ID: 946434753

View in Genome Browser
Species Human (GRCh38)
Location 2:219644150-219644172
Sequence CGCCCTCCCTTGCCATAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946434753_946434756 -10 Left 946434753 2:219644150-219644172 CCCATCTATGGCAAGGGAGGGCG No data
Right 946434756 2:219644163-219644185 AGGGAGGGCGGCCGTAGTTTAGG No data
946434753_946434763 8 Left 946434753 2:219644150-219644172 CCCATCTATGGCAAGGGAGGGCG No data
Right 946434763 2:219644181-219644203 TTAGGAAGGGCAGGAGGCGAGGG No data
946434753_946434758 -5 Left 946434753 2:219644150-219644172 CCCATCTATGGCAAGGGAGGGCG No data
Right 946434758 2:219644168-219644190 GGGCGGCCGTAGTTTAGGAAGGG No data
946434753_946434757 -6 Left 946434753 2:219644150-219644172 CCCATCTATGGCAAGGGAGGGCG No data
Right 946434757 2:219644167-219644189 AGGGCGGCCGTAGTTTAGGAAGG No data
946434753_946434761 2 Left 946434753 2:219644150-219644172 CCCATCTATGGCAAGGGAGGGCG No data
Right 946434761 2:219644175-219644197 CGTAGTTTAGGAAGGGCAGGAGG No data
946434753_946434759 -1 Left 946434753 2:219644150-219644172 CCCATCTATGGCAAGGGAGGGCG No data
Right 946434759 2:219644172-219644194 GGCCGTAGTTTAGGAAGGGCAGG No data
946434753_946434762 7 Left 946434753 2:219644150-219644172 CCCATCTATGGCAAGGGAGGGCG No data
Right 946434762 2:219644180-219644202 TTTAGGAAGGGCAGGAGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946434753 Original CRISPR CGCCCTCCCTTGCCATAGAT GGG (reversed) Intergenic