ID: 946434763

View in Genome Browser
Species Human (GRCh38)
Location 2:219644181-219644203
Sequence TTAGGAAGGGCAGGAGGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946434753_946434763 8 Left 946434753 2:219644150-219644172 CCCATCTATGGCAAGGGAGGGCG No data
Right 946434763 2:219644181-219644203 TTAGGAAGGGCAGGAGGCGAGGG No data
946434747_946434763 28 Left 946434747 2:219644130-219644152 CCTTACTCATTTAAAGACGACCC No data
Right 946434763 2:219644181-219644203 TTAGGAAGGGCAGGAGGCGAGGG No data
946434754_946434763 7 Left 946434754 2:219644151-219644173 CCATCTATGGCAAGGGAGGGCGG No data
Right 946434763 2:219644181-219644203 TTAGGAAGGGCAGGAGGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946434763 Original CRISPR TTAGGAAGGGCAGGAGGCGA GGG Intergenic