ID: 946434747

View in Genome Browser
Species Human (GRCh38)
Location 2:219644130-219644152
Sequence GGGTCGTCTTTAAATGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946434747_946434751 -6 Left 946434747 2:219644130-219644152 CCTTACTCATTTAAAGACGACCC No data
Right 946434751 2:219644147-219644169 CGACCCATCTATGGCAAGGGAGG No data
946434747_946434756 10 Left 946434747 2:219644130-219644152 CCTTACTCATTTAAAGACGACCC No data
Right 946434756 2:219644163-219644185 AGGGAGGGCGGCCGTAGTTTAGG No data
946434747_946434752 -5 Left 946434747 2:219644130-219644152 CCTTACTCATTTAAAGACGACCC No data
Right 946434752 2:219644148-219644170 GACCCATCTATGGCAAGGGAGGG No data
946434747_946434762 27 Left 946434747 2:219644130-219644152 CCTTACTCATTTAAAGACGACCC No data
Right 946434762 2:219644180-219644202 TTTAGGAAGGGCAGGAGGCGAGG No data
946434747_946434761 22 Left 946434747 2:219644130-219644152 CCTTACTCATTTAAAGACGACCC No data
Right 946434761 2:219644175-219644197 CGTAGTTTAGGAAGGGCAGGAGG No data
946434747_946434759 19 Left 946434747 2:219644130-219644152 CCTTACTCATTTAAAGACGACCC No data
Right 946434759 2:219644172-219644194 GGCCGTAGTTTAGGAAGGGCAGG No data
946434747_946434750 -9 Left 946434747 2:219644130-219644152 CCTTACTCATTTAAAGACGACCC No data
Right 946434750 2:219644144-219644166 AGACGACCCATCTATGGCAAGGG No data
946434747_946434758 15 Left 946434747 2:219644130-219644152 CCTTACTCATTTAAAGACGACCC No data
Right 946434758 2:219644168-219644190 GGGCGGCCGTAGTTTAGGAAGGG No data
946434747_946434755 -2 Left 946434747 2:219644130-219644152 CCTTACTCATTTAAAGACGACCC No data
Right 946434755 2:219644151-219644173 CCATCTATGGCAAGGGAGGGCGG No data
946434747_946434749 -10 Left 946434747 2:219644130-219644152 CCTTACTCATTTAAAGACGACCC No data
Right 946434749 2:219644143-219644165 AAGACGACCCATCTATGGCAAGG No data
946434747_946434763 28 Left 946434747 2:219644130-219644152 CCTTACTCATTTAAAGACGACCC No data
Right 946434763 2:219644181-219644203 TTAGGAAGGGCAGGAGGCGAGGG No data
946434747_946434757 14 Left 946434747 2:219644130-219644152 CCTTACTCATTTAAAGACGACCC No data
Right 946434757 2:219644167-219644189 AGGGCGGCCGTAGTTTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946434747 Original CRISPR GGGTCGTCTTTAAATGAGTA AGG (reversed) Intergenic