ID: 946449949

View in Genome Browser
Species Human (GRCh38)
Location 2:219771346-219771368
Sequence CCCAGCACTTTGAGAGCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946449949_946449952 6 Left 946449949 2:219771346-219771368 CCTCTTGCTCTCAAAGTGCTGGG No data
Right 946449952 2:219771375-219771397 GGTGTCAGCTACCACACGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946449949 Original CRISPR CCCAGCACTTTGAGAGCAAG AGG (reversed) Intergenic
No off target data available for this crispr