:397596-397618 AGGCCGCTCCCAGCACCTGCAGG - Exonic
1077444637 11:2585274-2585296 AGGCTGCCGCCGGGATCTGCCGG - Exonic
1079030693 11:16984003-16984025 AGGCTGCAGCCTCGACCTCCTGG - Intronic
1082844197 11:57714024-57714046 AAGCTGCTTCCAGTATCTGCTGG + Intronic
1083516431 11:63263256-63263278 AGGTTGCAGCCAGTGGCAGCAGG - Intronic
1083682721 11:64358838-64358860 CGGCTGCAGCCAGTGGCTGGAGG - Intergenic
1083712036 11:64555457-64555479 AGGCCTCAGCCACTCCCTGCTGG - Intergenic
1083888491 11:65584258-65584280 CAGCTCCAGCCAGTCCCTGCTGG + Exonic
1084325953 11:68400134-68400156 AGGCTACAGCCAGCCCCAGCCGG + Intronic
1085400789 11:76234380-76234402 AGGCTCCAGCCAGCTCCTGAAGG + Intergenic
1087276102 11:96161916-96161938 AGGTTGGTGCCAGTACCTGTGGG + Intronic
1087705027 11:101480363-101480385 AGACTGCAGTCACTACCTACCGG + Intronic
1087778176 11:102275698-102275720 TGGCTACTGCCAGTACTTGCTGG + Intergenic
1088893456 11:114061226-114061248 ACGCTGCAGCCAGCGCCAGCCGG + Intronic
1089311021 11:117558209-117558231 AAGCTGCTGCCAGCACCTACAGG + Intronic
1090226891 11:125077082-125077104 CCCCTGCAGCCAGTTCCTGCAGG + Intronic
1090801922 11:130178518-130178540 AGGGAGCAGCCAGCTCCTGCAGG - Intronic
1090807847 11:130213462-130213484 AGTCTGTAGCCAGGACCTGCTGG + Intergenic
1091491792 12:938834-938856 AGACTGCAGCCACAACCTCCTGG + Intronic
1095444992 12:42274041-42274063 GGGCTGCACCCAGTGCTTGCGGG - Intronic
1096630955 12:52926416-52926438 GAGCTGGAGCCAGGACCTGCAGG - Exonic
1097180212 12:57167569-57167591 AGGCTACAGCCAGGCCCTCCAGG + Intronic
1098356612 12:69618281-69618303 AGGCAGCAGCCAGCACCAGTGGG - Intergenic
1099191363 12:79564990-79565012 GGGCTGCAGGCAGTGCTTGCGGG + Intergenic
1102208041 12:111104179-111104201 ATGGTGCAGCCAGGACATGCTGG - Intronic
1102890946 12:116558209-116558231 AGGCTGCAGCCTGGACCTCTTGG + Intergenic
1103746375 12:123127291-123127313 AGGCAGCTGCCAGCACCTCCTGG - Intronic
1104015645 12:124960004-124960026 AGGCTGCAGCCAGGAAGAGCCGG + Intronic
1104347011 12:128009349-128009371 AGGCTGCACCCAGTAACGGTAGG - Intergenic
1104645797 12:130496528-130496550 AGGCTCCATCCACTTCCTGCAGG + Intronic
1104740459 12:131168406-131168428 AAGCTGCAGCCCTTACCTGCAGG + Intergenic
1104959996 12:132484130-132484152 AGGCAGCACCCCGTACCCGCTGG - Intergenic
1104960035 12:132484254-132484276 AGGCAGCACCCCGTACCCGCTGG - Intergenic
1104960053 12:132484316-132484338 AGGCAGCACCCCGTACCCGCTGG - Intergenic
1105241304 13:18611174-18611196 AGGCCACAGCCAGTCCCTCCTGG - Intergenic
1105504880 13:21001369-21001391 GGGCTGCAGCCCGTACATACAGG - Intronic
1106241276 13:27915692-27915714 AGGCTGCAGCAGGAACCTGGAGG + Intergenic
1108590025 13:51905183-51905205 AGGCTGAAGGCAGTTCGTGCAGG + Intergenic
