ID: 946458067

View in Genome Browser
Species Human (GRCh38)
Location 2:219845259-219845281
Sequence TTGAGGCAGGATGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946458061_946458067 -3 Left 946458061 2:219845239-219845261 CCAAGAAATGAAGGAGGCAGTTG No data
Right 946458067 2:219845259-219845281 TTGAGGCAGGATGAGGAGGAGGG No data
946458058_946458067 16 Left 946458058 2:219845220-219845242 CCAGAAGTTAAAGTGCTGACCAA No data
Right 946458067 2:219845259-219845281 TTGAGGCAGGATGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946458067 Original CRISPR TTGAGGCAGGATGAGGAGGA GGG Intergenic
No off target data available for this crispr