ID: 946437234

View in Genome Browser
Species Human (GRCh38)
Location 2:219665376-219665398
Sequence TTCTGGCCTGTCCTTAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946437230_946437234 -8 Left 946437230 2:219665361-219665383 CCTGCCAGAAATGGGTTCTGGCC No data
Right 946437234 2:219665376-219665398 TTCTGGCCTGTCCTTAAGAGGGG No data
946437222_946437234 22 Left 946437222 2:219665331-219665353 CCAGATCACCATTTGGGCTGGCA No data
Right 946437234 2:219665376-219665398 TTCTGGCCTGTCCTTAAGAGGGG No data
946437225_946437234 14 Left 946437225 2:219665339-219665361 CCATTTGGGCTGGCAGGGCCAAC No data
Right 946437234 2:219665376-219665398 TTCTGGCCTGTCCTTAAGAGGGG No data
946437221_946437234 23 Left 946437221 2:219665330-219665352 CCCAGATCACCATTTGGGCTGGC No data
Right 946437234 2:219665376-219665398 TTCTGGCCTGTCCTTAAGAGGGG No data
946437228_946437234 -4 Left 946437228 2:219665357-219665379 CCAACCTGCCAGAAATGGGTTCT No data
Right 946437234 2:219665376-219665398 TTCTGGCCTGTCCTTAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946437234 Original CRISPR TTCTGGCCTGTCCTTAAGAG GGG Intergenic
No off target data available for this crispr