ID: 946447830

View in Genome Browser
Species Human (GRCh38)
Location 2:219754812-219754834
Sequence CTAGTCCACAAGGTCTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946447823_946447830 0 Left 946447823 2:219754789-219754811 CCTGGAGTCACTCCACCACCTGG No data
Right 946447830 2:219754812-219754834 CTAGTCCACAAGGTCTCTCTGGG No data
946447822_946447830 1 Left 946447822 2:219754788-219754810 CCCTGGAGTCACTCCACCACCTG No data
Right 946447830 2:219754812-219754834 CTAGTCCACAAGGTCTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946447830 Original CRISPR CTAGTCCACAAGGTCTCTCT GGG Intergenic
No off target data available for this crispr