ID: 946434757

View in Genome Browser
Species Human (GRCh38)
Location 2:219644167-219644189
Sequence AGGGCGGCCGTAGTTTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946434746_946434757 22 Left 946434746 2:219644122-219644144 CCTGGCAGCCTTACTCATTTAAA No data
Right 946434757 2:219644167-219644189 AGGGCGGCCGTAGTTTAGGAAGG No data
946434747_946434757 14 Left 946434747 2:219644130-219644152 CCTTACTCATTTAAAGACGACCC No data
Right 946434757 2:219644167-219644189 AGGGCGGCCGTAGTTTAGGAAGG No data
946434745_946434757 23 Left 946434745 2:219644121-219644143 CCCTGGCAGCCTTACTCATTTAA No data
Right 946434757 2:219644167-219644189 AGGGCGGCCGTAGTTTAGGAAGG No data
946434753_946434757 -6 Left 946434753 2:219644150-219644172 CCCATCTATGGCAAGGGAGGGCG No data
Right 946434757 2:219644167-219644189 AGGGCGGCCGTAGTTTAGGAAGG No data
946434754_946434757 -7 Left 946434754 2:219644151-219644173 CCATCTATGGCAAGGGAGGGCGG No data
Right 946434757 2:219644167-219644189 AGGGCGGCCGTAGTTTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946434757 Original CRISPR AGGGCGGCCGTAGTTTAGGA AGG Intergenic