ID: 946434759

View in Genome Browser
Species Human (GRCh38)
Location 2:219644172-219644194
Sequence GGCCGTAGTTTAGGAAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946434754_946434759 -2 Left 946434754 2:219644151-219644173 CCATCTATGGCAAGGGAGGGCGG No data
Right 946434759 2:219644172-219644194 GGCCGTAGTTTAGGAAGGGCAGG No data
946434747_946434759 19 Left 946434747 2:219644130-219644152 CCTTACTCATTTAAAGACGACCC No data
Right 946434759 2:219644172-219644194 GGCCGTAGTTTAGGAAGGGCAGG No data
946434746_946434759 27 Left 946434746 2:219644122-219644144 CCTGGCAGCCTTACTCATTTAAA No data
Right 946434759 2:219644172-219644194 GGCCGTAGTTTAGGAAGGGCAGG No data
946434753_946434759 -1 Left 946434753 2:219644150-219644172 CCCATCTATGGCAAGGGAGGGCG No data
Right 946434759 2:219644172-219644194 GGCCGTAGTTTAGGAAGGGCAGG No data
946434745_946434759 28 Left 946434745 2:219644121-219644143 CCCTGGCAGCCTTACTCATTTAA No data
Right 946434759 2:219644172-219644194 GGCCGTAGTTTAGGAAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946434759 Original CRISPR GGCCGTAGTTTAGGAAGGGC AGG Intergenic