ID: 946434745

View in Genome Browser
Species Human (GRCh38)
Location 2:219644121-219644143
Sequence TTAAATGAGTAAGGCTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946434745_946434749 -1 Left 946434745 2:219644121-219644143 CCCTGGCAGCCTTACTCATTTAA No data
Right 946434749 2:219644143-219644165 AAGACGACCCATCTATGGCAAGG No data
946434745_946434750 0 Left 946434745 2:219644121-219644143 CCCTGGCAGCCTTACTCATTTAA No data
Right 946434750 2:219644144-219644166 AGACGACCCATCTATGGCAAGGG No data
946434745_946434748 -6 Left 946434745 2:219644121-219644143 CCCTGGCAGCCTTACTCATTTAA No data
Right 946434748 2:219644138-219644160 ATTTAAAGACGACCCATCTATGG No data
946434745_946434759 28 Left 946434745 2:219644121-219644143 CCCTGGCAGCCTTACTCATTTAA No data
Right 946434759 2:219644172-219644194 GGCCGTAGTTTAGGAAGGGCAGG No data
946434745_946434758 24 Left 946434745 2:219644121-219644143 CCCTGGCAGCCTTACTCATTTAA No data
Right 946434758 2:219644168-219644190 GGGCGGCCGTAGTTTAGGAAGGG No data
946434745_946434755 7 Left 946434745 2:219644121-219644143 CCCTGGCAGCCTTACTCATTTAA No data
Right 946434755 2:219644151-219644173 CCATCTATGGCAAGGGAGGGCGG No data
946434745_946434756 19 Left 946434745 2:219644121-219644143 CCCTGGCAGCCTTACTCATTTAA No data
Right 946434756 2:219644163-219644185 AGGGAGGGCGGCCGTAGTTTAGG No data
946434745_946434757 23 Left 946434745 2:219644121-219644143 CCCTGGCAGCCTTACTCATTTAA No data
Right 946434757 2:219644167-219644189 AGGGCGGCCGTAGTTTAGGAAGG No data
946434745_946434752 4 Left 946434745 2:219644121-219644143 CCCTGGCAGCCTTACTCATTTAA No data
Right 946434752 2:219644148-219644170 GACCCATCTATGGCAAGGGAGGG No data
946434745_946434751 3 Left 946434745 2:219644121-219644143 CCCTGGCAGCCTTACTCATTTAA No data
Right 946434751 2:219644147-219644169 CGACCCATCTATGGCAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946434745 Original CRISPR TTAAATGAGTAAGGCTGCCA GGG (reversed) Intergenic