1113626367 13:111850835-111850857 GGGATGCAGCCAGTCACTGCAGG + Intergenic
1113721698 13:112562375-112562397 AGGCTGGAGACAGCAGCTGCAGG + Intronic
1113836484 13:113331393-113331415 ATGCTGCAGCCCGTGCCTCCTGG - Intronic
1114600646 14:23953493-23953515 AGGCAGCAGCCAAAGCCTGCGGG + Intergenic
1117965478 14:61203128-61203150 AGGCAGCAGTCAGTAACTGAAGG - Intronic
1118797357 14:69154931-69154953 TGCCTGGAGCCAGTACTTGCTGG + Intergenic
1119631682 14:76237548-76237570 ATGCTGTAGGCAGTGCCTGCGGG - Intronic
1119700789 14:76753120-76753142 AGGCAGCAGCCAGCTCCAGCTGG - Intergenic
1122864445 14:104597191-104597213 AGGCTGCAGCCAGAAACAGGAGG + Intronic
1122885417 14:104708359-104708381 AGGCTCCAGCCCCTGCCTGCTGG + Intronic
1123006536 14:105326522-105326544 AGGCTTCAGGCAGTGCCCGCCGG + Intronic
1123042929 14:105497821-105497843 AGGCTGCAGCAGGCACCTCCGGG - Exonic
1123490053 15:20773973-20773995 AGGCCACAGCCAGTCCCTCCTGG + Intergenic
1123546554 15:21343060-21343082 AGGCCACAGCCAGTCCCTCCTGG + Intergenic
1125650001 15:41308771-41308793 TGACTGCAGCCTCTACCTGCTGG + Intergenic
1125744617 15:41989915-41989937 AAGCTGCAGACAGTGCCTGCCGG + Intronic
1126778899 15:52121249-52121271 CAGGTGCAGCCAGAACCTGCCGG + Exonic
1132032014 15:98446108-98446130 AGTCTGCAGGCAGTTCCTGCTGG - Intronic
1132327811 15:100986370-100986392 AGGCTGTAGAGAGTACCTGTAGG + Intronic
1202954884 15_KI270727v1_random:70275-70297 AGGCCACAGCCAGTCCCTCCTGG + Intergenic
1135150435 16:20000604-20000626 AAGCTGCAGCCAGCATCAGCAGG + Intergenic
1136402561 16:30026535-30026557 AGGCTCCTGCCAGCACCAGCAGG + Intronic
1139356661 16:66370981-66371003 AGGCTGTTGGCAGAACCTGCAGG + Intronic
1139772688 16:69291862-69291884 GTGCTGCAGCCTGGACCTGCAGG - Intronic
1140318545 16:73923821-73923843 AGGCTCCAGGCAGTATGTGCTGG + Intergenic
1141461175 16:84179627-84179649 CGGCTGCAGCCAGTGGCTGAAGG - Exonic
1141594002 16:85086547-85086569 TGGGTGCCGCCAGCACCTGCGGG + Intronic
1141821029 16:86445885-86445907 ATGCTGCAGCCACTATGTGCAGG - Intergenic
1141863927 16:86736721-86736743 AGGCTGCAGCCAGTAATTATGGG - Intergenic
1142299619 16:89248685-89248707 AGGCTGCGGCCGGCACCTCCCGG - Intergenic
1142471606 17:166198-166220 GGGCTTCAGGCAGTGCCTGCTGG - Intronic
1144777755 17:17793336-17793358 CAGCCGCAGCCACTACCTGCAGG + Exonic
1147544527 17:41390474-41390496 AGGCTGCTGTCAGCATCTGCAGG - Intronic
1147925467 17:43942900-43942922 AGGCTACAGCCAGAGCCTCCAGG + Intergenic
1150130940 17:62668650-62668672 AGGTTGCAGCCAGTCTCTGCAGG + Intronic
1150226869 17:63529178-63529200 GGGCTGCAGCCAGACCCTGGAGG + Intronic
1151402381 17:73864298-73864320 AGGCTGGAGGCAGGAGCTGCTGG - Intergenic
1152006413 17:77684634-77684656 AGGCACCAGTCAGGACCTGCTGG - Intergenic
