ID: 946444578

View in Genome Browser
Species Human (GRCh38)
Location 2:219727293-219727315
Sequence GCTTTAACAGAGAATCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946444575_946444578 3 Left 946444575 2:219727267-219727289 CCAAGACTTTCTAAAGTAAAATA No data
Right 946444578 2:219727293-219727315 GCTTTAACAGAGAATCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946444578 Original CRISPR GCTTTAACAGAGAATCTTGA GGG Intergenic