ID: 946442813

View in Genome Browser
Species Human (GRCh38)
Location 2:219711199-219711221
Sequence CTTTCCTAGCTTCTGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946442811_946442813 13 Left 946442811 2:219711163-219711185 CCAGGATAAATCTGCTTTGGGCT No data
Right 946442813 2:219711199-219711221 CTTTCCTAGCTTCTGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946442813 Original CRISPR CTTTCCTAGCTTCTGGAAAA AGG Intergenic
No off target data available for this crispr