1152558586 17:81066842-81066864 AGGCTGCGGCCTCCACCTGCAGG - Intronic
1152595803 17:81237030-81237052 GGGCAGCAGCCAGTGCCTGCTGG - Exonic
1153046828 18:863591-863613 AGGCATCATCCAGTAACTGCTGG + Intergenic
1153331391 18:3879111-3879133 ACGCTCCTGCCAGTACCTGCAGG - Exonic
1153693485 18:7616709-7616731 AAGCTGCAGCCAGTTTGTGCTGG + Intronic
1154447654 18:14448727-14448749 AGGCCACAGCCAGTCCCTCCTGG + Intergenic
1155107143 18:22678586-22678608 AGGCTGCATCTAGGATCTGCAGG + Intergenic
1156072693 18:33231916-33231938 AGGCAGCAGCCAGTGCCTGGAGG - Intronic
1156478289 18:37420238-37420260 ACCCTGCAGCCAGAACCTGGGGG + Intronic
1157547107 18:48554378-48554400 AGCCTGGAGCCAGTTCCTGAGGG - Intronic
1158500992 18:58001711-58001733 TGGCTGCAGCCAGGAACTCCTGG + Intergenic
1158947991 18:62464340-62464362 AGGCAGGAGCCAGAACATGCAGG + Intergenic
1160805147 19:989396-989418 CGGCTGCACTCAGGACCTGCAGG - Intronic
1160907256 19:1457184-1457206 GGCCTGCAGCCAGTCCCAGCAGG - Exonic
1161301076 19:3543553-3543575 AGCCTACACCCAGCACCTGCGGG + Exonic
1162453603 19:10769278-10769300 AGCGTGCTGCCAGTACATGCTGG + Intronic
1163130068 19:15266814-15266836 AAGATGTAGCCAGTAGCTGCTGG + Intronic
1163430195 19:17262788-17262810 AGGCTGCAGCCGCTGCCTCCAGG + Exonic
1164720224 19:30426526-30426548 AGGCTGCAGCCAGTGCACTCAGG - Intronic
1164752416 19:30666460-30666482 TGAGTGCAGCCAGTGCCTGCCGG - Intronic
1164764189 19:30751097-30751119 TGGCTGCAGGTGGTACCTGCTGG + Intergenic
1165999082 19:39866986-39867008 AGGCTGAAGCCCGGAACTGCTGG - Exonic
1166226216 19:41397246-41397268 AGGCTGCAGCCAGGACCCCGAGG + Exonic
1166765481 19:45250556-45250578 ATGCTGCAGCCCCAACCTGCGGG + Intronic
1167152214 19:47716828-47716850 CAGCTTCATCCAGTACCTGCTGG + Exonic
1167793492 19:51694530-51694552 GGGCAGCAGCCAGCTCCTGCAGG - Intergenic
1168103639 19:54153893-54153915 AGGCTCCAGGCAGCCCCTGCTGG + Intronic
1168317123 19:55489247-55489269 GGCCTACAGACAGTACCTGCAGG + Intronic
927894365 2:26771920-26771942 AGGCTGTAACCAGTACCAGTGGG - Intronic
928667656 2:33566728-33566750 TGGCTGCATCCAAAACCTGCTGG + Intergenic
929012243 2:37456598-37456620 AGGCAGCAGCCAGGACTTACAGG + Intergenic
929201483 2:39242118-39242140 TCACTGCAGCCTGTACCTGCTGG + Intergenic
934264331 2:91501633-91501655 TGGCTGCAGCCTCTACCTCCCGG + Intergenic
934523246 2:95033029-95033051 AGGCTGTGGCCAGGAACTGCAGG - Intronic
934614117 2:95760859-95760881 AGTCTGCAGCAAGAAGCTGCTGG + Intergenic
934646802 2:96063684-96063706 AGTCTGCAGCAAGAACCTGCTGG - Intergenic
934840204 2:97619766-97619788 AGTCTGCAGCAAGAACCTGCTGG - Intergenic
935257324 2:101322493-101322515 AAATTGCAGCCTGTACCTGCGGG - Intergenic
