ID: 946435127

View in Genome Browser
Species Human (GRCh38)
Location 2:219646346-219646368
Sequence GGAGCTCATGCAGCTTTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946435122_946435127 -1 Left 946435122 2:219646324-219646346 CCTTGCGCTCTAGGGCCACCAGG No data
Right 946435127 2:219646346-219646368 GGAGCTCATGCAGCTTTTCTAGG No data
946435119_946435127 9 Left 946435119 2:219646314-219646336 CCATAGCGGTCCTTGCGCTCTAG No data
Right 946435127 2:219646346-219646368 GGAGCTCATGCAGCTTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946435127 Original CRISPR GGAGCTCATGCAGCTTTTCT AGG Intergenic
No off target data available for this crispr