ID: 946444575

View in Genome Browser
Species Human (GRCh38)
Location 2:219727267-219727289
Sequence TATTTTACTTTAGAAAGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946444575_946444581 24 Left 946444575 2:219727267-219727289 CCAAGACTTTCTAAAGTAAAATA No data
Right 946444581 2:219727314-219727336 GGAGATTCAATAAAAGGTGGAGG No data
946444575_946444582 25 Left 946444575 2:219727267-219727289 CCAAGACTTTCTAAAGTAAAATA No data
Right 946444582 2:219727315-219727337 GAGATTCAATAAAAGGTGGAGGG No data
946444575_946444580 21 Left 946444575 2:219727267-219727289 CCAAGACTTTCTAAAGTAAAATA No data
Right 946444580 2:219727311-219727333 GAGGGAGATTCAATAAAAGGTGG No data
946444575_946444577 2 Left 946444575 2:219727267-219727289 CCAAGACTTTCTAAAGTAAAATA No data
Right 946444577 2:219727292-219727314 GGCTTTAACAGAGAATCTTGAGG No data
946444575_946444579 18 Left 946444575 2:219727267-219727289 CCAAGACTTTCTAAAGTAAAATA No data
Right 946444579 2:219727308-219727330 CTTGAGGGAGATTCAATAAAAGG No data
946444575_946444578 3 Left 946444575 2:219727267-219727289 CCAAGACTTTCTAAAGTAAAATA No data
Right 946444578 2:219727293-219727315 GCTTTAACAGAGAATCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946444575 Original CRISPR TATTTTACTTTAGAAAGTCT TGG (reversed) Intergenic