937471370 2:122176646-122176668 AAGCAGCAGCCCGTACCTGTGGG - Intergenic
937490196 2:122358975-122358997 AGGCTGCAGAGAGTTACTGCTGG + Intergenic
938065884 2:128281779-128281801 AGGCTGCTGCCAGGCCCTCCTGG - Intronic
938626386 2:133113674-133113696 AGCCTGCTTCCAGGACCTGCTGG + Intronic
939616275 2:144364966-144364988 AGGCTGCAGGCAGAAACTGATGG + Intergenic
940316323 2:152331079-152331101 AGGCTACAGCCAGTATCTGTAGG - Intergenic
940429204 2:153568290-153568312 TCGCTGCAGCCTGGACCTGCTGG + Intergenic
943704879 2:191023950-191023972 TGGCTGCAGCCAAGACCTCCTGG + Intergenic
944256376 2:197627053-197627075 AGGCAGCAGCCAGTCCCTACAGG - Intronic
946431656 2:219629689-219629711 AGGCTGCAGCCAGTACCTGCTGG - Exonic
947795970 2:232894224-232894246 AGGCTTCACACAGTCCCTGCTGG + Intronic
948233130 2:236366249-236366271 AGGCTGCAGCCGGTGTCTCCTGG + Intronic
948458193 2:238116998-238117020 GGACTGCGCCCAGTACCTGCGGG + Exonic
1168841334 20:911946-911968 AGGGAGCAGCCAGCAGCTGCTGG - Intronic
1169662769 20:7998580-7998602 AGGCTGAAGCCAGGTCATGCAGG - Intronic
1169869990 20:10239872-10239894 AGGCAGCAGCAAGAACCTACAGG + Intronic
1171246425 20:23613605-23613627 AGGCTGCAGAATGTGCCTGCAGG + Intergenic
1172950209 20:38718589-38718611 AGGCTGCAGGCAGGGCCTGCAGG - Intergenic
1173374366 20:42470358-42470380 AGGTTGCAGCCAGTTTTTGCTGG + Intronic
1173546757 20:43903720-43903742 AGGCTGCAGCCAAGGCCTGGGGG + Intergenic
1174125031 20:48298071-48298093 AGGCTGCAAACAGTATCAGCTGG + Intergenic
1174550794 20:51360152-51360174 AGGCTCCACCCAGGACCAGCAGG + Intergenic
1175938683 20:62527006-62527028 AGCCTGCAGCCTGTGCCTGCTGG - Intergenic
1176004189 20:62850799-62850821 AGCTGGCAGCCAGGACCTGCCGG - Intronic
1176304351 21:5115447-5115469 AGCACGCAGCCAGTGCCTGCGGG + Intergenic
1177142204 21:17369405-17369427 TCGCTGCAGCCAGAACCTCCAGG - Intergenic
1178597222 21:33964912-33964934 AGGATGCAGACAGTAACTTCTGG - Intergenic
1179728877 21:43356227-43356249 CGGCTGCCGCCTGTAACTGCTGG + Intergenic
1179852707 21:44146583-44146605 AGCACGCAGCCAGTGCCTGCAGG - Intergenic
1180554097 22:16561779-16561801 TGGCTGCAGCCTCTACCTCCCGG - Intergenic
1180788898 22:18563077-18563099 TGGCTGCCACCAGGACCTGCTGG - Intergenic
1180981820 22:19881924-19881946 AGGCTCCAGGCAGACCCTGCAGG - Intronic
1181232839 22:21432243-21432265 TGGCTGCCACCAGGACCTGCTGG + Intronic
1181245812 22:21502614-21502636 TGGCTGCCACCAGGACCTGCTGG - Intergenic
1181378410 22:22479404-22479426 AGCCAAGAGCCAGTACCTGCTGG + Intergenic
1181619837 22:24083239-24083261 TGGATGCAGCCAGTTCCTTCTGG - Exonic
1182228934 22:28821699-28821721 GTGATGCAGCCAGGACCTGCTGG + Intergenic
1182311373 22:29410907-29410929 TGGCTGCAGCCACAAACTGCAGG - Intronic
