ID: 946432240

View in Genome Browser
Species Human (GRCh38)
Location 2:219632019-219632041
Sequence CCTCCCGGACGCAGGGCGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 10, 3: 46, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946432231_946432240 9 Left 946432231 2:219631987-219632009 CCCTGGTGTGCGGCGACACTTAG 0: 1
1: 0
2: 0
3: 2
4: 35
Right 946432240 2:219632019-219632041 CCTCCCGGACGCAGGGCGGGAGG 0: 1
1: 0
2: 10
3: 46
4: 236
946432232_946432240 8 Left 946432232 2:219631988-219632010 CCTGGTGTGCGGCGACACTTAGT 0: 1
1: 0
2: 0
3: 2
4: 19
Right 946432240 2:219632019-219632041 CCTCCCGGACGCAGGGCGGGAGG 0: 1
1: 0
2: 10
3: 46
4: 236
946432229_946432240 24 Left 946432229 2:219631972-219631994 CCGACTGGAGGACAACCCTGGTG 0: 1
1: 0
2: 5
3: 8
4: 101
Right 946432240 2:219632019-219632041 CCTCCCGGACGCAGGGCGGGAGG 0: 1
1: 0
2: 10
3: 46
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946432240 Original CRISPR CCTCCCGGACGCAGGGCGGG AGG Exonic