ID: 946434754

View in Genome Browser
Species Human (GRCh38)
Location 2:219644151-219644173
Sequence CCGCCCTCCCTTGCCATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946434754_946434759 -2 Left 946434754 2:219644151-219644173 CCATCTATGGCAAGGGAGGGCGG No data
Right 946434759 2:219644172-219644194 GGCCGTAGTTTAGGAAGGGCAGG No data
946434754_946434763 7 Left 946434754 2:219644151-219644173 CCATCTATGGCAAGGGAGGGCGG No data
Right 946434763 2:219644181-219644203 TTAGGAAGGGCAGGAGGCGAGGG No data
946434754_946434762 6 Left 946434754 2:219644151-219644173 CCATCTATGGCAAGGGAGGGCGG No data
Right 946434762 2:219644180-219644202 TTTAGGAAGGGCAGGAGGCGAGG No data
946434754_946434761 1 Left 946434754 2:219644151-219644173 CCATCTATGGCAAGGGAGGGCGG No data
Right 946434761 2:219644175-219644197 CGTAGTTTAGGAAGGGCAGGAGG No data
946434754_946434757 -7 Left 946434754 2:219644151-219644173 CCATCTATGGCAAGGGAGGGCGG No data
Right 946434757 2:219644167-219644189 AGGGCGGCCGTAGTTTAGGAAGG No data
946434754_946434758 -6 Left 946434754 2:219644151-219644173 CCATCTATGGCAAGGGAGGGCGG No data
Right 946434758 2:219644168-219644190 GGGCGGCCGTAGTTTAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946434754 Original CRISPR CCGCCCTCCCTTGCCATAGA TGG (reversed) Intergenic