1182518996 22:30874787-30874809 AGGGAGCTGCCAGTACCTGAAGG - Intronic
1182642477 22:31779512-31779534 AGGTTCCAGCCAGTTCATGCAGG + Intronic
1182689603 22:32149382-32149404 TGGCTGCAGCCACAAACTGCAGG + Exonic
1184268837 22:43365953-43365975 AGGCTGGAGCCAGAATCTGGAGG + Intergenic
950473131 3:13198793-13198815 GAGCTGAAGCCAGTGCCTGCTGG + Intergenic
952700027 3:36317894-36317916 AGGCTGAAGCCAGATCCTACAGG - Intergenic
954373792 3:50183845-50183867 AGCCTGCCTCCAGCACCTGCAGG - Intronic
954590543 3:51778236-51778258 TGGCTGCAGCCAGGGCCAGCTGG - Intergenic
954594504 3:51813655-51813677 TGGCTGCAGCCAGGGCCAGCTGG + Intergenic
954664997 3:52246852-52246874 AGGCTGGGGCCACGACCTGCAGG + Intronic
954753506 3:52826775-52826797 AGGTAGCAGCAGGTACCTGCAGG + Exonic
957293432 3:78306669-78306691 AGGCTTCTGCCAGGACATGCAGG - Intergenic
957708128 3:83816449-83816471 ATTGTGCAGCCAGTACCTGGTGG - Intergenic
959946100 3:112126736-112126758 AGGCTGAAGGCAGTAACTGGGGG - Intronic
960574689 3:119218243-119218265 AGGCTGCTGGCACTCCCTGCAGG + Intronic
961456651 3:127027898-127027920 AGGCTGCAGCCAGGACCCCCGGG - Intronic
961468849 3:127098822-127098844 AGGCTCCACACAGTACCAGCAGG - Intergenic
961642763 3:128375212-128375234 GGGCTGCAGACAGTCCCTGGGGG + Intronic
963280967 3:143384327-143384349 AGGGAACAGCCAGCACCTGCTGG - Intronic
966913013 3:184569653-184569675 AGGCAGCAGCCATTCACTGCAGG - Intronic
968149634 3:196327017-196327039 TAGCTGCAGTGAGTACCTGCAGG + Exonic
968248787 3:197185251-197185273 AGGCTGCATCCAGTTGGTGCTGG - Intronic
968660250 4:1795820-1795842 AGGTTGCAGCCAGCACCTTCGGG - Intronic
970603288 4:17657315-17657337 AGGCTGCAGCAAGGAACTGAGGG - Intronic
974203519 4:58670314-58670336 AGACTGCAGCCAGCAGCTGGCGG - Intergenic
975973272 4:80068049-80068071 AGGCTGCACTCAGCATCTGCAGG + Intronic
977362666 4:96026029-96026051 GTGCTGCAGCCAGAAACTGCAGG - Intergenic
978361456 4:107934632-107934654 AGGCAGCAGCCAGATCCTTCAGG - Intronic
978525721 4:109663070-109663092 AGGCAGCAGCCAGTTTCTTCGGG + Intronic
979175012 4:117652075-117652097 AGCCTGCAGGCAGTAGCAGCAGG + Intergenic
979565837 4:122152899-122152921 AGGCTGCAGTCCGAGCCTGCGGG - Intronic
981606591 4:146546715-146546737 GGTCTCCAGCCAGCACCTGCTGG - Intergenic
985030282 4:185782027-185782049 AGGCAGAATGCAGTACCTGCGGG - Intronic
985636441 5:1038070-1038092 AGCCTTCAGCTACTACCTGCCGG + Exonic
986169758 5:5305887-5305909 AGGCTGCAGCCCCCACTTGCAGG - Intronic
988490091 5:31698815-31698837 AGGCTGCCGCCCGAATCTGCAGG - Intronic
990583355 5:57185907-57185929 AGGCTGCAACCTCTACCTCCTGG - Intronic
990744932 5:58950102-58950124 AGGCAGCAGCCAGCAGCAGCAGG - Intergenic
991460826 5:66856256-66856278 AGGGTGCAGGGAGAACCTGCAGG + Intronic
