ID: 946434746

View in Genome Browser
Species Human (GRCh38)
Location 2:219644122-219644144
Sequence TTTAAATGAGTAAGGCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946434746_946434751 2 Left 946434746 2:219644122-219644144 CCTGGCAGCCTTACTCATTTAAA No data
Right 946434751 2:219644147-219644169 CGACCCATCTATGGCAAGGGAGG No data
946434746_946434756 18 Left 946434746 2:219644122-219644144 CCTGGCAGCCTTACTCATTTAAA No data
Right 946434756 2:219644163-219644185 AGGGAGGGCGGCCGTAGTTTAGG No data
946434746_946434758 23 Left 946434746 2:219644122-219644144 CCTGGCAGCCTTACTCATTTAAA No data
Right 946434758 2:219644168-219644190 GGGCGGCCGTAGTTTAGGAAGGG No data
946434746_946434748 -7 Left 946434746 2:219644122-219644144 CCTGGCAGCCTTACTCATTTAAA No data
Right 946434748 2:219644138-219644160 ATTTAAAGACGACCCATCTATGG No data
946434746_946434757 22 Left 946434746 2:219644122-219644144 CCTGGCAGCCTTACTCATTTAAA No data
Right 946434757 2:219644167-219644189 AGGGCGGCCGTAGTTTAGGAAGG No data
946434746_946434755 6 Left 946434746 2:219644122-219644144 CCTGGCAGCCTTACTCATTTAAA No data
Right 946434755 2:219644151-219644173 CCATCTATGGCAAGGGAGGGCGG No data
946434746_946434749 -2 Left 946434746 2:219644122-219644144 CCTGGCAGCCTTACTCATTTAAA No data
Right 946434749 2:219644143-219644165 AAGACGACCCATCTATGGCAAGG No data
946434746_946434759 27 Left 946434746 2:219644122-219644144 CCTGGCAGCCTTACTCATTTAAA No data
Right 946434759 2:219644172-219644194 GGCCGTAGTTTAGGAAGGGCAGG No data
946434746_946434761 30 Left 946434746 2:219644122-219644144 CCTGGCAGCCTTACTCATTTAAA No data
Right 946434761 2:219644175-219644197 CGTAGTTTAGGAAGGGCAGGAGG No data
946434746_946434750 -1 Left 946434746 2:219644122-219644144 CCTGGCAGCCTTACTCATTTAAA No data
Right 946434750 2:219644144-219644166 AGACGACCCATCTATGGCAAGGG No data
946434746_946434752 3 Left 946434746 2:219644122-219644144 CCTGGCAGCCTTACTCATTTAAA No data
Right 946434752 2:219644148-219644170 GACCCATCTATGGCAAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946434746 Original CRISPR TTTAAATGAGTAAGGCTGCC AGG (reversed) Intergenic