992055441 5:72984705-72984727 AGGCTGCAGCCTTGACCTCCTGG + Intronic
993421055 5:87701162-87701184 AGGTTGCAGCCAGCAGCTGCAGG - Intergenic
995988469 5:118208285-118208307 AGGCTGCAGGCGGCACTTGCAGG - Intergenic
996129456 5:119764171-119764193 AGGCTTCAACCATTACCTCCAGG - Intergenic
996791520 5:127298512-127298534 AGGGAGGAGCCAGTATCTGCAGG - Intronic
998140084 5:139694841-139694863 AGTTTGAAGCCAGTATCTGCAGG + Intergenic
1000698453 5:164418719-164418741 AGGCTCCAGCCAGTTCCAGGTGG - Intergenic
1001313264 5:170626047-170626069 AGGCTGGAACCAGACCCTGCAGG + Intronic
1001950358 5:175812272-175812294 AGAATGCAGCCAGCACCTGAGGG + Intronic
1002132645 5:177090973-177090995 AAACTGCATGCAGTACCTGCGGG + Exonic
1002426787 5:179181334-179181356 AGGCTGCCACCACCACCTGCTGG + Intronic
1002793056 6:449455-449477 GGGCTGCAGCCAGCACATTCTGG + Intergenic
1004477687 6:15989025-15989047 AAGCTGGAGCCAGCACCTGGGGG + Intergenic
1004966042 6:20852860-20852882 AGGATTCAGCCAGAATCTGCTGG + Intronic
1005063793 6:21798599-21798621 AGCCTGCAGCCTGGAACTGCTGG + Intergenic
1007333632 6:41135256-41135278 AGGCCACAGCCAGTAGCTACAGG + Intergenic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1007619554 6:43203681-43203703 AAGCTGCAGCCAGGACATGAGGG + Intronic
1011801368 6:91019750-91019772 AGGCAGGAGCCAGGTCCTGCAGG - Intergenic
1012231763 6:96768477-96768499 GGGCTGCAGCCAGCAGCAGCAGG + Intergenic
1014209949 6:118698046-118698068 AAGCTGCAGCCTGGACCAGCTGG + Intronic
1014240708 6:119015347-119015369 AGGCTGCACGCAGCACTTGCGGG + Intronic
1015116937 6:129660103-129660125 AGGCTGCCGCCAAATCCTGCAGG + Intronic
1016801393 6:148172906-148172928 AGGCTGAAGCCAGCACAGGCAGG - Intergenic
1017995385 6:159527651-159527673 TGGCTCCAGCCCCTACCTGCAGG + Intergenic
1018283794 6:162216117-162216139 TAGCTGCAGCCACTATCTGCAGG + Intronic
1019076621 6:169393416-169393438 AGGCTGCAGCCAGCAGCCGGTGG + Intergenic
1021464062 7:20921791-20921813 AGGCTGCAAGCAGCGCCTGCTGG - Intergenic
1027131228 7:75592630-75592652 AGGCTGCACCCAGCCACTGCAGG + Intronic
1027218938 7:76201994-76202016 AGGCGGCAGCCCGGACCGGCGGG + Exonic
1029212923 7:98923388-98923410 GTGCTGCAGCCAGTGCCGGCAGG - Intronic
1029529895 7:101118286-101118308 TCGCTGCAGCCACTACCTCCTGG - Intergenic
1033728250 7:144145360-144145382 AAGTAGCAGCCATTACCTGCAGG - Intergenic
1034293462 7:149950296-149950318 AGCCTGCAGGGAGCACCTGCTGG + Intergenic
1034812603 7:154146557-154146579 AGCCTGCAGGGAGCACCTGCTGG - Intronic
1034930101 7:155154742-155154764 AGGCTGCAGCAGGGACGTGCTGG + Intergenic
1035099227 7:156382617-156382639 TGGCAGCAGCCTGGACCTGCAGG + Intergenic
1035667186 8:1388029-1388051 TGGATGCAGCCAGTGCGTGCGGG + Intergenic
1036786795 8:11693015-11693037 AGGCTTCTGCCAGCGCCTGCGGG + Intronic
1038267187 8:26046262-26046284 AGGCTGCTGCCACCGCCTGCCGG - Intergenic
1043400643 8:79880928-79880950 AGGCTGCAGGAAGTTCGTGCAGG + Intergenic
1043638189 8:82413239-82413261 AGGCTGCAGCCTGGACTTGGAGG - Intergenic
1045198802 8:99957662-99957684 AAGCTGCAGCCACTATCTGGAGG + Intergenic
1045842615 8:106597347-106597369 AGGCTCCTTCCAGAACCTGCAGG + Intronic
1046595776 8:116259593-116259615 AGGCTTCCTTCAGTACCTGCAGG + Intergenic
1047415892 8:124664122-124664144 AGGCAGAAGCCAGCGCCTGCAGG + Intronic
1048244833 8:132782660-132782682 AGCCTGCAGCCTTTACCTCCCGG + Intronic
1048268457 8:133008651-133008673 GGGCTGGAGCCAGTTCTTGCAGG - Intronic
1049336992 8:142091918-142091940 AGGCTCTAGCCAGTACCTGGCGG + Intergenic
1049418339 8:142505640-142505662 AGGTTGGGGCCAGTCCCTGCGGG + Intronic
1049685131 8:143936320-143936342 AGGCTGCACCCTGCACCTCCCGG + Intronic
1050195178 9:3075392-3075414 AGGCTGCAGCCAGACCATGGAGG - Intergenic
1052246847 9:26346811-26346833 AGGCAGCAGACTGTCCCTGCAGG - Intergenic
1053218738 9:36294009-36294031 AGGCTGCAGTCAGAACCTGCTGG - Intronic
1053252280 9:36584790-36584812 TCACTGCAGCCTGTACCTGCTGG + Intronic
1056320525 9:85430702-85430724 ATGCTGCACCCAGTTCCTGGAGG + Intergenic
1057297761 9:93859480-93859502 AGGCTGGAGTCTGTACCTGGAGG - Intergenic
1058147240 9:101425612-101425634 AGACAGCAGCCAGGACCTGAAGG + Exonic
1059646815 9:116276130-116276152 TGCCTGCAGCCAGTGCCTGTTGG - Intronic
1060158196 9:121335000-121335022 AGGGTGCAGCTAGTACAGGCAGG + Intergenic
1060495273 9:124113650-124113672 AGGCAGCAGCCTGTCCCTGGAGG + Intergenic
1061300705 9:129703330-129703352 AGTCTGCAGCCAGGACCTGCAGG - Intronic
1062406380 9:136398687-136398709 AGGCTGCAACCAGCACAGGCAGG + Exonic
1062546297 9:137065078-137065100 TGGCTGCAGCCTGTGCCAGCCGG - Exonic
1062551506 9:137089585-137089607 ATGCTGCCTCCAGGACCTGCAGG - Intronic
1062572752 9:137193135-137193157 AGGCTCCAGGCAGCTCCTGCTGG + Intronic
1062644656 9:137541333-137541355 AAGCTGGAGCCAGTAGCTCCTGG - Intronic
1203668061 Un_KI270754v1:31080-31102 GTGCTGCAGCGAGGACCTGCCGG - Intergenic
1186519015 X:10189008-10189030 TGGCTGCTGCCAGTACATGACGG - Intronic
1187072673 X:15903604-15903626 AGGCTACAGGCAACACCTGCTGG - Intergenic
1192033776 X:67543526-67543548 AGGTTTCAGCAAGTATCTGCTGG + Intergenic
1192230629 X:69262450-69262472 AGGCTGGAGACAGCACATGCGGG - Intergenic
1197258147 X:124286600-124286622 AGGCTGAAGACAGGACCTGGGGG - Intronic
1198569386 X:137938927-137938949 AGGCTTCAGCCAGTTCCTTATGG - Intergenic
1199556426 X:149114137-149114159 AGGCTGGGTCCAGCACCTGCTGG - Intergenic
1200114891 X:153765656-153765678 AGGCTGCAGCCTGTATGTCCTGG - Intronic